Mycelial Mats Research Articles

Leaf Spot Disease Caused by Pestalotiopsis kenyana on Zanthoxylum schinifolium in Sichuan Province, China.

Zanthoxylum schinifolium Sieb. et Zucc, a species of prickly ash, is one of the main economic plants in China and mainly grown in Southwest China. The planting area of Z. schinifolium accounts for more than 70% of the total area of prickly ash, and one of the largest plantings of Z. schinifolium is located in Jianyang City (Sichuan) with the area of 6.67 km2. Since 2018, Z. schinifolium, located in Jianyang City, have developed leaf spot disease, with approximately 50% showing disease symptoms. At the beginning of the occurrence, yellow-brown lesions formed on the leaves; in the later stages, the area of the lesions expanded. At the severe stage, multiple lesions merged into one large, dead spot, and the plants failed to blossom and bear fruit. The samples were collected from typical symptoms of Z. schinifolium leaves in Jianyang City. A total of 20 leaf samples were collected from 5 Z. schinifolium plants (4 leaves per plant), and were cut into small pieces of 2 × 2mm at the junction of infected and healthy tissues. These tissues were surface-disinfested for 30 s in 3% sodium hypochlorite and the for 60 s in 75% ethanol, rinsed three times in sterile water, placed onto potato dextrose agar (PDA) amended with streptomycin sulfate (50 µg/ml), and incubated in a dark incubator at 25°C. Morphological observation was performed on 18 recovered isolates, 15 of which were described as Pestalotiopsis sp. The colonies were incubated on PDA at 25°C for 7 days and reached a diameter of 80-90 mm. The colonies were white with undulating edges and were similar in colors on the reverse side. After colony culture at 25°C for 10 days, gregarious black conidiomata were scattered on the mycelial mats. The conidia and appendages of the samples were measured by Leica Application Suite X 3.4.1.17822 (20 conidia per isolate), and the sizes of which were consistent with the description from Maharachchikumbura et al. Based on morphological observations, the isolates were identified as Pestalotiopsis kenyana Maharachch., K.D. Hyde & Crous. PCR was performed with primers ITS1/ITS4 for the ITS region, primers D1/D2 for the large subunit ribosomal RNA gene (LSU), primers 5f2/7cr for the RNA polymerase II second largest subunit (RPB2), primers Bt2a/Bt2b for the β-tubulin gene (TUB), and primers EF1-526F/EF2-567R for the translation elongation factor 1-alpha gene (TEF). The Sanger-sequenced PCR products were sequenced and blasted in GenBank, and the sequences showed that ITS: 99.17% (594 out of 599 bp), LSU: 100% (909 out of 909 bp), RPB2: 99.17% (832 out of 832 bp), TUB: 100% (774 out of 774 bp), TEF: 100% (485 out of 485 bp) with the type specimen of P. kenyana CBS 442.67 (ITS: GenBank accession NR147549.1, LSU: MH870724.1, PRB2: MH554958.1, TUB: KM199395.1, TEF: KM199502.1). Representative sequences were deposited in GenBank (ITS: MT509798; LSU: MT509800; RPB2: MT522448; TUB: MT522450; TEF: MT522449). To fulfill Koch's postulates, leaves on fifteen one-year-old healthy potted Z. schinifolium plants were sterilized by 75% ethanol cotton balls, and were rinsed by sterile water for three times. Then each leaf was punctured with sterile needles for two wounds (five leaves per plant). The wounds were inoculated by placing 8 mm mycelial plugs obtained from the periphery of 7-day-old single-spore cultures. An equal number of plants were wounded with the same method, and were respectively inoculated with sterile water and PDA plugs without mycelium as controls. All plants were placed in a growth chamber at 25°C under 90% relative humidity. After 7 days, all mycelial-inoculated leaves of the plants showed symptoms identical to those described above, whereas the control plants remained symptom free. P. kenyana was re-isolated from the infected leaves and confirmed to be the same as the inoculated pathogen through analyses of morphological characteristics and molecular techniques. The pathogenicity test was repeated three times with similar results. To our knowledge, this is the first report of P. kenyana as a causal agent of leaf spot disease on Z. schinifolium in China. These findings will aid the development of better preventive measures in accordance with the emergence of this new pathogen.

First Report of Postharvest Fruit Rot Disease of Hardy Kiwifruit Caused by Diaporthe eres in China.

