Monopartite Begomovirus Research Articles

Assessment of the effectiveness of Ty genes in tomato against tomato leaf curl Bangalore virus

AbstractTomato leaf curl Bangalore virus (ToLCBaV), a monopartite begomovirus transmitted by the whitefly Bemisia tabaci, has become a major constraint in tomato production in the Indian subcontinent. Earlier breeding efforts in India led to the adoption of tomato cultivars carrying the resistance gene Ty‐2. However, it has been observed recently that such cultivars/hybrids are susceptible to begomoviruses. This requires the identification of additional or new sources of resistance against ToLCBaV. The present study was undertaken to assess the effectiveness of several Ty genes in providing resistance against infection by ToLCBaV. The kinetics of virus multiplication in different Ty resistance gene stocks of tomato were estimated and compared using quantitative PCR data. Accumulation of viral genomic units and symptom severity were lower in tomato lines carrying Ty‐3 and Ty‐2 + Ty‐3 compared with those carrying Ty‐2 alone. All tested lines carrying Ty‐2 showed typical tomato leaf curl disease symptoms. Tomato lines carrying Ty‐2 + ty‐5 and ty‐5 + Ty‐6 combinations had a significantly higher disease severity index and viral genomic units compared to those carrying Ty‐3 and Ty‐2 + Ty‐3 at 30 days postinoculation. The accumulation level of ToLCBaV genomic units serves as a good indicator for resistance selection along with other parameters of disease. We present here a comprehensive overview of the effectiveness of Ty‐2, Ty‐3, and ty‐5 alone as well as the combinations Ty‐2 + Ty‐3 and Ty‐2 + ty‐5 against ToLCBaV.

Genome characterisation of a distinct species of Begomovirus causing leaf curl disease in sweetpotato [Ipomoea batatas L. (Lam)] in India

ABSTRACT A novel species of monopartite begomovirus was detected in sweetpotato [Ipomoea batatas L (Lam)] originating from the experimental field of ICAR-AICRP on Tuber Crops (West Bengal), India. The plants showed a typical upward curling of leaves symptoms and reduction in plant height and was easily transmitted through the tuber and vine cuttings of infected plant. PCR-mediated detection using specific primers confirmed the presence of begomovirus in the infected sweetpotato plants. The virus isolate was characterised genome level with 2823 nucleotide in size (GenBank accession FN432356) and designated as Sweet potato leaf curl Bengal virus (SPLCV) (India:West Bengal). The comparative analysis showed that SPLCV (India:West Bengal) clustered with distinct isolate of previously reported 35 SPLCV in the world. Six ORFs of the isolate were highly divergent from equivalent regions of other isolates. Sequence comparisons and population structure analysis of 35 SPLCV isolates revealed that SPLCV (India:West Bengal) showed 85–90% nucleotide sequence identity. Systematic examination revealed that SPLCV (India:West Bengal) isolate was shown to have a recombinant in origin. The results of the current study have uncovered the diversity and genetic structure of sweetpotato leaf curl virus and generated potentially useful information for developing management strategies for this virus.

Classification of genomic components and prediction of genes of Begomovirus based on subsequence natural vector and support vector machine.

BackgroundBegomoviruses are widely distributed and causing devastating diseases in many crops. According to the number of genomic components, a begomovirus is known as either monopartite or bipartite begomovirus. Both the monopartite and bipartite begomoviruses have the DNA-A component which encodes all essential proteins for virus functions, while the bipartite begomoviruses still contain the DNA-B component. The satellite molecules, known as betasatellites, alphasatellites or deltasatellites, sometimes exist in the begomoviruses. So, the genomic components of begomoviruses are complex and varied. Different genomic components have different gene structures and functions. Classifying the components of begomoviruses is important for studying the virus origin and pathogenic mechanism.MethodsWe propose a model combining Subsequence Natural Vector (SNV) method with Support Vector Machine (SVM) algorithm, to classify the genomic components of begomoviruses and predict the genes of begomoviruses. First, the genome sequence is represented as a vector numerically by the SNV method. Then SVM is applied on the datasets to build the classification model. At last, recursive feature elimination (RFE) is used to select essential features of the subsequence natural vectors based on the importance of features.ResultsIn the investigation, DNA-A, DNA-B, and different satellite DNAs are selected to build the model. To evaluate our model, the homology-based method BLAST and two machine learning algorithms Random Forest and Naive Bayes method are used to compare with our model. According to the results, our classification model can classify DNA-A, DNA-B, and different satellites with high accuracy. Especially, we can distinguish whether a DNA-A component is from a monopartite or a bipartite begomovirus. Then, based on the results of classification, we can also predict the genes of different genomic components. According to the selected features, we find that the content of four nucleotides in the second and tenth segments (approximately 150-350 bp and 1,450–1,650 bp) are the most different between DNA-A components of monopartite and bipartite begomoviruses, which may be related to the pre-coat protein (AV2) and the transcriptional activator protein (AC2) genes. Our results advance the understanding of the unique structures of the genomic components of begomoviruses.

