Mulberry Cultivation Research Articles

Conservation and breeding of natural silkworm (Bombyx mori L.) in Indonesia

Natural silk farming is a series of silk agro-industry activities from mulberry cultivation, silkworm maintenance, cocoon production and processing, silk spinning and weaving. Many supporting factors for the development of natural silk in Indonesia. However, the natural silk industry is getting worse with high import values. The main problem is the low quality of silkworm egg seeds. The Forest Research and Development Center (P3H) is a government agency authorized for natural silk commodity development. This study aims to describe the efforts of conservation and breeding of natural silkworm in Indonesia. The material used for conservation is the germ plasma silkworms collection owned by P3H. Whereas for breeding activities, silkworms used are produced from conservation activities. Conservation is carried out using eggs of the same type of strain in the germ-plasma, while breeding is done by crossing various types of moths. The result of conservation is the maintenance of 58 germ plasma silkworms. While breeding results are a type of hybrid caterpillar PS 01, which has a production advantage compared to commercial types CS 03. The dissemination of results such as hybrid PS 01, which has a comparative advantage needs to be improved to help overcome the problem of Indonesian silkworms.

Elevated Potassium Enhances Leaf Productivity and Suppresses Foliar Diseases of Mulberry Plant

Potassium (K) may enhance productivity and suppresses foliar diseases of mulberry plant. Existing optimum dose of K for mulberry cultivation need to be updated for suppress foliar disease and improve mulberry plant productivity. This study was conducted to renew the optimum dose of K for mulberry cultivation with respect to the ages of mulberry plant. Therefore, a field study was conducted in split plot design with three replications at Bangladesh Sericulture Research and Training Institute (BSTRI), Rajshahi, Bangladesh to find out the effect of elevated K and ages of plant on growth, leaf yield, leaf quality, nutrient uptake and infestation of foliar diseases of mulberry plant. Six levels of K (0, 30, 60, 90, 120 and 150 kg/ha/yr) along with BSRTI recommended basal doses of nitrogen (N) and phosphorus (P) were applied on two age group of plant viz: (0-5) years and (6-10) years. Result showed that the highest leaf yield 47.10 mt ha -1 year -1 for 6-10 year’s plant at the treatment of T5 (N300P150K150 kg ha -1 year -1). This indicatedleaf yield 175.44% greater over the control but 22.69% higher than the 0-5 year’s plant. Similarly, the maximum leaf quality viz: moisture, reducing sugar, total mineral, total sugar, soluble carbohydrate and crude protein were obtained in (6-10) year’s plant for the same treatments which were 13.82%, 23.47%, 29.96%, 20.57%, 39.58% and 30.69% respectively greater over the control. Furthermore, the average incidence percentages of foliar diseases like leaf spot, tukra and powdery mildew were reduced by 42.34%, 58.02% and 82.96% respectively in (6-10) years plant due to the elevated doses of K like as 150 kg, 90 kg and 60 kg/ha/yr respectively with BSRTI recommended doses of N and P over the control. This findings indicated that the use of 150 kg potassium ha -1 year -1 had better performance on the leaf yield and quality of mulberry plant. Therefore, the application of 150 kg potassium ha -1 year -1 with BSRTI recommended dose of N and P both for (0-5) and (6-10) year’s ages of mulberry plant cultivation is the best options for higher leaf yield and quality whereas 150 kg, 90 kg and 60 kg potassium ha -1 year -1 respectively are better for controlling of leaf spot, tukra and powdery mildew diseases.

