Monogenic Syndromes Research Articles

Ischemic stroke as presentation of DADA2: Case report and literature review

Deficiency of adenosine deaminase type 2 (DADA2) is a rare monogenic vasculitis syndrome caused by mutations in the ADA2 gene that encodes the adenosine deaminase 2 (ADA2) protein. It is an autosomal recessive disease characterised by a large phenotypic variability due to the many organs that can be affected. Ischemic and/or hemorrhagic stroke could be a manifestation of the disease. We described a case of ischemic stroke as presentation of DADA2.

Clinical Management of Hypertriglyceridemia in the Prevention of Cardiovascular Disease and Pancreatitis.

Purpose of ReviewHypertriglyceridemia (HTG) is common and is a significant contributor to atherosclerosis and pancreatitis risk. Specific HTG treatments have had variable success in reducing atherosclerosis risk. Novel therapies for severe HTG treatment and pancreatitis risk reduction are likely to be available soon. These novel therapies are expected to have broader applications for more moderate HTG and atherosclerosis risk reduction as well.Recent FindingsNHANES 2012 data has confirmed a reduction in average triglyceride (TG) levels in the US population. Dietary modification and weight reduction when needed remain the core treatment elements for all individuals with HTG, while statin therapy is a foundational pharmacologic care for atherosclerotic cardiovascular disease (ASCVD) event risk reduction. In addition, the REDUCE-IT study provides evidence for additional benefit from the use of high-dose icosapent ethyl (IPE) on top of background medical therapy in adults with moderate HTG and ASCVD or type 2 diabetes mellitus (T2D) and additional ASCVD risk factors. However, treatment with eicosapentaenoic acid (EPA) combined with docosahexanoic acid (DHA) did not reduce ASCVD in a similar population studied in the STRENGTH trial. Furthermore, novel therapeutics targeting PPAR-ɑ, as well as ApoC-III and AngPTL3, effectively lower TG levels in individuals with moderate and severe HTG, respectively. These treatments may have applicability for reducing risk from ASCVD among individuals with chylomicronemia; in addition, ApoC-III and AngPTL3 treatments may have a role in treating individuals with the rare monogenic familial chylomicronemia syndrome (FCS) at risk for acute pancreatitis (AP).SummaryResidual ASCVD risk in individuals treated with contemporary care may be due in part to non-LDL lipid abnormalities including HTG. The findings from REDUCE-IT, but not STRENGTH, confirm that consumption of high-dose EPA may reduce ASCVD risk, while combination therapy of EPA plus DHA does not reduce ASCVD in a similar population. TG lowering likely reduces ASCVD risk in individuals with HTG, but ASCVD risk is multifactorial; the added benefit of IPE to contemporary preventive therapy is the consequence of differential non-TG biologic properties between the two fatty acids. Acute pancreatitis is more difficult to study prospectively since it is less common; however, TG lowering is likely critical for the care of at-risk individuals. Additional benefit from novel therapy that has an impact on this otherwise refractory condition is anticipated.

Генетична основа ендокринної патології

Метою наведеного огляду був аналіз даних літератури щодо молекулярно-генетичної основи та діагностики ендокринної патології. Проведено огляд наукової літератури за ключовими словами «гени», «ендокринні хвороби», «молекулярна діагностика», «прогормони», «ядерні рецептори і фактори транс­крипції» з використанням пошукової системи PubMed. Беручи до уваги дослідження, проведені в останні 10 років, проаналізовані тези 144 статей. Більш детально вивчено результати дослідження, висвітлені у 32 статтях. Серед наведених нозологій — різні спадкові форми гіпопітуїтаризму, порушення біосинтезу стероїдних гормонів, порушення формування статі, моногенні форми цукрового діабету (ЦД) та інші захворювання. Виділено патологію, що пов’язана з мутацією генів, які кодують білкові прогормони, рецептори, ферменти біосинтезу стероїдів, молекули внутрішньоклітинного сигналінгу, транспортні білки, іонні канали, фактори транскрипції. Серед ендокринних захворювань, асоційованих із дефектами генів, які кодують білкові прогормони, найбільш поширеними є дефекти гена GH1; серед захворювань, асоційованих із дефектами генів, які кодують ферменти, найбільш поширеними є дефекти гена CYP21A2 (21-гідроксилази). Частіше мутації генів, які кодують білки, що відносяться до класу рецепторів, пов’язані із G-білком (G-protein coupled receptors). Більшість мутацій, пов’язаних із МЕН-2А, зосереджено в багатому цистеїном регіоні рецептора Ret. Відомо більше 70 моногенних синдромів, при яких відзначається клінічно виражена толерантність до глюкози і діагностується та чи інша форма ЦД, також виявлений ЦД, зумовлений мутацією мітохондріального гена (мутація tRNALeu, UUR). Самою частою з усіх моногенних форм є ожиріння, спричинене мутацією гена рецептора меланокортину 4-го типу (MC4R). У хворих на вроджений гіпотиреоз підвищена частота алелей HLA (Bw44, Aw24, B18) та описані мутації в генах TITF1, TITF2, FOXE1, PAX8 (транскрипційні маркери нормального онтогенезу щитоподібної залози).