Molecular and Biological Characterization of a New World Mono-/Bipartite Begomovirus/Deltasatellite Complex Infecting Corchorus siliquosus.

The genus Begomovirus (family Geminiviridae) is the largest genus in the entire virosphere, with more than 400 species recognized. Begomoviruses are single-stranded DNA plant viruses transmitted by whiteflies of the Bemisia tabaci complex and are considered one of the most important groups of emerging plant viruses in tropical and subtropical regions. Several types of DNA satellites have been described to be associated with begomoviruses: betasatellites, alphasatellites, and deltasatellites. Recently, a family of single-stranded DNA satellites associated with begomoviruses has been created, Tolecusatellitidae, including the genera Betasatellite and Deltasatellite. In this work, we analyzed the population of begomoviruses and associated DNA satellites present in Corchorus siliquosus, a malvaceous plant growing wild in Central America, southeastern North America and the Caribbean, collected in Cuba. The genomes of isolates of two New World begomoviruses [(Desmodium leaf distortion virus (DesLDV) and Corchorus yellow vein Cuba virus (CoYVCUV)] and two deltasatellites [tomato yellow leaf distortion deltasatellite 2 (TYLDD2) and Desmodium leaf distortion deltasatellite (DesLDD)] have been cloned and sequenced from plants showing yellow vein symptoms. Isolates of one of the begomoviruses, CoYVCUV, and one of the deltasatellites, DesLDD, represent novel species. Experiments with infectious clones showed the monopartite nature of CoYVCUV and that DesLDD utilizes the bipartite DesLDV as helper virus, but not the monopartite CoYVCUV. Also, CoYVCUV was shown to infect common bean in addition to Nicotiana benthamiana. This is the first time that (i) a monopartite New World begomovirus is found in a host other than tomato and (ii) deltasatellites have been found in C. siliquosus, thus extending the host and helper virus ranges of this recently recognized class of DNA satellites.

Transgenic expression of the Agrobacterium tumefaciens single-stranded DNA binding protein VirE2 provides resistance to both bipartite and monopartite betasatellite-associated begomoviruses in Nicotiana benthamiana

Viruses of the genus Begomovirus (family Geminiviridae) are a threat to agriculture and food security throughout the warmer parts of the world. Begomoviruses are transmitted by the whitefly Bemisia tabaci and have genomes consisting of one (monopartite) or two (bipartite) circular, single-stranded (ss) DNA molecules. Most monopartite begomoviruses also associate with host range and symptom exacerbating satellites known as betasatellites. Cotton leaf curl Kokhran virus (CLCuKoV), in association with the betasatellite cotton leaf curl Multan betasatellite (CLCuMuB), is one of a number of viruses that cause cotton leaf curl disease in southern Asia. Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus widespread on the Indian subcontinent that has recently also been identified in North Africa and southern Europe and causes problems in a number of crops including cotton and tomato. The Agrobacterium tumefaciens virulence protein VirE2 has ssDNA binding activity. Nicotiana benthamiana was transformed with a construct for the expression of VirE2 to assess its potential to impart resistance to begomoviruses. Plants of three VirE2 transgenic lines showed attenuated symptoms when infected with either CLCuKoV, CLCuKoV with CLCuMuB or ToLCNDV relative to the severe symptoms induced in non-transformed plants. Presence of the betasatellite was found to reduce the effectiveness of the resistance imparted byVirE2. There was a marked reduction in the accumulation of viral/betasatellite DNA for both viruses as detected by Southern hybridization. The results indicate that VirE2 shows promise in efforts to develop non-conventional, broad spectrum resistance against begomoviruses, being active against monopartite and bipartite begomoviruses. Efforts should now focus on investigating VirE2 resistance in crop plants, with a view to developing commercially useful resistant lines.