Hardy kiwifruit (Actinidia arguta), as an economically important fruit crop growing in Northeast China with thin, hairless and smooth skin, is susceptible to postharvest decay. In September 2018, infected cultivar Kwilv fruits were obtained from a commercial farm in Liaoning province, northeastern China. The occurring incidence of the rot disease varied from 20% to 90% according to the fruit number in each box during a 7-day-long storage at room temperature, and the initial symptom included a small, soft, chlorosis to light brown lesion and later watery brown lesions. Pure cultures of the same characteristics were obtained from the isolated strains in four rotten fruits on PDA medium. The isolates grew into transparent radial mycelium on PDA in the first two days followed by abundant white, fluffy aerial mycelium. After 14 days, colonies formed white to light brown aerial mycelial mats with gray concentric rings, and they produced gray and embedded pycnidia. Alpha conidia of 4.4 to 8.8 µm × 1.4 to 3.3 µm (n = 50) were abundant in culture, hyaline, aseptate, ellipsoidal to fusiform, while Beta conidia at 20.5 to 28.6 µm × 1.0 to 1.4 µm (n = 50) were hyaline, long, slender, curved to hamate. These morphological characteristics were similar to Diaporthe species (anamorph: Phomopsis spp.) (Udayanga et al. 2014). For identification, DNA was extracted from three single isolates respectively , and the internal transcribed spacer (ITS) region, β-tubulin (BT), and histone (HIS) H3 gene were amplified by using primers ITS1/ITS4 (White et al. 1990), T1/T22 (O'Donnell et al. 1997) and HIS1F/HISR (Gao et al. 2017), respectively. The three isolates produced identical sequences across all three gene regions, which were submitted to NCBI (Genbank accession numbers MT561361, MT561360 and MT855966). Nucleotide BLAST analysis revealed that the ITS sequence shared 99% homology with those of ex-type Diaporthe eres in NCBI GenBank (MG281047.1 and KJ210529.1), so did the BT sequence that had 98% identity to D. eres (MG281256.1 and KJ420799.1) and the HIS 99% identity to D. eres (MG28431.1 and MG281395.1) (Hosseini et al. 2020, Udayanga et al. 2014). Pathogenicity was tested by wound inoculation on the cv. Kwilv fruits. Five mature and healthy fruits were surface-sterilized with 1% NaClO solution, rinsed in sterile distilled water and dried. Every fruit was wounded by penetrate the peel 1-2 mm with a sterile needle, and inoculated with mycelium plugs (5 mm in diameter) of the isolate on PDA, with five inoculated with sterile PDA plugs as controls. Treated fruits were kept in sterilized transparent plastic cans separately under high humidity (RH 90 to 100%) at 28°C. After five days, the same rot symptoms were observed on all fruits inoculated with mycelium while the control remained symptomless. The fungi was re-isolated from the lesions of inoculated fruits and identified as D. eres by sequencing, thus fulfilling Koch's postulates. The pathogenicity experiment was re-performed using D. eres conidial suspension (107 conidia/ml) in sterile distilled water in October 2019 and the same results were obtained. D. eres was recently reported to cause European pear rot in Italy (Bertetti et al. 2018). To our knowledge, this is the first report of D. eres causing a postharvest rot in hardy kiwifruit in China, leading to severe disease and thus huge economic losses in Northeast China. Accordingly, effective measures should be taken to prevent its spreading to other production regions in China.

First Report of Crown and Root Rot Caused by Pythium myriotylum on Hemp (Cannabis sativa) in Arizona.

During August and September 2020, symptoms of leaf chlorosis, stunting, and wilting were observed on indoor hemp plants (Cannabis sativa L. cv. 'Wedding Cake') in a commercial indoor facility located in Coolidge, Arizona. Plants were grown in soilless coconut coir growing medium (Worm Factory COIR250G10), watered with 1.5 to 2.1 liters every 24 h through drip irrigation, and supplemented with 18 h of lighting. About 35% of plants displayed symptoms as described above and many symptomatic plants collapsed. To identify the causal agent, crown and root tissues from four symptomatic plants were harvested and rinsed with tap water. Tissue fragments (approx. 2 to 4 mm in size) were excised from the margins of the stem and root lesions, surface sterilized in 0.6% sodium hypochlorite for 1 min, rinsed well in sterile distilled water, blotted dry, and plated on potato dextrose agar (PDA) and on oomycete-selective clarified V8 media containing pimaricin, ampicillin, rifampicin, and pentachloronitrobenzene (PARP). Plates were incubated at room temperature (21-24 oC). Five isolates resembling Pythium were transferred after 3 days and maintained on clarified V8 media. Morphological characteristics were observed on grass blade cultures (Waterhouse 1967). Grass blades were placed on CV8 inoculated with the isolate. After a 1-day incubation at 25°C, the colonized blades were transferred to 8 ml of soil water extract in a Petri dish. Ten sporangia and oogonia were selected randomly and their diameters were measured under the microscope. Sporangia were mostly filamentous, undifferentiated or inflated lobulate, ranging from 7 to 17 µm in diameter. Knob-like appressoria were observed on branching clusters. Bulbous-like antheridia were formed on branched stalk with 1-8 antheridia per oogonium. Globose oogonia were terminal or intercalary and ranged from 21 to 33 µm in diameter. Globose oospores were mostly aplerotic and ranged from 15 to 21 μm in diameter. Based on these morphological characteristics, isolates were tentatively identified as Pythium myriotylum (Watanabe, 2002). Genomic DNA was extracted from mycelial mats of two isolates using DNeasy Plant Pro Kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. The internal transcribed spacer (ITS) region of rDNA was amplified with primers ITS1/ITS4 and two identical nucleotide sequences were obtained and deposited under accession number MW380925. A BLASTn search revealed ≥ 98% query coverage and 100% match with sequences HQ237488.1, KY019264.1, and KM434129, which were isolates of P. myriotylum from palm, tobacco, and ginger, respectively. To fulfill Koch's postulates, pathogenicity tests were conducted with 2 isolates using plants of 'Wedding Cake' grown in 12 1.9-liter pots filled with a steam-disinfested potting mix (Sungro Professional Growing Mix). Pots were placed in a plastic container and watered to flooding three times a week. Plants were maintained in a greenhouse with 18 h/10 h day/night supplemental light cycle (15-28 oC). Plants were fertilized weekly with Peters Professional fertilizer at 1mg/ml. Four plants were inoculated with each isolate at three weeks after seed sowing by placing two 5-mm mycelial plugs from active growing 4 days-old cultures on PDA media adjacent to the main root mass at an approximately 3 cm depth. Four plants were inoculated with blank PDA plugs as controls. Symptoms of leaf chlorosis, crown rot and wilting were observed after four weeks while control plants remained symptomless. P. myriotylum was re-isolated from necrotic roots of inoculated plants after surface-sterilization, but not from control plants. The pathogenicity test was repeated once. While P. myriotylum often occurs in warmer regions and has a wide host range of >100 host plant species including numerous economically important crops (Wang et al., 2003), there are only two reports of this pathogen on indoor hemp plants in a greenhouse in Connecticut (McGehee et al., 2019) and in Canada (Punja et al., 2019). This is the first report of P. myriotylum causing root and crown rot of indoor hemp in Arizona. A more careful water management in soilless growth medium to reduce periods of saturation would minimize the risk of Pythium root rot in indoor hemp production.