KELAYAKAN USAHA BUDIDAYA ULAT SUTERA (BOMBIX MORI L.) BERDASARKAN ASPEK NON FINANSIAL KABUPATEN BOALEMO

The purpose of this study was to determine the feasibility of the business based on non-financial aspects of silkworm cultivation. The results of this study were with high demand and with a guarantee of the cocoon market, silkworm cultivation business conducted in the Tangga Barito village, the working area of of KPHP Unit V Boalemo worthy of doing. Cocoon selling prices of Rp. 40,000 is a standard price that is appropriate for quality b (medium) cocoons. To increase the added value of mulberry cultivation, it can endeavor to manufacture mulberry tea which is used as an antioxidant drink or to process silkworm waste into organic fertilizer. For technical and technology aspects starting from the business location, the location of caterpillar maintenance in general is close to the residence so as to facilitate maintenance and supervision. Silkworm cultivation is prepared starting from the building of silkworms to how to control pests and diseases that attack silkworms. The organization in question consists of informing matters relating to the cultivation of silkworms, directing, coordinating the development of mulberry and silkworm maintenance demonstration plots. From these results the silkworm business is feasible to run.Keywords: Aspect of non financial, Boalemo, Business feasibility, silkworms

A Study on the Perception of Farmers on Mulberry Cultivation and Silkwarms Rearing in Channapattana Talukh

A Study on the Perception of Farmers on Mulberry Cultivation and Silkwarms Rearing in Channapattana Talukh

Paclobutrazol Induces Photochemical Efficiency in Mulberry (Morus alba L.) Under Water Stress and Affects Leaf Yield Without Influencing Biotic Interactions

Mulberry (Morus spp.) is an important plant used for rearing silkworm (Bombyx mori L.). Its fruit is also used for human consumption with several medicinal properties. Most of the mulberry cultivation in India is under the risk of either intermittent or terminal drought, as 50% of the country’s mulberry acreage falls under arid and semi-arid conditions. Triazole-induced abiotic stress tolerance has been used successfully in many horticultural crops including planted trees. In order to understand the underlying mechanism, the effect of paclobutrazol (PBZ), a triazole, was studied on physiological tolerance in mulberry under water stress, and rainfed conditions. During pot experiment, PBZ improved photosynthetic accumulation of CO2 under water stress conditions, thus improving survival percentage. Different concentrations of PBZ (5, 10, 25, 50, 100, and 500 mg L−1) were applied in field during rainfed conditions. Lower concentration (10–25 mg L−1) of PBZ significantly (p ≤ 0.05) improved leaf biomass by increasing net photosynthetic rates. Increase in the photochemical efficiency of PSII and higher NPQ mediated through xanthophyll cycle was found to be the mechanism for these physiological effects. PBZ also reduced lipid peroxidation by inducing enzymatic antioxidants and redox metabolites. Bioassays do not suggest any negative interactions on silkworm or on downstream processing of silk. This study, therefore, provides mechanism of physiological tolerance and recommends the use of PBZ to mitigate stressful environment in planted trees under water stress and rainfed conditions. Results have been discussed in context of improving commercial silk yield.

