EDAR Mutations Research Articles

EDA ligand triggers plasma membrane trafficking of its receptor EDAR via PKA activation and SNAP23-containing complexes

BackgroundEctodysplasin-A (EDA), a skin-specific TNF ligand, interacts with its membrane receptor EDAR to trigger EDA signaling in skin appendage formation. Gene mutations in EDA signaling cause Anhidrotic/Hypohidrotic Ectodermal Dysplasia (A/HED), which affects the formation of skin appendages including hair, teeth, and several exocrine glands.ResultsWe report that EDA triggers the translocation of its receptor EDAR from a cytosolic compartment into the plasma membrane. We use protein affinity purification to show that upon EDA stimulation EDAR associates with SNAP23-STX6-VAMP1/2/3 vesicle trafficking complexes. We find that EDA-dependent PKA activation is critical for the association. Notably, either of two HED-linked EDAR mutations, T346M and R420W, prevents EDA-induced EDAR translocation; and both EDA-induced PKA activation and SNAP23 are required for Meibomian gland (MG) growth in a skin appendage model.ConclusionsOverall, in a novel regulatory mechanism, EDA increases plasma membrane translocation of its own receptor EDAR, augmenting EDA-EDAR signaling in skin appendage formation. Our findings also provide PKA and SNAP23 as potential targets for the intervention of HED.

The EDA/EDAR/NF-κB pathway in non-syndromic tooth agenesis: A genetic perspective.

Non-syndromic tooth agenesis (NSTA) is one of the most common dental developmental malformations affected by genetic factors predominantly. Among all 36 candidate genes reported in NSTA individuals, EDA, EDAR, and EDARADD play essential roles in ectodermal organ development. As members of the EDA/EDAR/NF-κB signaling pathway, mutations in these genes have been implicated in the pathogenesis of NSTA, as well as hypohidrotic ectodermal dysplasia (HED), a rare genetic disorder that affects multiple ectodermal structures, including teeth. This review provides an overview of the current knowledge on the genetic basis of NSTA, with a focus on the pathogenic effects of the EDA/EDAR/NF-κB signaling pathway and the role of EDA, EDAR, and EDARADD mutations in developmental tooth defects. We also discuss the phenotypic overlap and genetic differences between NSTA and HED. Ultimately, this review highlights the importance of genetic analysis in diagnosing and managing NSTA and related ectodermal disorders, and the need for ongoing research to improve our understanding of these conditions.

Congenital Nail Disorders among Children with Suspected Ectodermal Dysplasias.

We report on a cohort of 204 children referred between January 2017 and January 2022 to the German Center for Ectodermal Dysplasias, Erlangen. The most frequent reasons for referral were tooth malformations and lack of multiple teeth leading to the suspicion of an ectodermal dysplasia. Many patients also suffered from being unable to perspire. Nail abnormalities, in contrast, represented a much rarer finding, albeit the impact on some individuals was large. As ectodermal dysplasias are congenital genetic conditions affecting the development and/or homeostasis of two or more ectodermal derivatives, including hair, teeth, nails, and certain glands, we analyzed congenital nail disorders detected in these patients. Dystrophic or otherwise abnormal nails were evident in 17 of 18 subjects with pathogenic WNT10A or GJB6 variants but in none of 161 children with EDA variants underlying X-linked hypohidrotic ectodermal dysplasia. However, 2 of 17 children who carry mutations in EDAR or EDARADD, two other genes involved in the ectodysplasin A signaling pathway, showed nail abnormalities, such as brittle or hypoplastic nails. TP63 variants were regularly associated with nail disorders. In one girl, anonychia congenita caused by a compound heterozygous variant of the R-spondin-4 gene (RSPO4) was diagnosed. Thus, nail dysplasia is rarer among patients with ectodermal dysplasia than commonly thought.

Different degree of loss-of-function among four missense mutations in the EDAR gene responsible for autosomal recessive hypohidrotic ectodermal dysplasia may be associated with the phenotypic severity.