An exploratory MALDI-TOF MS library based on SARAMIS superspectra for rapid identification of Aspergillus section Nigri.

Matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) is a broadly used technique for identification and typing of microorganisms. However, its application to filamentous fungi has been delayed. The objective of this study was to establish a data library for rapid identification of the genus Aspergillus sect. Nigri using MALDI-TOF MS. With respect to sample preparation, we compared the utility of using mature mycelia, including conidial structures, to accumulate a wider range of proteins versus the conventional method relying on young hyphae. Mass spectral datasets obtained for 61 strains of 17 species were subjected to cluster analysis and compared with a phylogenetic tree based on calmodulin gene sequences. Specific and frequent mass spectral peaks corresponding to each phylogenetic group were selected (superspectra for the SARAMIS system). Fifteen superspectra representing nine species were ultimately created. The percentage of correct identification for 217 spectra was improved from 36.41% to 86.64% using the revised library. Additionally, 2.76% of the spectra were assigned to candidates that comprised several related species, including the correct species.

Brown Felt on Persimmon (Diospyros kaki) Caused by Septobasidium sp. in Korea

In 2020, a brown felt was observed on persimmon (Diospyros kaki) in persimmon orchards, Sangju, Korea. The symptom on persimmon was white to grey mycelial mats on some areas of the branches. Each mat progressively expanded until the mats coalesced to occupy larger areas and finally girdled the branches. The disease branches were covered with brown-colored mold, consisting of hyphal mats of the pathogen. Optimum temperature for mycelial growth was 30oC. On the basis of mycological characteristics, pathogenicity test, and molecular analysis with complete internal transcribed spacer rDNA region, the causal fungus was identified as Septobasidium sp. This is the first report of brown felt caused by Septobasidium sp. on persimmon in Korea.

Long noncoding RNAs are potentially involved in the degeneration of virulence in an aphid-obligate pathogen, Conidiobolus obscurus (Entomophthoromycotina)

ABSTRACT Virulence attenuation frequently occurs in in vitro culturing of pathogenic microbes. In this study, we investigated the total putative long noncoding RNAs (lncRNAs) in an aphid-obligate pathogen, Conidiobolus obscurus, and screened the differentially expressed (DE) lncRNAs and protein-coding genes involved in the virulence decline. The virulence was significantly attenuated after eight subculturing events, in which the median lethal concentration of the conidia ejected from mycelial mats relative to the bamboo aphid, Takecallis taiwanus, increased from 36.1 to 126.1 conidia mm–2, four days after inoculation. In total, 1,252 lncRNAs were identified based on the genome-wide transcriptional analysis. By characterizing their molecular structures and expression patterns, we found that the lncRNAs possessed shorter transcripts, lower expression, and fewer exons than did protein-coding genes in C. obscurus. A total of 410 DE genes of 329 protein-coding genes and 81 lncRNAs were identified. The functional enrichment analysis showed the DE genes were enriched in peptidase activity, protein folding, autophagy, and metabolism. Moreover, target prediction analysis of the 81 lncRNAs revealed 3,111 cis-regulated and 23 trans-regulated mRNAs, while 121 DE lncRNA-mRNA pairs were possibly involved in virulence decline. Moreover, the DE lncRNA-regulated target genes mainly encoded small heat shock proteins, secretory proteins, transporters, autophagy proteins, and other stress response-related proteins. This implies that the decline in virulence regulated by lncRNAs was likely associated with the environmental stress response of C. obscurus. Hence, these findings can provide insights into the lncRNA molecules of Entomophthoromycotina, with regards to virulence regulators of entomopathogens.