Occurrence of Tobacco Streak Virus in Mulberry

Mulberry (Morus alba) is an important tree crop of the family Moraceae. Moriculture serves as an important input for the silk industry, and most of the states in India have taken up sericulture as an important agro-industry. Currently, a total area of 9,491 ha is involved in mulberry cultivation in Tamil Nadu. In March 2016, a survey was conducted to record the incidence of cotton necrosis disease caused by Tobacco Streak virus (TSV), the type member of the genus Ilarvirus, in different districts of Tamil Nadu. Severe necrosis in mulberry plants cultivated near an infected cotton field was observed in Annur village, Coimbatore District of Tamil Nadu State, India. The following symptoms were observed: dark brown necrotic rings and marginal necrosis prominent in all the leaves of the upper and middle whorl. Cupping, curling, and brittleness of young leaves were also observed. The incidence of this necrotic syndrome was as high as 25%. To test for transmissibility of the disease, the young leaves with symptoms of severe necrosis were taken from mulberry plants, and the crude sap was extracted using 0.1 M phosphate buffer with 1% sodium sulfite, 1 to 2% sodium ethylenediaminetetraacetic acid, and 0.01 M β-mercaptoethanol, pH 7.2 (Rageshwari et al 2016). The extract was swabbed onto cotyledon leaves of cowpea cultivar 152 (Vigna unguiculata) and incubated under insect-proof cages. Necrotic lesions were observed 5 days postinoculation on inoculated leaves. The symptomatic, inoculated cowpea leaves were reinoculated onto 15 mulberry plants, which resulted in cupping and curling of leaves. Total RNA was extracted from mulberry leaves exhibiting necrosis with TRIzol (Chomczynski and Sacchi 1987). Reverse transcription polymerase chain reaction was performed using the RevertAid cDNA synthesis kit (Thermo Scientific) and TSV capsid protein gene specific primers TSVCPF (AGATAAGTCGCTTCTCGGAC) and TSVCPR (TGCTCGCATGGGTCATAGAC), based on TSV subgenomic RNA 4a. Amplicons of approximately 900 bp were generated from three symptomatic plants, and two of those amplicons were sequenced, producing an identical sequence, which was deposited in GenBank under the accession number KX405023. BLAST analysis revealed the closest nucleotide identity of 98 to 99% with TSV isolates KY176870 (sunflower, Andhra Pradesh), KF264470 (sunflower, Tamil Nadu), AY501482 (okra, Maharashtra), and AY501476 (sunflower, Maharashtra). Phylogenetically, all these isolates of TSV were placed in a single clade. To the best of our knowledge, this is the first report of TSV causing mulberry necrosis in India. These findings reveal mulberry tree as a host of TSV, and, hence, care should be taken to avoid cultivation of mulberry near cotton fields to minimize the disease spread.

Adaptation of Morus alba and Morus cathayana plants in a different climate and environment conditions in Indonesia

Abstract. Sasmita N, Purba JH, Yuniti IGAD. 2019. Adaptation of Morus alba and Morus cathayana plants in a different climate and environment conditions in Indonesia. Biodiversitas 20: 544-554. Mulberry (Morus alba L. and Morus cathayana Hemsl.) cultivation business as silkworm feed in Indonesia is increasing, considering the benefits of mulberry economically, ecologically and pharmaceutically. This study aimed to determine the mulberry plants adaptation to the ability of life and growth of mulberry cuttings. The research was conducted at three different places i.e. BPTH Bali, Cianjur Alam Sutra Nursery (West Java) and East Kutai Farming Farm, using Randomized Block Design consisted of mulberry treatments (M. alba and M. cathayana) and three treatments i.e. using Rootone F, Using Organic solution and Control (no added. The results show different growth rates from various regions in Indonesia. Mulberry growth in West Java was the best compared to mulberry which growth in Bali and Kalimantan. The highest live percentage was observed in West Java for M. alba (95%) and M. cathayana (90%), followed by Bali M. alba (85%) and M. cathayana (80%), Kalimantan M. alba (80%) and M. cathayana (75%). The best high parameter of mulberry plant in West Java for M. alba (80cm) and M. cathayana (76 cm), in Bali for M. alba (67 cm) and M. cathayana (76cm), in Kalimantan for M. alba (58 cm) and M. cathayana (50cm). The best mulberry species based on the whole parameter is M. alba in West Java. This means that West Java climate and environmental conditions are good for mulberry cultivation.

Eco-friendly Environment of Tripura, India Prove to be a Boon for Tasar Cultivation on Zizyphus mauritiana L.