Hypohidrotic ectodermal dysplasia is a rare condition characterized by hypohidrosis, hypodontia, and hypotrichosis. The disease can show X-linked recessive, autosomal dominant or autosomal recessive inheritance trait. Of these, the autosomal forms are caused by mutations in either EDAR or EDARADD. To date, the underlying pathomechanisms or genotype-phenotype correlations for autosomal forms have not completely been disclosed. In this study, we performed a series of in vitro studies for four missense mutations in the death domain of EDAR protein: p.R358Q, p.G382S, p.I388T, and p.T403M. The results revealed that p.R358Q- and p.T403M-mutant EDAR showed different expression patterns from wild-type EDAR in both western blots and immunostainings. NF-κB reporter assays demonstrated that all the mutant EDAR showed reduced activation of NF-κB, but the reduction by p.G382S- and p.I388T-mutant EDAR was moderate. Co-immunoprecipitation assays showed that p.R358Q- and p.T403M-mutant EDAR did not bind with EDARADD at all, whereas p.G382S- and p.I388T-mutant EDAR maintained the affinity to some extent. Furthermore, we demonstrated that all the mutant EDAR proteins analyzed aberrantly bound with TRAF6. Sum of the data suggest that the degree of loss-of-function is different among the mutant EDAR proteins, which may be associated with the severity of the disease.

Gene Mutations of the Three Ectodysplasin Pathway Key Players (EDA, EDAR, and EDARADD) Account for More than 60% of Egyptian Ectodermal Dysplasia: A Report of Seven Novel Mutations.

Ectodermal dysplasia (ED) is a diverse group of genetic disorders caused by congenital defects of two or more ectodermal-derived body structures, namely, hair, teeth, nails, and some glands, e.g., sweat glands. Molecular pathogenesis of ED involves mutations of genes encoding key proteins of major developmental pathways, including ectodysplasin (EDA) and wingless-type (WNT) pathways. The most common ED phenotype is hypohidrotic/anhidrotic ectodermal dysplasia (HED) featuring hypotrichosis, hypohidrosis/anhidrosis, and hypodontia. Molecular diagnosis is fundamental for disease management and emerging treatments. We used targeted next generation sequencing to study EDA, EDAR, EDARADD, and WNT10A genes in 45 Egyptian ED patients with or without hypohidrosis. We present genotype and phenotype data of 28 molecularly-characterized patients demonstrating genetic heterogeneity, variable expressivity, and intrafamilial phenotypic variability. Thirteen mutations were reported, including four novel EDA mutations, two novel EDARADD, and one novel EDAR mutations. Identified mutations congregated in exons encoding key functional domains. EDA is the most common gene contributing to 85% of the identified Egyptian ED genetic spectrum, followed by EDARADD (10%) and EDAR (5%). Our cohort represents the first and largest cohort from North Africa where more than 60% of ED patients were identified emphasizing the need for exome sequencing to explore unidentified cases.

Characterization of EDARADD gene mutations responsible for hypohidrotic ectodermal dysplasia.

Hypohidrotic ectodermal dysplasia (HED) is a genetic disorder characterized by hypohidrosis, hypodontia, and hypotrichosis. Autosomal forms of the disease are caused by mutations in either EDAR or EDARADD. To date, the underlying pathomechanisms for HED resulting from EDARADD mutations have not fully been disclosed. In this study, we performed detailed in vitro analyses in order to characterize three dominantly inherited missense mutations, p.D120Y, p.L122R, and p.D123N, and one recessively inherited missense mutation, p.E152K, in the EDARADD gene. Nuclear factor (NF)-κB reporter assays demonstrated that all the mutant EDARADD showed reduction in activation of NF-κB. Importantly, p.D120Y-, p.L122R-, and p.D123N-mutant EDARADD slightly reduced the NF-κB activity induced by wild-type EDARADD in a dominant negative manner. Co-immunoprecipitation assays showed that all of the mutant EDARADD were capable of binding to EDAR and wild-type EDARADD. Additional co-immunoprecipitation assays revealed that p.D120Y-, p.L122R-, and p.D123N-mutant EDARADD markedly prevented the interaction between EDAR and wild-type EDARADD, which further indicated a dominant negative effect by these mutations. Finally, we found that p.D120Y-, p.L122R-, and p.D123N-mutant EDARADD completely lost the ability to bind with TRAF6, while p.E152K-mutant EDARADD showed a mild reduction in the affinity. Our findings will provide crucial information toward unraveling the molecular mechanisms how EDARADD gene mutations cause the disease.