Assessing the efficiency of different solvents for detecting gliotoxin from soil, organic manures and crop plant

ABSTRACT Trichoderma virens produces gliotoxin and it is considered as a potent antibiotic against several soil-borne fungal and bacterial pathogens infecting crop plants. There is no study on the fate of gliotoxin especially its persistence in soil and crop plants. For precise analysis of its persistence, dissipation and movement of gliotoxin in soil ecosystem, it is important to find a suitable solvent that effectively extract the gliotoxin from soil and crop plant. In this study, various commonly used polar and non-polar solvents were assessed for their efficiency on extraction of gliotoxin from agricultural soil, farm yard manure (FYM), coir pith, tomato plants and from the mycelial mat of T. virens. Chloroform was found to be the effective solvent for the extraction of gliotoxin from soil, FYM and coir pith with extraction efficiency of 85%, 79% and 72%, respectively. Ethyl acetate extracted the maximum amount of gliotoxin from tomato leaves and roots with 79% and 72% extraction efficiency. Methanol effectively extracted gliotoxin from the mycelium of T. virens. From this study, it is concluded that chloroform and ethyl acetate are suitable for the extraction and detection of gliotoxin from the soil ecosystem and crop plants, respectively.

Pathogenicity against hemipteran vector insects of a novel insect pathogenic fungus from Entomophthorales (Pandora sp. nov. inedit.) with potential for biological control

A new but still unpublished entomopathogenic fungus (ARSEF13372) in the genus Pandora (Entomophthorales: Entomophthoraceae) was originally isolated from Cacopsylla sp. (Hemiptera: Psyllidae). Several species of the genus Cacopsylla vector phloem-borne bacteria of the genus ‘Candidatus Phytoplasma‘, which cause diseases in fruit crops such as apple proliferation, pear decline and European stone fruit yellows. To determine Pandora’s host range and biocontrol potential we conducted laboratory infection bioassays; Hemipteran phloem-feeding insects were exposed to conidia actively discharged from in vitro produced mycelial mats of standardized area. We documented the pathogenicity of Pandora sp. nov. to species of the insect families Psyllidae and Triozidae, namely Cacopsyllapyri L., C.pyricola (Foerster), C.picta (Foerster, 1848), C.pruni (Scopoli), C.peregrina (Foerster), and Trioza apicalis Foerster. The occurrence of postmortem signs of infection on cadavers within 10 days post inoculation proved that Pandora sp. nov. was infective to the tested insect species under laboratory conditions and significantly reduced mean survival time for C.pyri (summer form and nymph), C.pyricola, C.picta, C.pruni, C.peregrina and T.apicalis. Assessing a potential interaction between phytoplasma, fungus and insect host revealed that phytoplasma infection (‘Candidatus Phytoplasma mali’) of the vector C.picta and/or its host plant apple Malus domestica Borkh. did not significantly impact the survival of C.picta after Pandora sp. nov. infection. The results from infection bioassays were discussed in relation to Pandora sp. nov. host range and its suitability as biocontrol agent in integrated pest management strategies of psyllid pests, including vector species, in orchards.

Growth Characteristics of Polyporales Mushrooms for the Mycelial Mat Formation

Mushroom strains of Polyporales from the genera Coriolus, Trametes, Pycnoporus, Ganoderma, and Formitella were explored in terms of mycelial growth characteristics for the application of mushroom mycelia as alternative sources of materials replacing fossil fuel-based materials. Among the 64 strains of Polyporales, G. lucidum LBS5496GL was selected as the best candidate because it showed fast mycelial growth with high mycelial strength in both the sawdust-based solid medium and the potato dextrose liquid plate medium. Some of the Polyporales in this study have shown good mycelial growth, however, they mostly formed mycelial mat of weak physical strength. The higher physical strength of mycelial mat by G. lucidum LBS5496GL was attributed to its thick hyphae with the diameter of 13 µm as revealed by scanning electron microscopic analysis whereas the hyphae of others exhibited less than 2 µm. Glycerol and skim milk supported the best mycelial growth of LBS5496GL as a carbon and a nitrogen source, respectively.

First Report of Crown and Root Rot Caused by Pythium aphanidermatum on Industrial Hemp (Cannabis sativa) in Arizona.