Association of a begomovirus-satellite complex with yellow vein and leaf curl disease of hollyhock (Alcea rosea) in India.

Geminiviruses cause considerable yield loss in several crop plants worldwide. In 2016, several hollyhock plants displaying yellow mosaic and leaf curling symptoms were noticed in a nursery of Jawaharlal Nehru University, New Delhi, India. Analysis of the collected samples indicated an association of monopartite and bipartite begomoviruses with satellites. Three begomoviruses (including a member of a new begomovirus species), two alphasatellites, and a betasatellite were isolated from yellow-mosaic-disease-affected plants. Similarly, a begomovirus, two alphasatellites, and a betasatellite were found to be associated with leaf curl disease of hollyhock. These begomoviruses and satellites were found to be recombinants. By harboring diverse begomoviruses and satellite DNAs, hollyhock may serve as a potential source of virus inoculum.

Tomato leaf curl Kunene virus: a novel tomato-infecting monopartite begomovirus from Namibia.

This is the first description of the complete genome sequence of a new monopartite begomovirus isolated from tomato with symptoms of tomato (yellow) leaf curl disease collected in northwestern Namibia, which we provisionally name "tomato leaf curl Kunene virus". The DNA-A-like nucleotide sequence shares the highest nucleotide sequence identity (82.8%) with tobacco leaf curl Zimbabwe virus (ToLCZWV). Phylogenetic analysis confirmed its affiliation with Old World monopartite begomoviruses. The discovery of a new begomovirus in a vegetable plant in Namibia highlights the importance of maintaining epidemiological surveillance in southern Africa.

Codiaeum variegatum in Pakistan harbours pedilanthus leaf curl virus and papaya leaf curl virus as well as a newly identified betasatellite.

Codiaeum variegatum (common name, garden croton) is an ornamental plant grown for its bright yellow variegated leaf morphology. Two C. variegatum plants with upward leaf curling and vein swelling symptoms were collected in Faisalabad, Pakistan. Sequencing of clones obtained by PCR amplification with specific primers showed one plant infected with the monopartite begomoviruses pedilanthus leaf curl virus (PeLCV) and papaya leaf curl virus (PaLCuV) and the other to be infected with only PeLCV. Both plants also harboured a betasatellite that was distinct from all previously identified betasatellites, for which the name "codiaeum leaf curl betasatellite" (CoLCuB) is proposed. This is the first identification of a begomovirus and an associated betasatellite infecting C. variegatum in Pakistan. Both PeLCV and PaLCuV cause problems in a number of crop plants, and C. variegatum may act as a reservoir for these agriculturally important viruses. The precise impact and geographical distribution of the newly identified CoLCuB will be investigated.

In silico analysis of PepYLCV-βC1 protein interaction with pepper-SnRK1 for pathogenicity prediction

Pepper yellow leaf curl virus [PepYLCV] is a monopartite begomovirus that is usually associated with a beta satellite which encodes a pathogenicity protein [βC1] responsible for symptom appearance. A recent study revealed that plants overexpressing SnRK1 were delayed for symptom appearance and lower levels of satellite DNA. The current study provided the interaction of PepYLCV BC1 and Pepper SnRK1 protein by using computational approaches including homology modeling and protein-protein docking. The reliability of the 3D model was validated by using the Procheck server. Findings suggest that ubiquitin-associated [UBA] and auto-inhibitory sequence [AIS] domains of Pepper-SnRK1 are involved in the PepYLCV-βC1 interaction. Findings provide computational data support for domain-level interactions to predict the pathogenicity of new monopartite begomoviruses that lack known experimental data.