Indian silk industry is the second largest producer of silk in the world. India has the unique distinction of being the only country producing all the five known commercial silk, namely, Mulberry, Tropical Tasar, Oak Tasar, Eri, and Muga. Among the four varieties of silk produced in 2015-16, Tasar accounts for 9.90%, i.e., 2,818 MT of the total raw silk production of 28,472 MT. In Tripura, the societies are well acquainted with only mulberry silk production. Temperature plays a very vital role in the growth of Tasar (Anthereae mylitta) silkworm also. Anthereae mylitta is a species of moth in the family Saturniidae known commonly as the Tasar silkworm and Vanya silkworm. This species is variable, with at least 44 identified eco-races, populations adapted to varied ecological conditions and food plants. Though Tripura is endowed with well demarcated sub-tropical and temperate zones with a low average temperature of 10°C in the winter season which rises to a maximum average of 35°C in the summer, it supports the cultivation of tropical Tasar silkworm in a very unique manner naturally. The present study analyzes the morphological behavior of the Tasar silkworm in a new environment and its interaction to that particular eco-friendly environment to facilitate the socioeconomic upliftment regarding the sericulture practices exhibited by the rural people of the state of Tripura. This study also proves that in the near future Tasar culture will become a boon to the poor people along with Mulberry cultivation.

Managerial ability of Sericulturists in Amravati district

The present study on managerial ability of sericulturists in Amravati district was conducted in Dhamangaon Railway and Nandgaon Khandeshwar taluka of Amravati district. The 120 respondents were selected from 10 villages. The data were collected by personal interview method with the help of structured interview schedule. The data were tabulated, analyzed and interpreted. The study showed that the majority 43.33 per cent of respondents belonged to middle age group (36 to 50 years), 30.83 per cent of respondents were educated to high school level, 70.83 per cent of the respondents had medium level (4 to 6 ha) of farming experience, 57.50 per cent of the respondents had small (1.01 to 2.00 ha) land holding, 45.00 per cent of the respondents having low-medium annual income (Rs. 50,000 to 1,00,000), 90.00 per cent of the respondents had medium (0.29 to 0.64 ha) in area under mulberry cultivation. Related to material possession, it was observed that 68.33 per cent of respondents possessed rearing trays, 90.83 per cent of respondents possessed rearing stands, 93.33 per cent of respondents possessed rearing house, 90.00 per cent of respondents possessed leaf cutters. The 61.67 per cent had medium level of risk orientation, 75.83 per cent had occasional extension participation. Regarding to training received, it was observed that 80.83 per cent of respondents had medium category, 70.00 per cent of respondents had medium access to market and majority of the respondents 72.50 per cent had medium net profit. Majority of the respondents 69.17 per cent had medium managerial ability in sericulture enterprise. The majority 81.66 per cent of sericulturists were in opinion that non-availability of input material with 1st rank. Correlation co-efficient of selected characteristics of respondents namely education, farming experience, annual income, material possession, extension participation, access to market and net profit were found the positive and highly significantly correlated with managerial ability at 0.01 level of probability whereas, the variable training received was found positive and significantly correlated with managerial ability at 0.05 level of probability. The variables age, land holding, area under mulberry and risk orientation showed non-significantly correlated with managerial ability.

Evaluation of the alkaloid, polyphenols, and antioxidant contents of various mulberry cultivars from different planting areas in eastern China

Mulberry (Morus alba L.), a traditional industrial crop, has various cultivars and a large planting area in China and consequently, high exploitation potential. The aim of this study was to systematically study the mulberry resources in eastern China. Twenty-four mulberry leaf samples of eight representative cultivars from five provinces in eastern China were investigated. The alkaloid and polyphenols contents were determined by HPLC–MS/MS, and the total polyphenols and flavonoid contents were also obtained. Then, FRAP, ABTS, and DPPH tests were used to determine the antioxidant activity of mulberry leaves. The results indicated that the content of 1-deoxynojirimycin was within the range of 0.438 ± 0.010 mg/g–2.159 ± 0.016 mg/g, and the content of fagomine ranged from 0.379 ± 0.018 mg/g to 1.675 ± 0.021 mg/g. The samples from Anhui had the best antioxidant activity, of which the DPPH free radical-scavenging capacity reached 70.837 ± 1.246%, and the ferric reducing antioxidant power was 258.864 ± 22.718 mmol Fe2+/g. The principal component analysis results showed that there was a good correlation between the total polyphenols content, total flavonoid content, chlorogenic acid content, and antioxidant activity. Considering the active ingredient contents and antioxidant activity, we found that Yu711 was the most economically valuable variety, and Anhui is the best location to promote mulberry cultivation in eastern China, which provides a basis for the rational utilization of mulberry industrial products.