Homozygous variants of EDAR underlying hypohidrotic ectodermal dysplasia in three consanguineous families.

Hypohidrotic ectodermal dysplasia (HED) is a congenital anomaly characterized by hypohydrosis, hypotrichosis and hypodontia. Mutations in at least four genes (EDAR, EDARADD, WNT10A, TRAF6) have been reported to cause both autosomal recessive and autosomal dominant forms of HED. Mutations in two other genes (EDA and IKBKG) have been reported to cause X-linked HED. To clinically characterize three consanguineous families (A-C) segregating with autosomal recessive HED and identify possible disease-causing variants of EDAR and EDARADD genes. The genes, EDAR and EDARADD, were sequenced in Family A and C, and exome sequencing was performed in Family B. Additionally, in Family A and C, the effect of the identified variants was examined by analysis of EDAR mRNA, extracted from hair follicles from both affected and unaffected members. Sequence analysis revealed three possible disease-causing EDAR variants including a novel splice acceptor site variant (IVS3-1G > A) in Family A and two previously reported mutations (p.[Ala26Val], p.[Arg25*]) in the two other families. Previously, the nonsense variant p.(Arg25*) was reported only in the heterozygous state. Analysis of the RNA, extracted from hair follicles, revealed skipping of a downstream exon in EDAR and complete degradation of EDAR mRNA in affected members in family A and C, respectively. Computational modelling validated the pathogenic effect of the two variants identified in Family B and C. The three variants reported here expand the spectrum of EDAR mutations associated with HED which may further facilitate genetic counselling of families segregating with similar disorders in the Pakistani population.

Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ2- and Fisher's tests were used to analyze the genotype–phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

Functional studies for a dominant mutation in the EDAR gene responsible for hypohidrotic ectodermal dysplasia.

Hypohidrotic ectodermal dysplasia (HED) is a rare genetic disorder characterized by hypotrichosis, hypohidrosis and hypodontia. The disease shows X-linked recessive, autosomal dominant or autosomal recessive inheritance traits. The X-linked form of HED is caused by mutations in the EDA gene, while autosomal forms result from mutations in either EDAR or EDARADD genes. Regarding recessive mutations in the EDAR gene, the pathomechanisms have been well characterized. However, it has remained largely unknown how dominant mutations in the EDAR cause HED. In this study, we performed in vitro analyses for a dominant EDAR gene mutation, p.F398*, as a representative. We showed that the p.F398* mutant EDAR completely lost its affinity to EDARADD, and suppressed the downstream nuclear factor-κB activation induced by wild-type EDAR in a dominant-negative manner. Furthermore, we demonstrated that the mutant EDAR was capable of binding with the wild-type EDAR, which led to reduced interaction between the wild-type EDAR and EDARADD. Our findings not only underscore an essential role of the interaction between EDAR and EDARADD in ectodermal development, but also disclose, in part, the molecular basis of autosomal dominant HED.

Divergent genetic mechanism leads to spiny hair in rodents.

Spines, or modified hairs, have evolved multiple times in mammals, particularly in rodents. In this study, we investigated the evolution of spines in six rodent families. We first measured and compared the morphology and physical properties of hairs between paired spiny and non-spiny sister lineages. We found two distinct hair morphologies had evolved repeatedly in spiny rodents: hairs with a grooved cross-section and a second near cylindrical form. Compared to the ancestral elliptical-shaped hairs, spiny hairs had higher tension and stiffness, and overall, hairs with similar morphology had similar functional properties. To examine the genetic basis of this convergent evolution, we tested whether a single amino acid change (V370A) in the Ectodysplasin A receptor (Edar) gene is associated with spiny hair, as this substitution causes thicker and straighter hair in East Asian human populations. We found that most mammals have the common amino acid valine at position 370, but two species, the kangaroo rat (non-spiny) and spiny pocket mouse (spiny), have an isoleucine. Importantly, none of the variants we identified are associated with differences in rodent hair morphology. Thus, the specific Edar mutation associated with variation in human hair does not seem to play a role in modifying hairs in wild rodents, suggesting that different mutations in Edar and/or other genes are responsible for variation in the spiny hair phenotypes we observed within rodents.

