Sesame Mutant Research Articles

An Ethyl Methanesulfonate-Induced GIF1 Splicing Site Mutation in Sesame Is Associated with Floral Malformation and Small Seed Size

Flower and inflorescence architecture play fundamental roles in crop seed formation and final yield. Sesame is an ancient oilseed crop. Exploring the genetic mechanisms of inflorescence architecture and developmental characteristics is necessary for high-yield breeding improvements for sesame and other crops. In this study, we performed a genetic analysis of the sesame mutant css1 with a malformed corolla and small seed size that was mutagenized by ethyl methanesulfonate (EMS) from the cultivar Yuzhi 11. Inheritance analysis of the cross derived from css1 mutant × Yuzhi 11 indicated that the mutant traits were controlled by a single recessive gene. Based on the genome resequencing of 48 F2 individuals and a genome-wide association study, we determined SNP9_15914090 with the lowest p value was associated with the split corolla and small seed size traits, which target gene Sigif1 (GRF-Interacting Factor 1). SiGIF1 contains four exons and encodes a coactivating transcription factor. Compared to the wild-type allelic gene SiGIF1, Sigif1 in the mutant css1 has a splice donor variant at the exon2 and intron2 junction, which results in incorrect transcript splicing with a 13 bp deletion in exon2. The expression profile indicated that SiGIF1 was highly expressed in the flower, ovary, and capsule but lowly expressed in the root, stem, and leaf tissues of the control. In summary, we identified a gene, SiGIF1, that regulates flower organs and seed size in sesame, which provides a molecular and genetic foundation for the high-yield breeding of sesame and other crops.

Exploring fatty acid composition, bioactive compounds, and antioxidant properties in oils of newly developed sesame mutant lines in Morocco

AbstractSesame (Sesamum indicum L.) is renowned for its significance as a global oilseed crop, valued for its high oil content and nutritional properties. This study aimed to explore the fatty acid composition, bioactive compounds, and antioxidant attributes of sesame mutant oils, examining their potential applications in food industry. Nine M4 mutants, along with their parents, were grown in two contrasting environments (Taoujdate and Afourare) to investigate their seed oil, phenolic and flavonoid contents, the balance between omega‐6, omega‐9, and omega‐3 fatty acids, iodine value, and susceptibility to oxidation. Genotype and environment main effects as well as their interaction had a significant effect on the majority of the parameters studied. The mutant “US2‐1” stands out with a distinctive fatty acid profile, featuring the highest saturated fatty acids, ω‐6/ω‐9 ratio, and omega‐3 content, in addition to its high total flavonoid content and remarkable oxidative stability. “ML2‐10,” “US1‐2,” “US2‐6,” and “US2‐7” exhibit high oil content, coupled with substantial levels of phenols and flavonoids, rendering them excellent candidates for culinary and industrial applications where oxidative stability is important. “ML2‐68,” “ML2‐72,” “US06,” “US1‐DL,” and “US1‐3” offer versatile options with their moderate oil content and fatty acid profiles that resist oxidation. This research highlights the potential for breeding sesame mutants tailored to specific applications, contributing to both enhanced oil production and improved nutritional value. The insights gained here pave the way for the development of sesame varieties with superior nutritional and functional attributes, thereby promoting the sustainable production and consumption of sesame oil.

Exploring mechanisms of drought-tolerance and adaptation of selected sesame mutant lines

Sesame (Sesamum indicum L.) is an important oilseed crop, but its productivity and quality are often compromised by drought stress. Developing drought-resistant sesame varieties is thus crucial for its sustainable cultivation. In this study, we conducted a comprehensive investigation of morphoanatomical and physiochemical mechanisms underlying drought tolerance in selected sesame mutants. The drought-tolerant mutants ‘ML2-37’ and ‘ML2-72’ were compared to the susceptible mutant ‘US1-2’ and the parental cultivar ‘ML13’ under controlled greenhouse conditions. Our results showed that the tolerant mutants exhibited superior performance in response to drought stress. We identified specific adaptation mechanisms, including accumulation of proline, glycine, and cuticular wax, which contribute to maintaining optimal water status. Additionally, the tolerant mutants showed a significant reduction in the number and diameter of the xylem vessels, even under severe stress. These results open up good perspectives for the development of drought-resistant sesame varieties, thus offering a promising solution to improve agricultural productivity in regions affected by increasing water scarcity in the actual context of climate change. The selection indices proposed in this study provide practical tools to identify and develop sesame germplasm and cultivars adapted to drought stress conditions. This work constitutes a significant contribution to research on drought tolerance in sesame and offers promising prospects for sustainable agriculture in the context of global climate change.