During July and August 2020, symptoms of leaf yellowing and browning, sudden wilting, and death were observed on industrial hemp plants (Cannabis sativa L.) in several drip-irrigated fields in Yuma and Graham county, Arizona. About 85% of plants showed severe crown and root rot symptoms. A high percentage of affected plants collapsed under intensive heat stress. Shriveled stem tissue with necrotic lesions can often be seen at the base of the plant, extending upwards more than 5 cm. Internal tissue of main stem and branches was darkened or pinkish brown. Outer cortex of root bark was often completely rotten, exposing the white core. Cottony aerial mycelium was visible on the surface of stalk of some of the infected plants in two fields in Yuma. To identify the causal agent, a total of twenty symptomatic plants were collected from several fields across the state. Crown and root tissues from affected plants were harvested and rinsed in tap water to remove soils. Approximately 2 to 4 mm tissue fragments were excised from the margins of the affected stem and root lesions, surface sterilized in 0.6% sodium hypochlorite for 1 min, rinsed copiously in sterile distilled water, blotted dry, and plated on potato dextrose agar (PDA), and on oomycete-selective clarified V8 medium containing pimaricin, ampicillin, rifampicin, and pentachloronitrobenzene (PARP). Plates were incubated at room temperature for 2 days. Sixteen isolates were recovered and their mycelial colonies resembled the morphology of Pythium. Based on the culture morphology on V8 medium, all isolates were tentatively identified as P. aphanidermatum with fast-growing, aseptate hyphae ranging from 3 to 7 μm in width, globose oogonia ranging from 25 to 31 μm in diameter, barrel-shaped antheridia, globose oospores ranging from 15 to 21 μm in diameter (10 measurements) (Watanabe, 2002). Genomic DNA was extracted from mycelial mats of three isolates using DNeasy Plant Pro Kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. The internal transcribed spacer (ITS) region of rDNA was amplified with primers ITS1/ITS4 and three nucleotide sequences were obtained. All three sequences were identical and deposited under accession number MW380253 in GenBank. A BLASTn search revealed that MW380253 had a 100% query coverage and 100% match with sequences MK611609.1, KJ162355.1, and AY598622.2, obtained from isolates of P. aphanidermatum. To fulfill Koch's postulates, pathogenicity tests were conducted with 2 isolates using 12 seeds of a hemp line 14 sown in 12 1.9-liter pots filled with a steam-disinfested potting mix. Pots were placed in a plastic container and watered three times a week by flooding, to create waterlogged conditions. Plants were maintained in a greenhouse supplemented with artificial lighting of 14 h/10 h day/night light cycle. Plants were fertilized weekly with a 20-20-20 fertilizer at 1mg/ml. Three weeks after sowing, four plants were inoculated with each isolate by drenching each plant with 200 ml of a 1×105 zoospore/ml suspension. Four plants, serving as control, received each 200 ml of distilled water. Symptoms of leaf chlorosis, crown and root rot, and wilting were observed 3 weeks afterwards, while control plants remained asymptomatic. P. aphanidermatum were re-isolated from necrotic roots of inoculated plants, but not from control plants. P. aphanidermatum was previously detected on industrial hemp in a research plot in Indiana (Beckerman et al., 2017) and is also known to affect other crops in Arizona during the summer months as well (Olsen & Nischwitz, 2011). This report is the first publication documenting P. aphanidermatum on field grown hemp in Arizona. Industrial hemp (Cannabis sativa) is an emerging crop in Arizona. The first plantings of hemp were in June of 2019, where 5,430 acres of hemp was planted in thirteen counties in Arizona before the end of the year. The Arizona Department of Agriculture Industrial Hemp Program, 2019 Year End Report confirms that nearly one-quarter of all hemp planted in 2019 did not receive a final state inspection due to crop loss. This disease is a potential constraint to hemp production in hot, arid climates, where copious water is used in combination with plastic mulch and/or drainage is poor.

Fungal mycelial mats used as textile by indigenous people of North America

ABSTRACT The indigenous people of the United States and Canada long have used forest fungi for food, tinder, medicine, paint, and many other cultural uses. New information about historical uses of fungi continues to be discovered from museums as accessions of fungi and objects made from fungi collected over the last 150+ years are examined and identified. Two textiles thought to be made from fungal mats are located in the Hood Museum of Art, Dartmouth College, and the Oakland Museum of California. Scanning electron microscopy and DNA sequencing were used to attempt to identify the fungus that produced the mats. Although DNA sequencing failed to yield a taxonomic identification, microscopy and characteristics of the mycelial mats suggest that the mats were produced by Laricifomes officinalis. This first report of fungal mats used for textile by indigenous people of North America will help to alert museum curators and conservators as well as mycological researchers to their existence and hopefully lead to more items being discovered that have been made from fungal fabric.

First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India.

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Development of a Rapid and Low-Cost Method for the Extraction of Dermatophyte DNA.

Background:Polymerase chain reaction (PCR) is the most optimized method for the rapid detection and analysis of any environmental or clinically significant organism. While PCR amplification directly from samples has been shown effective for several bacteria and viruses, for filamentous fungus and yeast, extraction of genomic DNA is a must. The extraction of DNA from fungal cultures is often reported using user-friendly commercially available kits, which are designed to decrease the time, extensive manual work in extraction procedures but are often expensive. Dermatophytes pose an added drawback to efficient DNA extraction due to their poor recovery on culture media and slow growth rate.Aims and Objectives:In the present study, we developed and validated a method for effective genomic DNA extraction from dermatophytes.Materials and Methods:DNA yield from standard dermatophytes extracted from spore suspensions and mycelia mat by commercially available kits was compared. A modified method using lyticase buffer and phenol-chloroform extraction was developed. The yield obtained was compared with the existing methods (kit-based method and cetyl trimethyl ammonium bromide method). The yield and quality of the total genomic DNA were estimated spectrophotometrically and by successful PCR amplification of the ITS region. The results were validated using 21 clinical isolates from recalcitrant dermatophytosis.Results:Minimal fungal DNA was obtained from the spores compared to that obtained from mycelial mat. Commercially available kits yielded lower amounts of DNA compared to the CATB method. The modified method developed in this study yielded better quality and quantity of DNA.Conclusion:Of the three extraction methods evaluated, the developed method gave significantly higher total genomic DNA yield and better purity than the reference methods. In addition, the turnaround time for DNA extraction was reduced to half based on modifications in culture conditions.