WNT10B mutations associated with isolated dental anomalies.

Isolated hypodontia is the most common human malformation. It is caused by heterozygous variants in various genes, with heterozygous WNT10A variants being the most common cause. WNT10A and WNT10B are paralogs that likely evolved from a common ancestral gene after its duplication. Recently, an association of WNT10B variants with oligodontia (severe tooth agenesis) has been reported. We performed mutational analysis in our cohort of 256 unrelated Thai families with various kinds of isolated dental anomalies. In 7 families afflicted with dental anomalies we detected 4 heterozygous missense variants in WNT10B. We performed whole exome sequencing in the patients who had WNT10B mutations and found no mutations in other known hypodontia-associated genes, including WNT10A, MSX1, PAX9, EDA, AXIN2, EDAR, EDARADD, LPR6, TFAP2B, LPR6, NEMO, KRT17, and GREM2. Our findings indicate that the variants c.475G>C [p.(Ala159Pro)], found in 4 families, and c.1052G>A [p.(Arg351His)], found in 1 family, are most probably causative. They also show that WNT10B variants are associated not only with oligodontia and isolated tooth agenesis, but also with microdontia, short tooth roots, dental pulp stones, and taurodontism.

Ectodysplasin A in Biological Fluids and Diagnosis of Ectodermal Dysplasia

The tumor necrosis factor (TNF) family ligand ectodysplasin A (EDA) is produced as 2 full-length splice variants, EDA1 and EDA2, that bind to EDA receptor (EDAR) and X-linked EDA receptor (XEDAR/EDA2R), respectively. Inactivating mutations in Eda or Edar cause hypohidrotic ectodermal dysplasia (HED), a condition characterized by malformations of the teeth, hair and glands, with milder deficiencies affecting only the teeth. EDA acts early during the development of ectodermal appendages—as early as the embryonic placode stage—and plays a role in adult appendage function. In this study, the authors measured EDA in serum, saliva and dried blood spots. The authors detected 3- to 4-fold higher levels of circulating EDA in cord blood than in adult sera. A receptor binding-competent form of EDA1 was the main form of EDA but a minor fraction of EDA2 was also found in fetal bovine serum. Sera of EDA-deficient patients contained either background EDA levels or low levels of EDA that could not bind to recombinant EDAR. The serum of a patient with a V262F missense mutation in Eda, which caused a milder form of X-linked HED (XLHED), contained low levels of EDA capable of binding to EDAR. In 2 mildly affected carriers, intermediate levels of EDA were detected, whereas a severely affected carrier had no active EDA in the serum. Small amounts of EDA were also detectable in normal adult saliva. Finally, EDA could be measured in spots of wild-type adult or cord blood dried onto filter paper at levels significantly higher than that measured in EDA-deficient blood. Measurement of EDA levels combined with receptor-binding assays might be of relevance to aid in the diagnosis of total or partial EDA deficiencies.

GREMLIN 2 Mutations and Dental Anomalies

Isolated or nonsyndromic tooth agenesis or hypodontia is the most common human malformation. It has been associated with mutations in MSX1, PAX9, EDA, AXIN2, EDAR, EDARADD, and WNT10A. GREMLIN 2 (GREM2) is a strong bone morphogenetic protein (BMP) antagonist that is known to regulate BMPs in embryogenesis and tissue development. Bmp4 has been shown to have a role in tooth development. Grem2–/– mice have small, malformed maxillary and mandibular incisors, indicating that Grem2 has important roles in normal tooth development. Here, we demonstrate for the first time that GREM2 mutations are associated with human malformations, which include isolated tooth agenesis, microdontia, short tooth roots, taurodontism, sparse and slow-growing hair, and dry and itchy skin. We sequenced WNT10A, WNT10B, MSX1, EDA, EDAR, EDARADD, AXIN2, and PAX9 in all 7 patients to rule out the effects of other ectodermal dysplasias and other tooth-related genes and did not find mutations in any of them. GREM2 mutations exhibit variable expressivity even within the same families. The inheritance is autosomal dominant with incomplete penetrance. The expression of Grem2 during the early development of mouse teeth and hair follicles and the evaluation of the likely effects of the mutations on the protein structure substantiate these new findings.

