Abstract
BackgroundLeaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied.ResultsFor cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed.ConclusionsSiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.
Highlights
Leaf shape can affect plantlet development and seed yield in sesame
To explore the genetic mechanism, Uzun et al [12] has identified an Amplified fragment length polymorphisms (AFLP) molecular marker linked to the mutated trait using bulked segregation analysis (BSA) approach in sesame
Characterization of mutant cl1 and the wild type Systematical phenotypic observation showed that there existed the significant difference in leaf and capsule tissues between cl1 and the wild type (WT, Yuzhi 11) (Fig. 1)
Summary
Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl (cl) with curly leaf and indehiscent capsule traits were performed in this study. The genome resequencing data of the 822 germplasm with normal leaf shape were applied. An optimal leaf shape is important to avoid of self-shading and maintains the ideal plant architecture for high yield [7]. Leaf shape can dramatically affect the yield level. The mutagenesis of cl could affect the plant development and the yield, and the trait is controlled by a regress gene allele [1, 10, 11]. To explore the genetic mechanism, Uzun et al [12] has identified an AFLP (amplified fragment length polymorphisms) molecular marker linked to the mutated trait using BSA (bulked segregation analysis) approach in sesame. The target gene for the curly leaf mutation in cl has not been detected mainly for the lack of accurate methods for gene location and validation
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