Asperosporus subterraneus, a new genus and species of sequestrate Agaricaceae found in Florida nursery production.

We describe a novel sequestrate genus and species, Asperosporus subterraneus gen. et sp. nov., found associated with nursery production of ferns in south Florida. This truffle species has a unique combination of morphological characters among described Agaricaceae in that it lacks a stipe or columella, has large, ornamented spores, the fresh sporocarps rapidly stain pink-red when cut or bruised, and they have a rancid smell. Although this fungus does not appear to be a direct plant pathogen, the hyphae of A. subterraneus produce a thick hydrophobic mycelial mat that binds the organic matter and therefore prevents water and fertilizer from being absorbed by plants, consequently causing wilting and chlorosis. Using morphological characteristics and phylogenetic reconstruction based on the internal transcribed spacer (ITS), partial large subunit nuclear ribosomal DNA (LSU), second largest subunit of RNA polymerase II (rpb2) and translation elongation factor 1-alpha (tef1) regions, we describe this taxon as a new genus and species in Agaricaceae.

Sporulating mycelium of Davidsoniella australis on the bark of Nothofagus cunninghamii, and role as inoculum for new infections

Sporulating mycelial mats on the bark of lower stems are a common and notable sign of Davidsoniella australis infection of Nothofagus cunninghamii in cool temperate rainforest in Tasmania and Victoria. Inoculation studies indicate viable conidia from mats may be present in the rainforest during most of the year. Air- or water-borne conidia from sporulating mats and in the frass of the ambrosia beetle Platypus subgranosus that attacks infected trees, is the likely source of new infections in N. cunninghamii

First Report of Southern Blight of Manglietia decidua Caused by Sclerotium rolfsii in China.

Manglietia decidua, named 'Hua manglietia', belonging to the Magnoliaceae family, is one of the most important ornamental plant in China. In 2019 and 2020, an unknown disease caused 3- to 12-month plants of M. decidua to wither and die in the field in Zhanjiang, Guangdong province（N21°9'3";E110°17'47"）. Initially, the infected plants showed leaves dehydration, chlorosis and wilting with water-soaked lesions on stems at ground level. About 7 days later, the plants completely wilted, collapsed and died. Delayed and stunted growth with wilting of foliage continued through the whole year. Dense white mycelial mat and small white-to-brown spherical sclerotia were observed on the surface of the stalk lesion when weather conditions were warm and humid. Approximately 10% of plants were infected. Especially from July to October 2020, up to 30% of about 500 plants were infected and died. To identify the causal agents of the disease, infected tissue and sclerotia were collected, surface disinfected in 75% alcohol for 30s and 30% hydrogen peroxide solution for 5 min, and washed with sterile water for 1 min. The surface disinfected tissue and sclerotia were put on potato dextrose agar containing ampicillin (50mg/L) and kept in an incubator at 25°C in the dark. Fast growing fungus colonies with white mycelium and numerous sclerotia developed in the plates after 6 to 8 days of incubation. The hyphae were septate, hyaline and formed typically clamp connection after 10 days of growth. Sclerotia were initially white and became tan to dark brown over time and 1.0 to 3.0 mm (2.13 mm on average, n=124) in diameter at maturity. For molecular identification，the ITS region was amplified using primer pair ITS1/ITS4 (White et al. 1990). A 666 bp PCR product was sequenced (GenBank accession no. MW093622) and shared above 99% sequence identity with some Athelia rolfsii isolates (GenBank accession Nos. HQ895869, KX499470 and AB075290). Based on morphological and molecular characteristics, the fungus was identified as Sclerotium rolfsii (teleomorph A. rolfsii) （Paul et al. 2017，Xu et al. 2010. Pathogenicity tests were conducted by inoculating ten healthy 1-year-old M. decidua plants grown in pots. Five sclerotia and mycelial mat obtained from 15-day-old cultures were buried adjacent to the stem of each unwounded healthy plant. Non-inoculated plants served as controls. After inoculation, the plants were maintained in a 25-28 ℃ greenhouse and watered regularly to keep the soil moisture content at about 15%. Symptoms of southern blight were observed on all inoculated plants, which began to wilt 7 to 10 days after inoculation and died within 15 to 20 days. The control plants remained healthy. S. rolfsii was again isolated from the artificially inoculated plants, but not from non-inoculated plants. The pathogenicity test was repeated twice and the results were the same. S. rolfsii has an extensive host range worldwide and the common host ornamental plants are Iris, Chrysanthemum, CymbidiumTrifolium, Jasminum, Begonia, and Stevia etc. in China. To our knowledge, this is the first report of southern blight caused by S. rolfsiii on M. decidua in China. M. decidua is a horticultural plant which belongs to the protected and endangered tree species. This finding is important to alert growers to realize the proper management of this disease during species protection and cultivar extension.