Novel missense mutations in the AXIN2 gene associated with non-syndromic oligodontia

ObjectiveOligodontia, which is the congenital absence of six or more permanent teeth excluding third molars, may contribute to masticatory dysfunction, speech alteration, aesthetic problems and malocclusion. To date, mutations in EDA, AXIN2, MSX1, PAX9, WNT10A, EDAR, EDARADD, NEMO and KRT 17 are known to associate with non-syndromic oligodontia. The aim of the study was to search for AXIN2 mutations in 96 patients with non-syndromic oligodontia. DesignWe performed mutation analysis of 10 exons of the AXIN2 gene in 96 patients with isolated non-syndromic oligodontia. ResultsWe identified two novel missense mutations (Exon 3 c.923C>T and Exon 11 c.2490G>C) in two patients. One mutation (c.923C>T) results in a Thr308Met substitution and the other mutation (c.2490G>C) results in a Met830Ile substitution. ConclusionsThis is the first report indicating that mutations in AXIN2 are responsible for oligodontia in the Chinese population. Our findings indicate that AXIN2 can be regarded as a candidate gene for mutation detection in individuals with non-syndromic oligodontia in the Chinese population.

WNT10A mutations account for ¼ of population‐based isolated oligodontia and show phenotypic correlations

A large proportion (>50%) of patients with isolated oligodontia were recently reported with WNT10A mutations. We have analyzed a population-based cohort of 102 individuals diagnosed with non-syndromic oligodontia and a mean of 8.2 missing teeth. The cohort included 94 families and screening of WNT10A identified that 26 probands (27.7%) had at least one WNT10A variant. When we included the MSX1, PAX9, AXIN2, EDA, EDAR, and EDARADD genes, 38.3% of probands were positive for a mutation. Biallelic WNT10A mutations were strongly associated with a larger number of missing teeth (11.09) when compared to both monoallelic WNT10 mutations (6.82) and the group without mutations in WNT10A, MSX1, PAX9, AXIN2, EDA, EDAR, or EDARADD (7.77). Genotype-phenotype analysis of individuals with WNT10A mutations showed that premolars were the most common missing teeth. Furthermore, biallelic WNT10A mutations were associated with absence of maxillary and mandibular molars as well as mandibular central incisors. Maxillary central incisors were always present. Thus, our study indicates that WNT10A mutations are associated with both the type and numbers of missing teeth. Furthermore, we show that this population-based cohort of isolated oligodontia had a considerably lower frequency of mutated WNT10A alleles and a lower mean number of missing teeth when compared to patients recruited from dental specialist centers.

Candidate gene analysis of tooth agenesis identifies novel mutations in six genes and suggests significant role for WNT and EDA signaling and allele combinations.

Failure to develop complete dentition, tooth agenesis, is a common developmental anomaly manifested most often as isolated but also as associated with many developmental syndromes. It typically affects third molars or one or few other permanent teeth but severe agenesis is also relatively prevalent. Here we report mutational analyses of seven candidate genes in a cohort of 127 probands with non-syndromic tooth agenesis. 82 lacked more than five permanent teeth excluding third molars, called as oligodontia. We identified 28 mutations, 17 of which were novel. Together with our previous reports, we have identified two mutations in MSX1, AXIN2 and EDARADD, five in PAX9, four in EDA and EDAR, and nine in WNT10A. They were observed in 58 probands (44%), with a mean number of missing teeth of 11.7 (range 4 to 34). Almost all of these probands had severe agenesis. Only few of the probands but several relatives with heterozygous genotypes of WNT10A or EDAR conformed to the common type of non-syndromic tooth agenesis, incisor-premolar hypodontia. Mutations in MSX1 and PAX9 affected predominantly posterior teeth, whereas both deciduous and permanent incisors were especially sensitive to mutations in EDA and EDAR. Many mutations in EDAR, EDARADD and WNT10A were present in several families. Biallelic or heterozygous genotypes of WNT10A were observed in 32 and hemizygous or heterozygous genotypes of EDA, EDAR or EDARADD in 22 probands. An EDARADD variant were in seven probands present together with variants in EDAR or WNT10A, suggesting combined phenotypic effects of alleles in distinct genes.