Genetic determinants of autism spectrum disorders - a review

Abstract Introduction: It is estimated that various types of abnormalities from the autistic spectrum disorder occur in up to 2% of the population. These include difficulties in maintaining relationships, communication, and repetitive behaviours. Literature describes them quite well, in contrast to the causes of these disorders, which include both environmental factors and a very long list of genetic aberrations. Materials and methods: The papers available on the PubMed platform and other sources were reviewed to describe the most important genetic factors responsible for the development of autism spectrum disorders. Results: There are many genes and their mutations associated with the prevalence of autism spectrum disorders in patients. One of the main factors is the SHANK gene family, with the type and degree of abnormality in patients depending on the damage to particular genes: SHANK1-SHANK3. Research also shows the potential of targeted symptom-relieving therapies in patients with SHANK3 mutations. A correlation with the occurrence of autism has also been demonstrated for genes responsible for calcium signaling - especially the group of IP3R calcium channels. Their calcium transmission is abnormal in the majority of patients with autism spectrum disorders. A number of mutations in the 7q region were discovered - including the AUTS2, GNAI1, RELN, KMT2E, BRAF genes - the occurrence of which is associated with the presence of symptoms of autism. Autism spectrum disorders occur in about 10% of patients suffering from monogenic syndromes such as fragile X chromosome syndrome, Timothy syndrome, tuberous sclerosis, Rett syndrome or hamartomatic tumor syndrome. Conclusions: Research shows that many mutations can contribute to the development of autism spectrum disorders. Further studies are necessary to discover their therapeutic and diagnostic potential for autism.

Evaluation of Eeg Pattern and Seizure Types of Genetic Dysmorphic Syndromes: Report of 50 Patients and Review of the Literature

Many chromosomal anomalies manifest with epilepsy. Only few typical EEG and seizure type have been identified in genetic syndromes. Identification of typical seizure and EEG findings of certain genetic syndromes may serve as a guide for genetic analysis. This study aims to find typical EEG paterns of spesific genetic syndromes. The study enrolled 50 patients aged 0-16 years with a diagnosis of epilepsy and genetic syndrome in between 2014-2017 at the Dr. Behçet UZ Children’s Hospital Pediatric Neurology and Medical Genetics departments. Patients' characteristics and dysmorphic features were retrieved from Medical Genetic outpatient clinic patient files, while seizure type, epileptic syndromic classification, EEG and brain MRI findings, age at onset and frequency of seizure were determined from pediatric neurology follow-ups. Fifty patients (29 girls) with a mean age of 6.52 ±3.67 years (max=16, min=1) were enrolled. Twenty-two patients had microdeletion-duplication (44%), 12 had chromosomal anomalies (24%) and 16 had monogenic syndrome (32%). Pathology was present in the EEGs of 40 patients (80%). Focal epileptic disorder was determined in 28 subjects (56%), epileptic encephalopathy in 7 (14%), and generalized epileptic disorder in 5 (10%) Identification of seizure type and EEG pattern specific to each genetic dysmorphic syndrome may give clues to clinicians in recognizing these syndromes. However, in order to detect other specific EEG patterns, there is a need for multicentre studies with more patients.

Toward an Improved Classification of Type 2 Diabetes: Lessons From Research into the Heterogeneity of a Complex Disease.