Deletion of a 1,049 bp sequence from the 5´ UTR upstream of the SiHEC3 gene induces a seed non-shattering mutation in sesame

Sesame is a labor intensive crop with limited mechanized harvesting mainly due to the seed shattering (SS) trait. In this study, we performed a genetic analysis of the seed-shattering resistance (SR) trait with a SR sesame mutant 12M07. Unlike the SS type, the parenchyma cells in the abscission zone of the 12M07 mutant are arranged loosely but adhere to the seed coat. Inheritance analysis of six generations derived from 12M07 (SR)×Xiangcheng Dazibai (SS) showed that the SR trait is recessive and controlled by a single gene pair. Association mapping of the F2 population with 888,619 variants (single-nucleotide polymorphisms (SNPs) and insertion-deletion (InDels)) and 31,884 structural variations (SVs) determined that only SV12002 in the 5´ upstream region of gene Sindi0765000 (named SiHEC3) in Chr.3 was significantly associated with the SR trait. SiHEC3 encodes the bHLH transcription factor. A 1,049 bp deletion occurred in the 5´ UTR of Sihec3 in 12M07. SiHEC3 is mainly expressed in developing placental tissues, with the expression peaking in capsules at 45 days after pollination. A dual-luciferase reporter assay in tobacco confirmed that the promoter activity of Sihec3 was reduced because of the deletion of the 1,049 bp promoter sequence. Protein–protein interaction network analysis showed that HEC3 is co-expressed with nine key proteins, such as SHATTERPROOF1 (SHP1) and SEEDSTICK (STK) which participate in the secondary wall biosynthesis of the abscission layer in plants. The findings of this study show the important function of Sihec3 corresponding with the SR trait and supply the genetic information for breeding new varieties that are amenable to mechanized harvesting in sesame and other crops.

Drought-tolerant sesame mutant lines assessed by physiological traits and stress indices under water deficit conditions

Climate change and water scarcity are the most important factors that affect crop production in dry areas. Sesame (Sesamum indicum L.) is a very ancient oilseed crop cultivated in arid and semi-arid regions and therefore its productivity is limited under drought conditions, which makes the selection and development of drought-tolerant cultivars imperative. This study aims to evaluate the responses to drought stress of eleven M4 sesame mutants, in addition to their two wild-type parents, cultivated in two contrasting environments. Drought stress was applied, under field conditions, by reducing the amount of irrigation water supplied by half, compared to the control. Physiological traits and various drought indices were measured/calculated. All data were subjected to analysis of variance and unweighted pair group method with arithmetic mean (UPGMA) to classify genotypes as drought sensitive or drought tolerant. Significant variations among genotypes were observed in their reactions to water regimes and environments. Overall, under water stress, proline content and stomatal resistance significantly increased, while chlorophyll content, seed yield, and relative water content significantly decreased in stressed plants. Drought indices revealed substantial differences among genotypes, with tolerant ones showing the best scores. Furthermore, correlation analysis demonstrated significant associations between physiological traits and drought indices. In light of all the traits/indices investigated, the mutant ‘US1-2’ was found to be very drought-sensitive, although it performed best under full-irrigation conditions. In contrast, the mutant lines ‘ML2-37’ and ‘ML2-37’ proved to be highly drought-tolerant and, therefore, they can be handled as an elite germplasm for the development of resilient cultivars adapted to arid and semi-arid regions where irrigation water is a limiting factor. This work constitutes a significant contribution to research on sesame drought tolerance and offers promising prospects for this crop in the context of global climate change.