Mutations in WNT10A are frequently involved in oligodontia associated with minor signs of ectodermal dysplasia

Ectodermal dysplasias (ED) are a clinically and genetically heterogeneous group of hereditary disorders that have in common abnormal development of ectodermal derivatives. Hypohidrotic ectodermal dysplasia (HED) is characterized by abnormal development of eccrine sweat glands, hair, and teeth. The X-linked form of the disease, caused by mutations in the EDA gene, represents the majority of patients with the hypohidrotic form. Autosomal dominant and autosomal recessive forms are occasionally seen, and result from mutations in at least three genes (WNT10A, EDAR, or more rarely EDARADD). We have screened for mutations in EDAR (commonly involved in the hypohidrotic form) and WNT10A (involved in a wide spectrum of ED and in isolated hypodontia) in a cohort of 36 patients referred for EDA molecular screening, which failed to identify any mutation. We identified eight EDAR mutations in five patients (two with homozygous mutations, one with compound heterozygous mutations, and two with heterozygous mutation), four of which were novel variants. We identified 28 WNT10A mutations in 16 patients (5 with homozygous mutations, 7 with compound heterozygous mutations, and 4 with heterozygous mutations), seven of which were novel variants. Our study allows a more precise definition of the phenotypic spectrum associated with EDAR and WNT10A mutations and underlines the importance of the implication of WNT10A among patients with ED.

Oligodontia with taurodontism in monozygous twins

Oligodontia with taurodontism in monozygous twins

A Missense Mutation in the Death Domain of EDAR Abolishes the Interaction with EDARADD and Underlies Hypohidrotic Ectodermal Dysplasia

Background: Hypohidrotic ectodermal dysplasia (HED) is a rare condition characterized by hypotrichosis, hypohidrosis and hypodontia. The disease shows X-linked recessive, autosomal-dominant or autosomal-recessive inheritance trait. X-linked form of HED is caused by mutations in the EDA gene, while autosomal forms are caused by mutations in either EDAR or EDARADD genes. Methods: We analyzed the DNA from a Japanese patient with HED through direct sequencing, and also performed functional studies for the mutation. Results: We identified a homozygous missense mutation c.1073G>A (p.R358Q) in the EDAR gene of the patient, which was a nonconservative amino acid substitution within the death domain of EDAR protein. We demonstrated that the p.R358Q mutant EDAR protein lost its affinity to EDARADD, leading to reduced activation of the downstream NF-ĸB. Conclusion: Our data further suggest the crucial role of the EDAR signaling in development of hair, teeth, and sweat gland in humans.

Only four genes (EDA1, EDAR, EDARADD, and WNT10A) account for 90% of hypohidrotic/anhidrotic ectodermal dysplasia cases

Hypohidrotic and anhidrotic ectodermal dysplasia (HED/EDA) is a rare genodermatosis characterized by abnormal development of sweat glands, teeth, and hair. Three disease-causing genes have been hitherto identified, namely, (1) EDA1 accounting for X-linked forms, (2) EDAR, and (3) EDARADD, causing both autosomal dominant and recessive forms. Recently, WNT10A gene was identified as responsible for various autosomal recessive forms of ectodermal dysplasias, including onycho-odonto-dermal dysplasia (OODD) and Schöpf-Schulz-Passarge syndrome. We systematically studied EDA1, EDAR, EDARADD, and WNT10A genes in a large cohort of 65 unrelated patients, of which 61 presented with HED/EDA. A total of 50 mutations (including 32 novel mutations) accounted for 60/65 cases in our series. These four genes accounted for 92% (56/61 patients) of HED/EDA cases: (1) the EDA1 gene was the most common disease-causing gene (58% of cases), (2)WNT10A and EDAR were each responsible for 16% of cases. Moreover, a novel disease locus for dominant HED/EDA mapped to chromosome 14q12-q13.1. Although no clinical differences between patients carrying EDA1, EDAR, or EDARADD mutations could be identified, patients harboring WNT10A mutations displayed distinctive clinical features (marked dental phenotype, no facial dysmorphism), helping to decide which gene should be first investigated in HED/EDA.