First Report of Papaya Leaf Curl China Virus on Passion Fruit in China

Papaya leaf curl China virus, a monopartite begomovirus, belongs to genus Begomovirus, family Geminiviridae. Papaya leaf curl China virus (PaLCuCNV) was originally reported on Carica papaya L. in Guangxi province of China (Wang et al. 2004). To date, the virus has been reported to infect many plants, including Carica papaya, Solanum lycopersicum, Corchoropsis timentosa, Siegesbeckia orientalis, Ageratum conyzoides, Eclipta prostrata, and Acalypha australis (Huang et al. 2006; Tang et al. 2018; Yang et al. 2011; Zhang et al. 2010; Zhang et al. 2015). Passion fruit (Passiflora spp.) is an economically important fruit crop in many tropical and subtropical regions worldwide. In recent years, two passion fruit species, the purple (Passiflora edulis Sims) and the yellow (Passiflora edulis f. flavicarpa Degener), were widely planted in southern China, including Guangdong, Guangxi, Fujian, Jiangxi, and Guizhou provinces. Until now, more than 30 plant viruses, including two begomoviruses, Euphorbia leaf curl virus and papaya leaf curl Guangdong virus, have been reported on passion fruit in several countries (Cheng et al. 2014). There are few reports on viruses infecting passion fruit in mainland China. In June 2018, plants of passion fruit were found exhibiting leaf curl, malformation on leaves, in one orchard of Ganzhou city, Jiangxi province. Two symptomatic leaf samples were collected from two diseased plants, and the total RNA was extracted from the leaf tissues using TRIzol reagent (Invitrogen, U.S.A.) according to the manufacturer’s protocol. The extracted RNA was subjected to ribosomal RNA depletion and a cDNA library constructed using a TruSeq RNA Sample Prep kit (Illumina, U.S.A.) and sequenced by an Illumina HiSeq X-ten platform. A total of 40,544,026 candidate clean reads were eventually obtained and assembled de novo by CLC Genomics Workbench 9.5 (Qiagen). BLASTn searches of the resulting contigs revealed the presence of one virus contig of 1,027 nucleotides (nt) nearly identical (99.88%) to PaLCuCNV. To determine the complete viral genome sequence, two pairs of abutting primers were designed based on the contig. The complete DNA-A sequence of this isolate of PaLCuCNV, designated as PaLCuCNV-[China:Jiangxi:Passion fruit:2018], consists of 2,754 nt. A phylogenetic tree constructed with the full genome sequences of PaLCuCNV isolates showed the closest relationship to the PaLCuCNV Chinese (Jiangxi) isolate KP68559, which was collected from on A. conyzoides. The complete nucleotide sequence has been submitted to the GenBank database under accession number MN092343. We used PCR assay with the specific primers (β01, GGTACCACTACGCTACGCAGCAGCC; and β02, GGTACCTACCCTCCCAGGGGTACAC) to target the betasatellite DNA (Briddon et al. 2002) but did not generate any amplicon. In a brief survey, another 19 passion fruit leaf samples, which were asymptomatic, were collected from the same orchard to test for the presence of PaLCuCNV by PCR. Seven of the 19 samples tested positive for the virus. To our knowledge, this is the first report of natural occurrence of PaLCuCNV on passion fruit in China. This report indicates that passion fruit plays a possible role as a reservoir host in PaLCuCNV transmission.

Present status of cotton leaf curl virus disease (CLCUVD): a major threat to cotton production

Cotton is a major cash crop cultivated throughout the world for fiber, feed, fuel and food. Globally, it ranked 1st for fiber and 2nd among the oilseed crops. It is cultivated in around 60 countries of the world with an approximate production of 119.8 million bales annually. During its life cycle, cotton is exposed to about 75 destructive diseases from sowing till harvesting. These stresses are responsible for about 50% yield losses annually with a worth of $ 50 billion in the world. Among them, Cotton leaf curl virus disease (CLCuVD) is one of the significant factors responsible for yield reduction worldwide. This disease is caused by cotton leaf cur virus which is mainly acquired and transmitted by the vector Whitefly (Bemisia tabaci). This virus belongs to the family Geminiviridae and genus Begomovirus. Geminiviruses consist of small circular, single stranded DNA encapsidated in a twinned icosahedral pattern. These are either monopartite or bipartite. Bipartite begomoviruses are composed of circular single stranded DNA-A and DNA-B, both these components are essential for the infection in New World while some bipartite begomoviruses are also present in Old World, but differences are still present. Monopartite begomoviruses are composed of circular single stranded DNA-A and satellite molecules (DNA α-satellite and β-satellite), these are essential components for the severity of disease in the Old World. Efforts are underway to develop new strategies to protect the cotton plants against CLCuVD and its viral causal agents. This review helps the reader to better understand the biology of Cotton leaf curl virus (CLCuV), its behavior/interaction with the host Whitefly as well as recent developments being made for the control of cotton leaf curl disease.