Accumulating evidence indicates that type 2 diabetes (T2D) is phenotypically heterogeneous. Defining and classifying variant forms of T2D are priorities to better understand its pathophysiology and usher clinical practice into an era of "precision diabetes." We reviewed literature related to heterogeneity of T2D over the past 5 decades and identified a range of phenotypic variants of T2D. Their descriptions expose inadequacies in current classification systems. We attempt to link phenotypically diverse forms to pathophysiology, explore investigative methods that have characterized "atypical" forms of T2D on an etiological basis, and review conceptual frameworks for an improved taxonomy. Finally, we propose future directions to achieve the goal of an etiological classification of T2D. Differences among ethnic and racial groups were early observations of phenotypic heterogeneity. Investigations that uncover complex interactions of pathophysiologic pathways leading to T2D are supported by epidemiological and clinical differences between the sexes and between adult and youth-onset T2D. Approaches to an etiological classification are illustrated by investigations of atypical forms of T2D, such as monogenic diabetes and syndromes of ketosis-prone diabetes. Conceptual frameworks that accommodate heterogeneity in T2D include an overlap between known diabetes types, a "palette" model integrated with a "threshold hypothesis," and a spectrum model of atypical diabetes. The heterogeneity of T2D demands an improved, etiological classification scheme. Excellent phenotypic descriptions of emerging syndromes in different populations, continued clinical and molecular investigations of atypical forms of diabetes, and useful conceptual models can be utilized to achieve this important goal.

Genetic syndromes with diabetes: A systematic review.

Previous reviews and clinical guidelines have identified 10-20 genetic syndromes associated with diabetes, but no systematic review has been conducted to date. We provide the first comprehensive catalog for syndromes with diabetes mellitus. We conducted a systematic review of MEDLINE, Embase, CENTRAL, PubMed, OMIM, and Orphanet databases for case reports, case series, and observational studies published between 1946 and January 15, 2020, that described diabetes mellitus in adults and children with monogenic or chromosomal syndromes. Our literature search identified 7,122 studies, of which 160 fulfilled inclusion criteria. Our analysis of these studies found 69 distinct diabetes syndromes. Thirty (43.5%) syndromes included diabetes mellitus as a cardinal clinical feature, and 56 (81.2%) were fully genetically elucidated. Sixty-three syndromes (91.3%) were described more than once in independent case reports, of which 59 (93.7%) demonstrated clinical heterogeneity. Syndromes associated with diabetes mellitus are more numerous and diverse than previously anticipated. While knowledge of the syndromes is limited by their low prevalence, future reviews will be needed as more cases are identified. The genetic etiologies of these syndromes are well elucidated and provide potential avenues for future gene identification efforts, aid in diagnosis and management, gene therapy research, and developing personalized medicine treatments.

Monogenic Syndromes with Congenital Heart Diseases in Newborns (Diagnostic Clues for Neonatologists): A Critical Analysis with Systematic Literature Review.

Congenital heart disease (CHD), the most common major congenital anomaly, is associated with a genetic syndrome (chromosomal anomalies, genomic disorders, or monogenic disease) in 30% of patients. The aim of this systematic review was to evaluate if, in the neonatal setting, clinical clues that orient the diagnostic path can be identified. For this purpose, we revised the most frequent dysmorphic features described in newborns with CHD, comparing those associated with monogenic syndromes (MSG) with the ones reported in newborns with genomic disorders. For this systematic review according to PRISMA statement, we used PubMed, Medline, Google Scholar, Scopus database, and search terms related to CHD and syndrome. We found a wide range of dysmorphisms (ocular region, ears, mouth, and/or palate and phalangeal anomalies) detected in more than half of MSGs were found to be associated with CHDs, but those anomalies are also described in genomic rearrangements syndromes with equal prevalence. These findings confirmed that etiological diagnosis in newborns is challenging, and only the prompt and expert recognition of features suggestive of genetic conditions can improve the selection of appropriate, cost-effective diagnostic tests. However, in general practice, it is crucial to recognize clues that can suggest the presence of a genetic syndrome, and neonatologists often have the unique opportunity to be the first to identify abnormalities in the neonate.

Unravelling the tangled web of hypertension and cancer.

