Occurrence of Tobacco Streak Virus in Mulberry

Abstract

Mulberry (Morus alba) is an important tree crop of the family Moraceae. Moriculture serves as an important input for the silk industry, and most of the states in India have taken up sericulture as an important agro-industry. Currently, a total area of 9,491 ha is involved in mulberry cultivation in Tamil Nadu. In March 2016, a survey was conducted to record the incidence of cotton necrosis disease caused by Tobacco Streak virus (TSV), the type member of the genus Ilarvirus, in different districts of Tamil Nadu. Severe necrosis in mulberry plants cultivated near an infected cotton field was observed in Annur village, Coimbatore District of Tamil Nadu State, India. The following symptoms were observed: dark brown necrotic rings and marginal necrosis prominent in all the leaves of the upper and middle whorl. Cupping, curling, and brittleness of young leaves were also observed. The incidence of this necrotic syndrome was as high as 25%. To test for transmissibility of the disease, the young leaves with symptoms of severe necrosis were taken from mulberry plants, and the crude sap was extracted using 0.1 M phosphate buffer with 1% sodium sulfite, 1 to 2% sodium ethylenediaminetetraacetic acid, and 0.01 M β-mercaptoethanol, pH 7.2 (Rageshwari et al 2016). The extract was swabbed onto cotyledon leaves of cowpea cultivar 152 (Vigna unguiculata) and incubated under insect-proof cages. Necrotic lesions were observed 5 days postinoculation on inoculated leaves. The symptomatic, inoculated cowpea leaves were reinoculated onto 15 mulberry plants, which resulted in cupping and curling of leaves. Total RNA was extracted from mulberry leaves exhibiting necrosis with TRIzol (Chomczynski and Sacchi 1987). Reverse transcription polymerase chain reaction was performed using the RevertAid cDNA synthesis kit (Thermo Scientific) and TSV capsid protein gene specific primers TSVCPF (AGATAAGTCGCTTCTCGGAC) and TSVCPR (TGCTCGCATGGGTCATAGAC), based on TSV subgenomic RNA 4a. Amplicons of approximately 900 bp were generated from three symptomatic plants, and two of those amplicons were sequenced, producing an identical sequence, which was deposited in GenBank under the accession number KX405023. BLAST analysis revealed the closest nucleotide identity of 98 to 99% with TSV isolates KY176870 (sunflower, Andhra Pradesh), KF264470 (sunflower, Tamil Nadu), AY501482 (okra, Maharashtra), and AY501476 (sunflower, Maharashtra). Phylogenetically, all these isolates of TSV were placed in a single clade. To the best of our knowledge, this is the first report of TSV causing mulberry necrosis in India. These findings reveal mulberry tree as a host of TSV, and, hence, care should be taken to avoid cultivation of mulberry near cotton fields to minimize the disease spread.