Association of cotton leaf curl Multan betasatellite and Ageratum conyzoides symptomless alphasatellite with tomato leaf curl New Delhi virus in Luffa cylindrica in Pakistan

Luffa plants showing symptoms of begomovirus infection were collected from Vehari, Punjab in 2016. RCA and PCR amplifications of begomovirus genomic components showed the presence of a typical Old World bipartite begomovirus Tomato leaf curl New Delhi virus (ToLCNDV). Interestingly, Ageratum conyzoides symptomless alphasatellite and CLCuMB were also found associated with bipartite begomoviruses in the same host, however, no monopartite begomovirus was detected. To the best of our knowledge, this is the first report of ToLCNDV with associated satellites infecting L. cylindrica in Pakistan. The importance of begomovirus extended host range with different combinations of associated satellites has been discussed.

Tomato vein clearing leaf deformation virus, a new begomovirus species infecting tomato in Argentina

Begomoviruses (family Geminiviridae) cause economic damage around the world in tomato crops. Here, we present the molecular characterization of a new bipartite begomovirus that infects tomato in Argentina. Sequences analyses revealed that the DNA-A of this begomovirus shares the highest nucleotide percentage identity (81.3%) with Centrosema yellow spot virus (CenYSV). In phylogenetic studies, the DNA-A sequence was shown to be related to bipartite and monopartite begomoviruses from Brazil. Tomato plants biolistically inoculated with the new virus displayed vein clearing and leaf deformation symptoms, fulfilling the Koch’s postulate. We propose the tentative name tomato vein clearing leaf deformation virus (ToVCLDeV) for this new begomovirus species.

Journey of begomovirus betasatellite molecules: from satellites to indispensable partners.

Betasatellites are a group of circular, single-stranded DNA molecules that are frequently found to be associated with monopartite begomoviruses of the familyGeminiviridae. Betasatellites require their helper viruses for replication, movement, and encapsidation and they are often essential for induction of typical disease symptoms. The βC1 protein encoded by betasatellites is multifunctional that participates in diverse cellular events. It interferes with several cellular processes like normal development, chloroplasts, and innate immune system of plants. Recent research has indicated βC1 protein interaction with cellular proteins and its involvement in modulation of the host's cell cycle and symptom determination. This article focuses on the functional mechanisms of βC1 and its interactions with other viral and host proteins.

Frequent occurrence of Mungbean yellow mosaic India virus in tomato leaf curl disease affected tomato in Oman

Next generation sequencing (NGS) of DNAs amplified by rolling circle amplification from 6 tomato (Solanum lycopersicum) plants with leaf curl symptoms identified a number of monopartite begomoviruses, including Tomato yellow leaf curl virus (TYLCV), and a betasatellite (Tomato leaf curl betasatellite [ToLCB]). Both TYLCV and ToLCB have previously been identified infecting tomato in Oman. Surprisingly the NGS results also suggested the presence of the bipartite, legume-adapted begomovirus Mungbean yellow mosaic Indian virus (MYMIV). The presence of MYMIV was confirmed by cloning and Sanger sequencing from four of the six plants. A wider analysis by PCR showed MYMIV infection of tomato in Oman to be widespread. Inoculation of plants with full-length clones showed the host range of MYMIV not to extend to Nicotiana benthamiana or tomato. Inoculation to N. benthamiana showed TYLCV to be capable of maintaining MYMIV in both the presence and absence of the betasatellite. In tomato MYMIV was only maintained by TYLCV in the presence of the betasatellite and then only at low titre and efficiency. This is the first identification of TYLCV with ToLCB and the legume adapted bipartite begomovirus MYMIV co-infecting tomato. This finding has far reaching implications. TYLCV has spread around the World from its origins in the Mediterranean/Middle East, in some instances, in live tomato planting material. The results here may suggest that begomoviruses which do not commonly infect tomato, such as MYMIV, could be spread as a passenger of TYLCV in tomato.