Critical Analysis on Role of Women in Sericulture Industry

Women constitute more than fifty per cent of the world's population, one third of the labour force, and perform nearly two thirds of all working hours. Women are also mostly engaged in the unorganized sector (Mehta and Sethi, 1977). This is more in the case of agriculture and allied activities. Sericulture is one of the important potential labour intensive agro-based rural industry in the world. No wonder women are playing a very important role in the sericulture industry. Their qualities like maternal instincts and loving care of those under their charge prove to be very helpful in the successful breeding of silk worms. The sericulture industry has opened up phenomenal employment avenues and has helped women to become important players in the decision-making process—whether in the household or in the community at large. The active involvement of women is very essential for the success of any community development initiative. This has been proved on many occasions all over the world—more so in the developing countries. This paper analyzed that impact of women workers’ dominance in sericulture sector upon the process of inclusive development in the rural household sectors of West Bengal. Women has patience, perseverance, caring attitude and adaptability to new technologies have made her activities more dominant in sericulture and silk production. The present study reveals that Women are engaged with about 60% (about 57% in 1st year and about 64% from 2nd year onwards) work in various sector in Sericulture i.e. from Mulberry cultivation to Silk weaving etc. and women are doing their works successfully in every sector.

Impact of simple agro-ergonomic practices adoption in mulberry cultivation for natural resources saving; cost reduction and increase income to sericulture farmers

Impact of simple agro-ergonomic practices adoption in mulberry cultivation for natural resources saving; cost reduction and increase income to sericulture farmers

The artisanal silk industry of West Bengal: A study of its history, performance and current problems

Abstract. Artisanal silk industry is a highly labour and land intensive activity ideally suited for economy like India. During medieval period, it was practiced as a dependable livelihood and Moghul Rulers were the patronizers. By 16 th Century, commercial production of silk was started in Bengal by Sultan Hussain Shah. From the mid of 17 th century, silk trade in India started flourishing since the demand for cheaper Bengal Silk began to rise in the European market. British traders realized that only low price of silk would not be enough to retain their market, and they introduced Piedmontese technology, though it was not suitable for Bengal economy at that point of time. After cessation of monopoly trade right, EEIC started selling off its filatures, thus spelling its gradual decline. After independence, attempts were made to transplant the temperate sericulture technology in the traditional silk producing states of India. West Bengal failed to bring the desired result both in domestic and export front, primary reason being large production of nistari multivoltine, while the export intensive bivoltine silk production is grossly ignored. During 2007-2012, the production of raw silk rose from 1660MT to 1924 MT, but the employment generation showed an enormous decline from 3.03 to 2.71 lakhs. The primary analysis in the Malda district explains that number of man-days generated from different phases of silk-worm rearing activity influences the total income generation of the artisans. On the other hand, cost of machineries and loans taken by household farms have positive effects on income generation of the sericulture farms. The primary analysis also reveals that area of mulberry cultivation, educational background of family head and total man-days creation have an inverse impact on the level of average employment generation in rural sericulture, while rise in household size and numbers of male and female hired labour have positive impact on the level of employment generation in a sericulture family farm. Employment of women generates a superior impact on the nutritional and educational level of the children and this study shows that higher percentage of female members in the household, wage accruals to the hired female workers and family empowerment of female members raise the gender pre-dominance of the sericulture farms. Keywords. Artisanal silk industry, Income, Employment, Gender labour force. JEL. J16, N00, O13, P46, R31.