“MYCO SYNTHESIS OF SILVER NANOPARTICLES USING GLIOCLADIUM ROSEUM (CLONOSTACHYS ROSEA (LINK) SCHROERS, SAMUELS) AND ITS ANTIMICROBIAL EFFICACY AGAINST SELECTED PATHOGENS”

Objective: Antimicrobial efficacy of silver nanoparticles from Gliocladium roseum, culture filtrate (C. F.) and mycelial mat extract (M. E.) against selected pathogens.
 Methods: Culture filtrate (C. F.) and Mycelial mat extract (M. E.) of Gliocladium roseum were subjected to 10 Mm silver nitrate solution for the synthesis of silver nanoparticles. Formed silver nanoparticles were evaluated via UV-vis spectroscopy and the structural elucidation was done by FT-IR and TEM. Antimicrobial efficacy was tested against bacterial (Salmonella typhi and Klebsiella pneumonia) and fungal (Cladosporium cladosporioides and Alternaria alternata) pathogens. Different nanoparticle concentrations-50, 100, 150 and 200 µl were checked via disc diffusion method.
 Results: Gliocladium roseum (C. F. and M. E.) on interaction with silver nitrate solution effectively reduced metallic silver exhibiting a colour change from yellow to dark brown within 24 h due to the formation of silver nanoparticles. The UV-vis spectrum of C. F. and M. E. showed maximum absorption peaks at 350-400 nm and 400-450 nm respectively and FT-IR and TEM showed strong N-H bonding and spherical shaped silver nanoparticles with the size of 11-19 nm (C. F.) and 25-38 nm (M. E.). Antimicrobial analysis resulted in efficient inhibitory activity against Salmonella typhi, Klebsiella pneumonia and also showed moderate inhibitory activity against Alternaria alternata and Cladosporium cladopsorioides.
 Conclusion: The synthesis of silver nanoparticles from fungus Gliocladium roseum is simple, cheap, safe and eco-friendly thus emphasising on large scale scientific application.

Transcriptional responses of toxigenic and atoxigenic isolates ofAspergillus flavus to oxidative stress in aflatoxin-conducive and non-conducive media

Aflatoxin production by isolates ofAspergillus flavus varies, ranging from highly toxigenic to completely atoxigenic. Several mechanisms have been identified which regulate aflatoxin production including medium carbon source and oxidative stress. In recent studies, aflatoxin production has been implicated in partially ameliorating oxidative stress inA. flavus. To better understand the role of aflatoxin production in oxidative stress responses, a selection of toxigenic and atoxigenic isolates ofA. flavus with moderate to high oxidative stress tolerance were exposed to increasing concentrations of H2O2 in both aflatoxin-conducive and non-conducive media. Mycelial mats were collected for global transcriptome sequencing followed by differential expression, functional prediction, and weighted co-expression analyses. Oxidative stress and medium carbon source had a significant effect on the expression of several secondary metabolite gene clusters including those for aflatoxin, aflatrem, aflavarin, cyclopiazonic acid, and kojic acid. Atoxigenic biological control isolates showed less differential expression under stress than other atoxigenic isolates suggesting expression profiles may be useful in screening. Increasing stress also resulted in regulation of SakA/Hog1 and MpkA MAP kinase signalling pathways pointing to their potential roles in regulating oxidative stress responses. Their expression was also influenced by medium carbon source. These results suggest that aflatoxin production along with that of other mycotoxins may occur as part of a concerted coping mechanism for oxidative stress and its effects in the environment. This mechanism is also regulated by availability of simple sugars and glycolytic compounds for their biosynthesis.

Transcriptional responses of toxigenic and atoxigenic isolates of Aspergillus flavus to oxidative stress in aflatoxin-conducive and non-conducive media

Aflatoxin production by isolates of Aspergillus flavus varies, ranging from highly toxigenic to completely atoxigenic. Several mechanisms have been identified which regulate aflatoxin production including medium carbon source and oxidative stress. In recent studies, aflatoxin production has been implicated in partially ameliorating oxidative stress in A. flavus. To better understand the role of aflatoxin production in oxidative stress responses, a selection of toxigenic and atoxigenic isolates of A. flavus with moderate to high oxidative stress tolerance were exposed to increasing concentrations of H2O2 in both aflatoxin-conducive and non-conducive media. Mycelial mats were collected for global transcriptome sequencing followed by differential expression, functional prediction, and weighted co-expression analyses. Oxidative stress and medium carbon source had a significant effect on the expression of several secondary metabolite gene clusters including those for aflatoxin, aflatrem, aflavarin, cyclopiazonic acid, and kojic acid. Atoxigenic biological control isolates showed less differential expression under stress than other atoxigenic isolates suggesting expression profiles may be useful in screening. Increasing stress also resulted in regulation of SakA/Hog1 and MpkA MAP kinase signalling pathways pointing to their potential roles in regulating oxidative stress responses. Their expression was also influenced by medium carbon source. These results suggest that aflatoxin production along with that of other mycotoxins may occur as part of a concerted coping mechanism for oxidative stress and its effects in the environment. This mechanism is also regulated by availability of simple sugars and glycolytic compounds for their biosynthesis.