Cardiovascular disease remains the primary cause of mortality globally, being responsible for an estimated 17 million deaths every year. Cancer is the second leading cause of death on a global level with roughly 9 million deaths per year being attributed to neoplasms. The two share multiple common risk factors such as obesity, poor physical exercise, older age, smoking and there exists rare monogenic hypertension syndromes. Hypertension is the most important risk factor for cardiovascular disease and affects more than a billion people worldwide and may also be a risk factor for the development of certain types of cancer (e.g. renal cell carcinoma (RCC)). The interaction space of the two conditions becomes more complicated when the well-described hypertensive effect of certain antineoplastic drugs is considered along with the extensive amount of literature on the association of different classes of antihypertensive drugs with cancer risk/prevention. The cardiovascular risks associated with antineoplastic treatment calls for efficient management of relative adverse events and the development of practical strategies for efficient decision-making in the clinic. Pharmacogenetic interactions between cancer treatment and hypertension-related genes is not to be ruled out, but the evidence is not still ample to be incorporated in clinical practice. Precision Medicine has the potential to bridge the gap of knowledge regarding the full spectrum of interactions between cancer and hypertension (and cardiovascular disease) and provide novel solutions through the emerging field of cardio-oncology. In this review, we aimed to examine the bidirectional associations between cancer and hypertension including pharmacotherapy.

The Genetic Basis of Hypertension

Hypertension (HTN) is one of the major risk factors for almost all cardiovascular diseases including coronary artery disease, stroke, heart failure and renal failure. Nonetheless , blood pressure (BP) regulation is insufficient due to its multifactorial nature involving interactions among genetic, environmental, mechanistic and neuroendocrine factors. Essential hypertension is the most frequent diagnosis indicating that a monocausal etiology has not been identified. The identification of causal genetic determinants has been unfulfilling. Analyses of rare monogenic syndromes of HTN focusing on renal sodium handling and steroid hormone metabolism have proved the well-defined genetic frame of hypertension though they do not affect the normal distribution of BP in the general population. Genome-wide association studies (GWAS) have revealed genetic variants that are associated with BP with small effect size which cumulatively explain to a very small extend the variability of BP. New large-scale studies in the genomic arena will clarify the polygenic determinants of BP and open a perspective on translation of the progression in BP genetics to clinical use.

Fetal micrognathia in the first trimester: An ominous finding even after a normal array

ObjectiveTo evaluate the prognosis of fetuses with a prenatal diagnosis of micrognathia in the first trimester. Study designOver a 3-year period, patients with fetal micrognathia were detected at the time of nuchal translucency screening. The medical records of these pregnancies were reviewed, including maternal demographics, sonographic findings, genetic testing results and pregnancy outcomes. ResultsForty-three cases of first-trimester micrognathia were included in this study. Chromosomal abnormalities were detected in seven cases. Of the fetuses with a normal array, further investigation of monogenic disorders with whole-exome sequencing was undertaken in 13 cases. Monogenic syndromes were identified in eight cases, including six with de-novo dominant alleles and two with recessive conditions. Whole-exome sequencing was refused in 23 cases; among these, other additional anomalies were found on anatomic ultrasound in 10 cases. ConclusionThis study demonstrated that caution should be adopted when finding an apparently isolated micrognathia in early gestation, even with a normal array. A diagnosis of genetic syndrome or multiple anomalies on subsequent scans is most likely, and will affect the final prognosis.

Establishment of the Safe and Efficient CRISPR/Cas9-RNP Based Gene-Correction Platform of ELANE Mutations in iPSCs of Severe Congenital Neutropenia (CN) Patients with No Response to G-CSF and High Risk to Develop Leukemia