Critical Analysis on Role of Women in Sericulture Industry

Women constitute more than fifty per cent of the world's population, one third of the labour force, and perform nearly two thirds of all working hours. Women are also mostly engaged in the unorganized sector (Mehta and Sethi, 1977). This is more in the case of agriculture and allied activities. Sericulture is one of the important potential labour intensive agro-based rural industry in the world. No wonder women are playing a very important role in the sericulture industry. Their qualities like maternal instincts and loving care of those under their charge prove to be very helpful in the successful breeding of silk worms. The sericulture industry has opened up phenomenal employment avenues and has helped women to become important players in the decision-making process—whether in the household or in the community at large. The active involvement of women is very essential for the success of any community development initiative. This has been proved on many occasions all over the world—more so in the developing countries. This paper analyzed that impact of women workers’ dominance in sericulture sector upon the process of inclusive development in the rural household sectors of West Bengal. Women has patience, perseverance, caring attitude and adaptability to new technologies have made her activities more dominant in sericulture and silk production. The present study reveals that Women are engaged with about 60% (about 57% in 1st year and about 64% from 2nd year onwards) work in various sector in Sericulture i.e. from Mulberry cultivation to Silk weaving etc. and women are doing their works successfully in every sector.

An economic analysis of mulberry cultivation and cocoon production in non-traditional area

Sericulture is a farm based, labor intensive and economic activity supporting farm families and cottage and small scale sector. Being one of the important sector in Indian economy it checks poverty and migration. Sericulture involves a series of activities like mulberry cultivation, cocoon production, silk reeling and the products in different forms. Sericulture is not only limited to the few areas where it is been intensively practiced called traditional areas but also for non-traditional areas. This study aims to know the profitability of mulberry cultivation and cocoon production by using primary data collected from 120 farmers of North Karnataka, India. The cost of mulberry cultivation per acre worked out to be 12699.82/-for rearing 300 Disease Free Laying (DFL's) of which 77.95 per cent is composed of variable component mainly human labour and the rest is fixed component. The gross returns on selling of mulberry leaves and stalks amounts 9472.91/-. So it is not profitable to cultivate mulberry for selling leaves instead one could rear the silkworm by purchasing leaves, but availability of mulberry leaves during all times is not assured. The cost of rearing 100 DFL's is worked out to be 33738.84/-and returns amounts 38604.96/-with a marginal net returns of 4866.12/-. The lower net returns attributed to lower prices due to poor established markets in non-traditional areas and low productivity (cocoon yield per 100 DFL's) i.e. 59.02 kg compared to traditional areas i.e. 90.00 kg.

Sericulture as an Employment Generating Household Industry in West Bengal (A Study on its Current Problems & Prospects)

Employment generation is one of the major potentials of Sericulture and Silk Industry in India. The farm and non-farm activity of this sector creates sixty lakh mandays of employment every year mostly in rural sector. The industry helps to create egalitarian distribution of income as it transfers greater share of its wealth from high end urban customers to poor artisan classes. In West Bengal, more than one lakh families are occupied with sericulture activities where Karnataka is the state with the largest number of families involved with sericulture. Despite having high level family involvement, West Bengal produces smaller quantities of raw silk compared to Karnataka as well as Andhra Pradesh. This paper investigates the reason of this low production and finds out that low productivity of land is no way responsible for that. Different Employment Models constructed in this paper suggest that ‘area of mulberry cultivation’, ‘cocoon-market’ and ‘power-looms’ are powerful factors in changing the level of employment, while the primary survey exposes factors like ‘unitary household structure’, ‘income’ ‘years of education’ and ‘numbers of female in the household’ as the significant factors in accelerating average employment per family. The spillover effect of this employment generation is studied at the end. The study finds that as a poverty eradication measure, sericulture fails to expand in rural West Bengal vis-a-vis the other prominent states. But income inequality is undoubtedly diminished with the practice in sericulture.