Molecular and biological characterization of Chilli leaf curl virus and associated Tomato leaf curl betasatellite infecting tobacco in Oman

BackgroundIn Oman tobacco (Nicotiana tabacum; family Solanaceae) is a minor crop, which is produced only for local consumption. In 2015, tobacco plants exhibiting severe downward leaf curling, leaf thickening, vein swelling, yellowing and stunting were identified in fields of tobacco in Suhar Al-Batina region, Oman. These symptoms are suggestive of begomovirus (genus Begomovirus, family Geminiviridae) infection.MethodsCircular DNA molecules were amplified from total DNA extracted from tobacco plants by rolling circle amplification (RCA). Viral genomes were cloned from RCA products by restriction digestion and betasatellites were cloned by PCR amplification from RCA product, using universal primers. The sequences of full-length clones were obtained by Sanger sequencing and primer walking. Constructs for the infectivity of virus and betasatellite were produced and introduced into plants by Agrobacterium-mediated inoculation.ResultsThe full-length sequences of 3 begomovirus and 3 betasatellite clones, isolated from 3 plants, were obtained. Analysis of the full-length sequences determined showed the virus to be a variant of Chilli leaf curl virus (ChiLCV) and the betasatellite to be a variant of Tomato leaf curl betasatellite (ToLCB). Both the virus and the betasatellite isolated from tobacco show the greatest levels of sequence identity to isolates of ChiLCV and ToLCB identified in other hosts in Oman. Additionally clones of ChiLCV and ToLCB were shown, by Agrobacterium-mediated inoculation, to be infectious to 3 Nicotiana species, including N. tabacum. In N. benthamiana the betasatellite was shown to change the upward leaf rolling symptoms to a severe downward leaf curl, as is typical for many monopartite begomoviruses with betasatellites.ConclusionsThe leaf curl disease of tobacco in Oman was shown to be caused by ChiLCV and ToLCB. This is the first identification of ChiLCV with ToLCB infecting tobacco. The study shows that, despite the low diversity of begomoviruses and betasatellites in Oman, the extant viruses/betasatellites are able to fill the niches that present themselves.

Identification of microRNAs regulated by tobacco curly shoot virus co-infection with its betasatellite in Nicotiana benthamiana

BackgroundMicroRNAs (miRNAs) are a class of 21–24 nucleotide endogenous non-coding small RNAs that play important roles in plant development and defense responses to biotic and abiotic stresses. Tobacco curly shoot virus (TbCSV) is a monopartite begomovirus, cause leaf curling and plant stunting symptoms in many Solanaceae plants. The betasatellite of TbCSV (TbCSB) induces more severe symptoms and enhances virus accumulation when co-infect the plants with TbCSV.MethodsIn this study, miRNAs regulated by TbCSV and TbCSB co-infection in Nicotiana benthamiana were characterized using high-throughput sequencing technology.ResultsSmall RNA sequencing analysis revealed that a total of 13 known miRNAs and 42 novel miRNAs were differentially expressed in TbCSV and TbCSB co-infected N. benthamiana plants. Several potential miRNA-targeted genes were identified through data mining and were involved in both catalytic and metabolic processes, in addition to plant defense mechanisms against virus infections according to Gene Ontology (GO) analyses. In addition, the expressions of several differentially expressed miRNAs and their miRNA-targeted gene were validated through quantitative real time polymerase chain reaction (qRT-PCR) approach.ConclusionsA large number of miRNAs are identified, and their target genes, functional annotations also have been explored. Our results provide the information on N. benthamiana miRNAs and would be useful to further understand miRNA regulatory mechanisms after TbCSV and TbCSB co-infection.