First Report of Phytopythium helicoides Causing Crown and Root Rot on Rhododendron pulchrum in China.

During a 2019-2020 survey of plant pathogenic oomycetes in Nanjing, China, a cluster of five adjacent Rhododendron pulchrum plants in Xuanwuhu Park exhibited symptoms including crown and root rot and wilting. foliage blight caused due to collar and had rotting crown and root tissues resultingrot foliage blight. Diseased roots were rinsed in water, cut into 10 mm pieces, immersed in 70% ethanol for 60 sec, and plated onto clarified V8 juice agar (cV8A) containingamended with pimaricin (20mg/liter), ampicillin (125mg/liter), rifampicin(10 mg/liter), and pentachloronitrobenzene (20mg/liter). After three3 days of incubation at 26°C, Ffive Pythium-like isolatescoloniesisolates were obtained using hypalhyphal-tipping after 3 days of incubation at 25°C. Ten agar plugs (2×2 mm2) of each isolate were growntransferred into 10 mLl of 10% clarified V8 juice (cV8) in a 100 -mm plate at 26°C to produce mycelial mats. After 3three days, cV8 was replaced with sterile water. To stimulate sporangial production, 3-5 drops of soil extract solution were added to each plate. Five isolates had identical morphological features. Sporangia were terminal, ovoid to globose, andmeasuring 34.2 ± 6.2 µm (24.0-42.5 µm range) in length and 30.7 ± 6.6 µm (20.9-41.1 µm range) in width. Oogonia were not observed. The following primers were used to amplify the rDNA internal transcribed spacer (ITS) region and the mitochondrial cytochrome c oxidase subunit 1 (cox1COI) and 2 (cox2COII) genes of from aA representative isolate, PH-C were amplified using the primer pairs ITS6 and ITS4 (Cooke et al. 2000), OomCoxI-Levup and OomCoxI-Levlo (Robideau et al. 2011) and Cox2-F and Cox2-RC4 (Hudspeth et al. 2000), respectivelyPhe-1. Isolate A xxx675 bp, xxx657 bp and 561xxx bp fragmentPH-C , respectively were amplified and had have identical sequences of the ITS (GenBank ACN. MT824568), and cox1 (MT834959), COI and cox2 COII genes the rDNA internal transcribed spacer (ITS) region and the mitochondrial cytochrome c oxidase subunit 1 and 2 genes (GenBank ACN. MT824568, MT834959, (MT834958, respectively) sequences identical to those of Phytopythium helicoides (MN541109, MK879709, KT595689, respectively). Based on the morphological and molecular characters, all five isolatesthe causal agent waswere identified the species represented by Phe-1 was identified as P. helicoides. One-year-old R. pulchrum plants (approx. 0.3 m in height) grown in 8×8 cm2 pots were used in to test the pathogenicity trials. Ten plants wasere carefully dug up to expose root ballsclusterballs. TenThree- days -old cultures of the isolate PH-Che-1 were used as the inoculum. Five The pplantss wereere inoculated by inserting 10 agar plugs into thee root ball of each plantcluster. For inoculatingfive control plants, sterile cV8A discsplugs were used. All inoculated plants were re-potted using original fresh potting mix and potsture .Ten 3-day-old cV8A cultural plugs (5×5 mm2) of Phe-1 were evenly insert into the root ball of each of five plants, while sterile cV8A plugs were used for five control plants. All were then planted into their original pots. Plants were maintained in a growth chamber set at 26°C with a 12/12 h light/dark cycle and irrigated as needed. After 21-25 days, the inoculated plants had symptoms identical to those in the field, while the controls remained asymptomatic. Identical outcomes were obtained from two repeated The pathogenicity trials. test was repeatedconducted twice . and the coutcome was identical. Phytopythium. helicoides (Phe-1) was reisolated from all symptomatic plants inemerging from the pathogenicity trials. Phytopythium helicoides was found causing diseases of Asian lotus (Yin et al. 2015), mandarin orange (Chen et al. 2016), and kiwifruit (Wang et al. 2015) plants in China. Phytopythium isolates with identical morphological features to those of Phe-1 were recovered from rotted crown and root tissues of all inoculated plants. In this note, P. helicoides causing crown and root rot on R. pulchrum is reported for the first time. Globally, this is the first report of P. helicoides causing crown blight and root rot of R. pulchrum. Additional surveys are being conducted forto mapping the distribution of P. helicoides in Nanjing, Province of China.