Identification and functional characterization of Si4CLL1 controlling the male sterility in the sesame genic male sterile mutant, ms1812

AbstractSesame (Sesamum indicum L.), 2n = 2x = 26, is an important oilseed crop with high heterosis potential. In this study, we explored the histological and genetic characters and causal gene of a male sterile sesame mutant, ms1812 (ms3). The microspore abortion of ms1812 that led to male sterility (MS) occurred at the tetrad stage of microspore development. No normal pollens were formed and observed in anther chambers of ms1812 at the microspore mature stage. With the aid of high‐efficient association mapping and the sesame var. Yuzhi 11 reference genome, we identified the single nucleotide polymorphism 10505640 on SiChr.3 segregating with the MS and the mutated gene, Si4cll1, controlling the recessive MS in sesame. Si4CLL1 encodes a 4‐coumarate‐CoA ligase‐like protein. The 1292th nucleotide (T1292) of Si4CLL1 mutated into A1292, resulting in the amino acid change from Ile239 to Lys239. Si4CLL1 is mainly expressed in young developing buds. Compared with the wild type, the transcript abundance of Si4cll1 in the developing buds of ms1812 reduced significantly, which might affect the phenylpropanoid biosynthesis pathway and finally, the lignin formation of microspore cell wall. These findings provide key new information for deciphering the molecular mechanism underlying MS and hybrid variety breeding assisted by MS in sesame.

Histological, Cytological, and Ultrastructural Analysis of a Novel Sesame Mutant JQA Showing Wrinkled Leaf and Abort Anther

Histological, Cytological, and Ultrastructural Analysis of a Novel Sesame Mutant JQA Showing Wrinkled Leaf and Abort Anther

Generation of Sesame Mutant Population by Mutagenesis and Identification of High Oleate Mutants by GC Analysis.

Sesame is one of the important oilseed crops in the world. Natural genetic variation exists in the sesame germplasm collection. Mining and utilizing the genetic allele variation from the germplasm collection is an important approach for seed quality improvement. The sesame germplasm accession, PI 263470, which has a significantly higher level of oleic acid (54.0%) than the average (39.5%), was identified by screening the entire USDA germplasm collection. The seeds from this accession were planted in a greenhouse. Leaf tissues and seeds were harvested from individual plants. DNA sequencing of the coding region of the fatty acid desaturase gene (FAD2) confirmed that this accession contained a natural mutation of G425A which may correspond to the deduced amino acid substitution of R142H leading to the high level of oleic acid, but it was a mixed accession with three genotypes (G/G, G/A, and A/A at the position). The genotype with A/A was selected and self-crossed for three generations. The purified seeds were used for EMS-induced mutagenesis to further enhance the level of oleic acid. A total of 635 M2 plants were generated from mutagenesis. Some mutant plants had significant morphological changes including leafy flat stems and others. M3 seeds were used for fatty acid composition analysis by gas chromatography (GC). Several mutant lines were identified with high oleic acid (70%). Six M3 mutant lines plus one control line were advanced to M7 or M8 generations. Their high oleate traits from M7 or M8 seeds harvested from M6 or M7 plants were further confirmed. The level of oleic acid from one mutant line (M7 915-2) was over 75%. The coding region of FAD2 was sequenced from these six mutants, but no mutation was identified. Additional loci may contribute to the high level of oleic acid. The mutants identified in this study can be used as breeding materials for sesame improvement and as genetic materials for forward genetic studies.

A novel wrinkled-leaf sesame mutant as a potential edible leafy vegetable rich in nutrients

Sesame (Sesamum indicum L.) is an ancient and globally important oil crop in the tropic and subtropic areas. Apart from being a good source of high-quality oil, sesame also represents a new source of edible leafy vegetables. However, data regarding the nutritional composition of the sesame leaves, especially their phytonutrient composition, are scarce. Previously we have developed a sesame mutant JQA with curly, wide, and thick leaves that are potentially used as a vegetable. The objective of this work was to gauge the nutrient contents in leaves of the JQA mutant by colorimetry methods. The sesame mutant JQA and its wild-type counterpart JQB were grown in the field, and leaf samples were collected at the flowering stage. Results showed that the sesame wrinkled leaves of JQA are a rich source of crude oil (5.33–6.38%), crude protein (3.14%), amino acids (> 18.6 mg/g), crude fiber (> 0.36%), cellulose or hemicellulose (> 21.4 mg/g), sugars (> 12.5 mg/g), vitamins, and flavones (> 63.2 mg/g). The wrinkled sesame leaves were high in unsaturated acid (32.0 mg/g), calcium (18.5 mg/g), potassium (16.1 mg/g), as well as vitamin B6 (24.5 mg/g), B2 (14.4 mg/g), C (1.7 mg/g) and D (1.3 mg/g) compared to other common green leafy vegetables. The fresh leaves had a mean total flavone content of 65.7 mg/g and can be consumed as fresh vegetables or preserved in a dry state. Collectively, the nutritional composition of the wrinkled leaf mutant JQA was ideal and thus had high RDIs (recommended daily intakes), suggesting that the wrinkled leaves are a rich source of nutrients and therefore suitable to be consumed as a new edible green vegetable.

