Abstract
BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ2- and Fisher's tests were used to analyze the genotype–phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.
Highlights
Ectodermal dysplasias (EDs) are genetically heterogeneous diseases caused by developmental failure in two or more ectodermal structures such as teeth, sweat glands, hair, nails, and skin
This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients
We report two EDA gene mutations—a pathogenic missense mutation and a deletion mutation—in two Chinese Han HED families
Summary
Ectodermal dysplasias (EDs) are genetically heterogeneous diseases caused by developmental failure in two or more ectodermal structures such as teeth, sweat glands, hair, nails, and skin. HED ( known as Christ-Siemens-Touraine syndrome) is characterized by hypohidrosis (reduced ability to sweat), hypotrichosis (sparseness of scalp and body hair), and hypodontia (congenital absence of teeth) Homozygous male patients usually have typical clinical manifestations of hypodontia, hypohidrosis, and sparse hair and characteristic facial features including frontal bossing, chin prominence, saddle nose, wrinkles, low-set ears, maxillary hypoplasia, and periorbital hyperpigmentation (Namiki et al, 2016; Liu et al, 2018a). This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