Tomato Solanum lycopersicum expressing the overlapping regions of three begomovirus genes exhibit resistance to Ageratum yellow vein Malaysia virus

A post transcriptional gene silencing (PTGS) strategy to control virus replication through the expression of hairpin RNAi (hp-RNAi) could confer protection against geminiviruses and is a promising approach for developing virus-resistant tomato (Solanum lycopersicum) lines. We report the development of tomato lines showing resistance to Ageratum yellow vein Malaysia virus (AYVMV) a monopartite begomovirus and a causative agent for leaf curling, cupping, crinkling and stunting disease in the tomato cultivar MT1. The plants were transformed with a hp-RNAi construct “pHells-C1C2C3” consisting of overlapping regions of the C1, C2 and C3 genes of AYVMV. Progenies of two transgenic tomato lines (L132 and L18) exhibited resistance to AYVMV infection after inoculation with viruliferous whiteflies. The relative viral DNA accumulation levels at different times post inoculation were either not detectable or extremely low in these lines. There was also higher accumulation of siRNA in the asymptomatic transgenic lines, affirming the potential of this approach for developing begomovirus-resistant tomatoes. Our results also showed that siRNA corresponding to a short region overlapping the C1, C2 and C3 genes, induced resistance to AYVMV, indicating that it is not necessary to use the complete sequences of C1, C2 and C3 genes as targets for silencing. Furthermore, our transgenic tomato plants were found to be resistant to this virus which has a betasatellite. Therefore, targeting the begomovirus genome will be sufficient to achieve high levels of resistance even for AYVMV associated with betasatellite.

First report of Tomato leaf curl Joydebpur virus infecting French bean (Phaseolus vulgaris L.)

During 2016-2017 in Bhagalpur, Bihar, northern India, French bean plants developed curling and yellow mosaic of leaves and stunting. In eight of 12 symptomatic plants, PCR tests for Mungbean yellow mosaic India virus were positive. In the four PCR-negative symptomatic plants, rolling circle amplification (RCA) detected a ~ 2.7-kb DNA that was identified as genomic DNA of Tomato leaf curl Joydebpur virus. Also a ~ 1.4-kb specific PCR product was identified as Tomato leaf curl Joydebpur betasatellite. Whitefly-mediated transmission to chili was as efficient as that to French bean. Our findings provide evidence of a monopartite begomovirus in French bean.

Identification and Analysis of Potential Genes Regulated by an Alphasatellite (TYLCCNA) that Contribute to Host Resistance against Tomato Yellow Leaf Curl China Virus and Its Betasatellite (TYLCCNV/TYLCCNB) Infection in Nicotiana benthamiana.

Recently, begomovirus/betasatellite disease complexes were found to be associated with alphasatellites, and their presence modulated disease symptoms and/or viral DNA accumulation in infected plants. However, the biological functions of alphasatellites during begomovirus/betasatellite infections remain unclear. Tomato yellow leaf curl China virus (TYLCCNV) associated with a betasatellite (TYLCCNB) is a widespread monopartite begomovirus in China. In the Yunnan province of China, the TYLCCNV/TYLCCNB disease complex is found in association with an alphasatellite (TYLCCNA). In this study, in order to explain the mechanisms underlying TYLCCNV/TYLCCNB infection and reductions in viral DNA accumulation caused by TYLCCNA, we analyzed the transcriptome profiles of Nicotiana benthamiana seedlings challenged by TYLCCNV/TYLCCNB or TYLCCNV/TYLCCNB/TYLCCNA using RNA sequencing. In total, 2272 and 1207 differentially expressed genes (DEGs) were identified to respond to TYLCCNV/TYLCCNB and TYLCCNV/TYLCCNB/TYLCCNA infections, respectively. Compared with the DEGs in the TYLCCNV/TYLCCNB-infected N. benthamiana seedlings, the number of DEGs in plants co-infected with TYLCCNV/TYLCCNB + TYLCCNA was significantly reduced. Additionally, 36 DEGs were identified to be regulated by TYLCCNA, six of which were further analyzed using the virus-induced gene silencing (VIGS) approach. Silencing of these six TYLCCNA responsive DEGs caused more severe disease symptoms and higher viral DNA accumulation levels, suggesting that TYLCCNA responsive DEGs may attenuate TYLCCNV/TYLCCNB infection.