Assessment of some sesame mutants under normal and water-stress conditions

ABSTRACT Sesame (Sesamum indicum L.) is a tropical oilseed crop that is also cultivated in arid and semi-arid environments, where drought occurs frequently. The objective of this study was to assess the performance of some sesame mutants, developed by our team through EMS-mutagenesis in 2020, under well-watered conditions and restricted irrigation by analyzing certain morphological, physiological, and agronomic attributes. The experiment was conducted in pots under field conditions according to a completely randomized design with three replications. The stress was simulated by suspending and reducing irrigation to 50% of the control, from the beginning of flowering until the appearance of the first capsule. The results showed variation attributable to genotypes, water regimes and their interaction was significant for all parameters studied, except the number of seeds per capsule. The mutants “ML2-5”, “ML2-72” and “ML2-37” were found to be the most tolerant to drought, exhibiting lowest stress sensitivity index and highest seed yield were associated with higher proline content in the leaves, more developed root system, higher chlorophyll content, and higher stomatal conductance than the rest of the mutants studied. This is the first report of sesame mutant lines with such high tolerance to drought during flowering. They could be used for developing high-performing cultivars with tolerance to drought during the flowering stage. The number of capsules per plant and stomatal conductance can be considered selection criteria to improve water-stress tolerance in sesame.

First Study of Improved Nutritional Properties and Anti-Oxidant Activity in Novel Sesame Mutant Lines as Compared to Their Wild-Types.

Sesame seed represents a reservoir of nutritional components with many medicinal properties. With the current trend to increase both seed yield and nutritional quality, the cultivation of new high-quality sesame varieties is a necessity to improve human health and promote the economic efficiency of this crop. However, research efforts for the development of cultivars of high nutritional quality are too scarce. In this study, we evaluated the nutritional value and antioxidant activity of seeds of selected M3 sesame mutants, in comparison with their two wild-type cultivars. The measurements included ash, proteins, crude fibers, sugars, total phenolic content (TPC), total flavonoid content (TFC), total anthocyanin content (TAC), lignans and free radical scavenging activity (FRSA). The results show higher FRSA, TPC, TAC and lignans in the mutant “US2-6”, compared to the wild type “US06”. Besides this, seeds of the mutant “US1-DL” are rich in ash and sugars, while high protein and fiber contents were found in the mutants “ML2-5” and “US2-7”, respectively. This work highlights the possibility of improving the nutritional value of sesame germplasm through mutagenesis. The valuable germplasm obtained will be used in the sesame breeding program to develop cultivars with high nutritional quality and antioxidant activity, which could contribute to the prevention of diseases related to free radicals and nutritional deficiencies.

Glycoside-specific glycosyltransferases catalyze regio-selective sequential glucosylations for a sesame lignan, sesaminol triglucoside.