To analyse the cost of mulberry and cocoon production in Haveri district

The study was conducted in Haveri district of Karnataka state. Where mulberry area of 947 hectares and cocoon production of 680.511 M tonnes, respectively during 2013-14 was observed. The study was conducted to analyze the cost of mulberry and cocoon production in Haveri district. In Haveri district two talukas were selected namely Haveri and Ranebennur. The cost of mulberry cultivation was found to be Rs. 23278.54 per acre in case of marginal farmers, Rs. 25116.18 per acre in case of small farmer and Rs. 26358.52 per acre in medium farmers. The cost of cocoon production was high for medium farmers Rs. 50046.54 per acre, followed by small farmers Rs.55036.06 per acre and marginal farmers Rs. 59187.20 per acre. Sericulture is a labour intensive enterprise providing employment to both men and women in mulberry cultivation and cocoon production. Where family labour was employed in this enterprise all around the year. Thus, encouraging this enterprise would help to generate additional income and absorb family labour which is under employed during off season.

Biotechnology of mulberry (Morus L.) - A review

Mulberry (Morus sp.) is one of the economically important trees grown in Asian countries. It is cultivated to provide leaves for feeding the caterpillars of the silk producing insect (Bombyx mori L.). In addition, it adds value through production of edible fruits, timber and several pharmaceutically important chemicals. Improvement of mulberry through conventional breeding is limited due to high heterozygosity and long generation period. Attempts have recently been made to complement conventional breeding with modern biotechnological tools such as plant tissue culture, recombinant DNA technology and molecular markers to facilitate mulberry genetic improvement. The techniques of tissue culture have grown considerably in mulberry and encompassed areas including micropropagation, plant regeneration from leaf discs, and screening for stress tolerance. Recently, genetic engineering was adopted to enhance drought and salt tolerance in mulberry using HVA1 and Osmotin genes. Molecular markers such as Random amplified polymorphic DNA (RAPD), inter simple sequence repeats (ISSR) and simple sequence repeats (SSR) have been used for molecular characterization of mulberry germplasm, biodiversity analysis, genetic mapping and identification of molecular markers for growth and yield . However, still a number of issues such as resistance to fungal and bacterial diseases, combating infestation of pests and insects, and tolerance to drought and salinity are to be sorted out to achieve sustainable mulberry cultivation to meet the increasing demand of the silk industry. This review describes the developments of tissue culture, transgenesis and molecular markers in mulberry and highlights the current constraints and future prospects.

Groupwise sampling: a strategy to sample core entries from RAPD marker data with application to mulberry

A strategy for effective utilization of RAPD marker data for sampling diverse entries was suggested and utilized for the development of mulberry core collection. Mulberry (Morus spp.) is a perennial tree cultivated mainly for its foliage in sericulture industry and also known for its edible fruits, fodder, and valued timber. In recent years, mulberry cultivation is confronted with several abiotic and biotic stresses due to inimical climatic factors and this has necessitated the genetic improvement of the crop. Core collection is an efficient way of harnessing the trait variation and novel genes available in a natural gene pool for the development of improved elite lines. In this study, we analyzed 850 mulberry accessions assembled from 23 countries with separate sets of polymorphic RAPD markers along with a limited number of ISSR, SSR, and phenotypic markers. A total of 75 accessions were duplicated in 20 clusters among five natural groups. The limitations of the RAPD marker system like problem in cross gel comparison were tackled by adopting a novel “Groupwise sampling” approach. A mulberry core collection with 100 diverse entries was selected using maximization method implemented in MSTRAT software. The mean Dice dissimilarity coefficient computed from marker data was 0.308 among core entries. Indigenous and exotic entries were not discriminated in cluster and principal component analysis supporting the spread of mulberry far from the place of origin. Accessions belonging to two wild mulberry species from Andaman Islands and Himalayan region formed separate clusters indicating the geographical, reproductive, and taxonomic distinction. The identified core collection will be available for researchers for intensive mining of desirable alleles in mulberry improvement as well as in genome resequencing program.

不同施氮量对桑园红壤耕层酶活性的影响

不同施氮量对桑园红壤耕层酶活性的影响