Sesame (Sesamum indicum) seeds contain a large number of lignans, phenylpropanoid-related plant specialized metabolites. (+)-Sesamin and (+)-sesamolin are major hydrophobic lignans, whereas (+)-sesaminol primarily accumulates as a water-soluble sesaminol triglucoside (STG) with a sugar chain branched via β1→2 and β1→6-O-glucosidic linkages [i.e. (+)-sesaminol 2-O-β-d-glucosyl-(1→2)-O-β-d-glucoside-(1→6)-O-β-d-glucoside]. We previously reported that the 2-O-glucosylation of (+)-sesaminol aglycon and β1→6-O-glucosylation of (+)-sesaminol 2-O-β-d-glucoside (SMG) are mediated by UDP-sugar-dependent glucosyltransferases (UGT), UGT71A9 and UGT94D1, respectively. Here we identified a distinct UGT, UGT94AG1, that specifically catalyzes the β1→2-O-glucosylation of SMG and (+)-sesaminol 2-O-β-d-glucosyl-(1→6)-O-β-d-glucoside [termed SDG(β1→6)]. UGT94AG1 was phylogenetically related to glycoside-specific glycosyltransferases (GGTs) and co-ordinately expressed with UGT71A9 and UGT94D1 in the seeds. The role of UGT94AG1 in STG biosynthesis was further confirmed by identification of a STG-deficient sesame mutant that predominantly accumulates SDG(β1→6) due to a destructive insertion in the coding sequence of UGT94AG1. We also identified UGT94AA2 as an alternative UGT potentially involved in sugar-sugar β1→6-O-glucosylation, in addition to UGT94D1, during STG biosynthesis. Yeast two-hybrid assays showed that UGT71A9, UGT94AG1, and UGT94AA2 were found to interact with a membrane-associated P450 enzyme, CYP81Q1 (piperitol/sesamin synthase), suggesting that these UGTs are components of a membrane-bound metabolon for STG biosynthesis. A comparison of kinetic parameters of these UGTs further suggested that the main β-O-glucosylation sequence of STG biosynthesis is β1→2-O-glucosylation of SMG by UGT94AG1 followed by UGT94AA2-mediated β1→6-O-glucosylation. These findings together establish the complete biosynthetic pathway of STG and shed light on the evolvability of regio-selectivity of sequential glucosylations catalyzed by GGTs.

Cytological, genetic, and proteomic analysis of a sesame (Sesamum indicum L.) mutant Siyl-1 with yellow\u2013green leaf color

BackgroundBoth photosynthetic pigments and chloroplasts in plant leaf cells play an important role in deciding on the photosynthetic capacity and efficiency in plants. Systematical investigating the regulatory mechanism of chloroplast development and chlorophyll (Chl) content variation is necessary for clarifying the photosynthesis mechanism for crops.ObjectiveThis study aims to explore the critical regulatory mechanism of leaf color mutation in a yellow–green leaf sesame mutant Siyl-1.MethodsWe performed the genetic analysis of the yellow-green leaf color mutation using the F2 population of the mutant Siyl-1. We compared the morphological structure of the chloroplasts, chlorophyll content of the three genotypes of the mutant F2 progeny. We performed the two-dimensional gel electrophoresis (2-DE) and compared the protein expression variation between the mutant progeny and the wild type.ResultsGenetic analysis indicated that there were 3 phenotypes of the F2 population of the mutant Siyl-1, i.e., YY type with light-yellow leaf color (lethal); Yy type with yellow-green leaf color, and yy type with normal green leaf color. The yellow-green mutation was controlled by an incompletely dominant nuclear gene, Siyl-1. Compared with the wild genotype, the chloroplast number and the morphological structure in YY and Yy mutant lines varied evidently. The chlorophyll content also significantly decreased (P < 0.05). The 2-DE comparison showed that there were 98 differentially expressed proteins (DEPs) among YY, Yy, and yy lines. All the 98 DEPs were classified into 5 functional groups. Of which 82.7% DEPs proteins belonged to the photosynthesis and energy metabolism group.ConclusionThe results revealed the genetic character of yellow-green leaf color mutant Siyl-1. 98 DEPs were found in YY and Yy mutant compared with the wild genotype. The regulation pathway related with the yellow leaf trait mutation in sesame was analyzed for the first time. The findings supplied the basic theoretical and gene basis for leaf color and chloroplast development mechanism in sesame.

A SNP Mutation of SiCRC Regulates Seed Number Per Capsule and Capsule Length of cs1 Mutant in Sesame.

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.

Yield Components of Some Sesame Mutant Populations Induced by Gamma Irradiation

&lt;p&gt;Sesame is an producing seed whose oil is commercially needed. Breeding attempts to improve the productivity of sesame and yield components are induction of gamma ray irradiation mutations (Co-60). This study was aimed to identify effects of induced mutation by gamma rays irradiation in quantitative characteristics and yield of sesame in M4 generation originated from local cultivars. Two types of sesame (black and white) are irradiated with eight doses (100-800 Gy) of Co-60. The result showed a high variation in almost all morphological characters and modified the character of stem height from base to first branch, number of capsules per plant, biomass yield per plant, and seed yield per plant. Sesame irradiated with 600 Gy Co-60 doses has a beneficial effect on the number of capsules (black:120.23; white: 255.23, respectively) and the weight of 1000 seeds (black:3.63 g; white: 4.55 g, respectively). Genotypic Coefficient of Variation in M4 generation were recorded for high value for characters number of primary branches (30.16%), stem height from base to the first branch (30.96%), stem height from base to first capsule (14.82%), number of secondary branches (53.64%), number of nodes to first flower (72.66%), number of capsules/plant (44.90%), biomass yield/plant (28.37%), and seed yield/plant (36.68%). Genetic variability of plant population is very important for plant breeding program and to sustain level of high productivity.&lt;/p&gt;

Genetic Variation in Selected Individuals Based on Number of Capsule in M5 Sesame Mutan Lines Detected by RAPD

Sesame (Sesamum indicum L.) is major oilseed crops with advantages in health and food industry. Due to self pollinated crop, breeding program in sesame utilized gamma rays irradiation to increase genetic variation. The research material consisted of 164 genotypes from 22 selected individual mutant line based on the number of capsules in M5 generation. This study is to detect genetic variation in selected individuals based on number of capsules in M5 generation of sesame mutant line using RAPD markers. The analysis consists of percentage of polymorphic loci, analysis of molecular variance and visualized in cluster and co-ordinate analysis. Fifteen primers RAPD were able to amplified 237 loci. Each genotype in populations had the similarity coefficient of 0.29 – 0.85. Variance within selected individual line (66%) was higher than variance among selected mutant lines (34%). Variance in each selected individual line contributed to its high value. Line 34 showed the lowest polymorphism (23.21%) and line 19 depicted the highest polymorphism (61.60%).

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening

BackgroundLeaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied.ResultsFor cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed.ConclusionsSiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

Analysis of induced genetic variability for morphological and floral characters with male sterility in sesame (Sesamum indicum L.)

Male sterility can be useful to obtain high yielding sesame hybrids with reduced cost and labour. It can be induced artificially into the released cultivars by using chemical mutagens. Hence the present study was undertaken to induce male sterility in a released sesame genotype cv. B 67 by three different concentrations of Ethyl methane sulphonate (0.25%, 0.50% and 0.75% ) and Nitroso-guanidine (0.01%, 0.02% and 0.04%). The treated seeds were sown to obtain M1 generation of mutants. This population was further advanced by progeny row method to M4 generation where thirty five stable mutants along with parent were screened for abnormal phenotypic and floral characters. The observation indicated generation of large variability for seven morphological characters and five floral characters among the mutants while male sterility could be achieved only up to 56.79%. These male sterile plants were characterized by low plant height, polypetalous and irregular or cleistogamous flowers. The present study implies that the above chemical mutagens can be used to develop useful male sterile mutants in sesame.

Genetic Variability, Standardized Multiple Linear Regression and Principal Component Analysis to Determine Some Important Sesame Yield Components

Sesame is an important commodity in supporting various industries such as low saturated fat oil producing and are often able to adapt under stressed grown conditions. Breeding sesame is undertaken to increase production and is possible by radiation induced polygenic characteristic changes with a gamma rays source. The study aims to identify the effectiveness of genetic variability, standardized multiple linear regression, and principal component analysis to determine some important sesame yield components for indirect selection. Eighteen sesame mutant lines (black and white types) were studied for eleven quantitative traits. Two sesame types were irradiated with eight doses (100-800 Gy) of gamma rays individually. Variability studies on seed yield and yield components are important raw material of high productivity for all studied traits. Standardized multiple linear regression analysis is the most effective way to provide information of relationship between seed yield and yield components in sesame mutant lines for indirect selection.

Morphological Characterization of Colchicine-induced Mutants in Sesame (Sesamum indicum L.)

Morphological Characterization of Colchicine-induced Mutants in Sesame (Sesamum indicum L.)