Severe congenital neutropenia (CN) is a monogenic pre-leukemia bone marrow failure syndrome characterized by an absolute neutrophil count (ANC) below 500 cells per microliter and recurrent, life-threatening bacterial infections. Treatment with recombinant human granulocyte colony-stimulating factor (rhG-CSF) increases ANC in the majority of CN patients and dramatically improves the quality of life. However, some CN patients do not respond or respond only poorly to G-CSF and should be treated by bone marrow transplantation (BMT). In some cases, “G-CSF no-responder” CN patients fail to engraft bone marrow transplant and no therapeutic options for these patients remain. Therefore, establishment of the alternative therapeutic approaches for these patients is indispensable.Many underlying genetic defects have been identified in CN. Autosomal dominant ELANE mutations have been identified in a majority of CN patient. Some ELANE mutations (e.g. p.A57V, p.C151Y, p.G214ter) are associated with no response or poor response to G-CSF therapy or high frequency of leukemia development.In the present study, we established a DNA- and virus-free clinical-grade gene correction approach of these phenotypically severe ELANE mutations in induced pluripotent stem cells (iPSCs) of CN patients using CRISPR/Cas9-based technology. We used ribonucleoprotein (RNP) form of CRISPR Cas9 as a safe tool to correct ELANE mutations. For this, we generated and characterized iPSCs from ELANE -CN patients harboring p.C151Y and p.G214ter ELANE mutations. We used embryoid body (EB)-based hematopoietic differentiation method to evaluate granulocytic differentiation of CN-patients specific iPSCs. Granulocytic differentiation was studied by absolute live cell counts, FACS analysis of myeloid-specific surface markers expression levels, CFU assay, cell morphology of cytospin preparations and nitroblue tetrazolium (NBT) assay. We found markedly diminished granulocytic differentiation of ELANE -CN iPSCs (ELANE mutations p.C151Y and p.G214ter), as compared to healthy individuals. We designed and generated repair templates and specific Crispr-RNA (crRNA) for the fourth (GGGACGCCGCCTGGGCAACG) and fifth (GGACGAAGGAGGCAATTTCG) exons of ELANE for correction of mutations p.C151Y and p.G214R, respectively and made efficient Crispr-Cas9 Ribonucleoprotein (RNP) complexes to edit the mutations along with ssODN repair templates.We further established gentle and efficient transfection of iPSCs from CN patients with ELANE -mutations specific-CRISPR/Cas9 ribonucleoprotein (RNP) complexes. We also developed simple and fast screening method for the selection of the ELANE gene corrected single iPSCs clones using restriction fragment length polymorphism (RFLP) analysis and Cas9 in vitro digestion technique. Selected clones were further analyzed for granulocytic differentiation. Up to now, we compared myeloid differentiation of iPSCs generated from healthy individuals with iPSCs from one CN- ELANE patient (p.C151Y) before- and after correction of ELANE mutation. We found that correction of ELANE mutation resulted in fully normalized granulocytic differentiation, that was in line with normalized levels of ELANE mRNA, correction of previously increased unfolded protein response (UPR)-activated gene expression, such as CHOP, ATF4, BIP, and reduction of elevated STAT5A levels in the ELANE corrected cells.Taken together, we established a safe and efficient CRISPR/Cas9-RNP based ELANE gene-correction platform of iPSCs of ELANE -CN patients that may provide novel stem cell-based therapy for CN patients with high risk of leukemia development as well as for G-CSF-non-responsive patients. This platform may be also applied for treatment of patients with other monogenic bone marrow failure syndromes. DisclosuresNo relevant conflicts of interest to declare.

Histologic Patterns and Clues to Autoinflammatory Diseases in Children: What a Cutaneous Biopsy Can Tell Us.

Autoinflammation is defined by aberrant, antigen-independent activation of the innate immune signaling pathways. This leads to increased, pro-inflammatory cytokine expression and subsequent inflammation. In contrast, autoimmune and allergic diseases are antigen-directed immune responses from activation of the adaptive immune system. The innate and adaptive immune signaling pathways are closely interconnected. The group of ‘complex multigenic diseases’ are a result of mutual dysregulation of both the autoinflammatory and autoimmune physiologic components. In contrast, monogenic autoinflammatory syndromes (MAIS) result from single mutations and are exclusively autoinflammatory in their pathogenesis. Studying the clinical and histopathological findings for the various MAIS explains the phenotypical correlates of their specific mutations. This review aims to group the histopathologic clues for autoinflammation into three recognizable patterns. The presence of these histologic patterns in a pediatric patient with recurrent fevers and systemic inflammation should raise suspicion of an autoinflammatory component in MAIS, or, more frequently, in a complex multigenic disease. The three major histopathological patterns seen in autoinflammation are as follows: (i) the ‘neutrophilic’ pattern, seen in urticarial neutrophilic dermatosis, pustular psoriasis, aseptic neutrophilic folliculitis, and Sweet’s syndrome; (ii) the ‘vasculitic’ pattern seen in small vessel-vasculitis (including hypersensitivity/leukocytoclastic vasculitis, thrombosing microangiopathy and lymphocytic vasculitis), and intermediate-sized vessel vasculitis, mimicking polyarteritis nodosa; and (iii) the ‘granulomatous’ pattern. Beyond these three patterns, there are additional histopathologic clues, which are detailed below. It is important for a dermatopathologist to recognize the patterns of autoinflammation, so that a diagnosis of MAIS or complex multigenic diseases may be obtained. Finally, careful histopathologic analyses could contribute to a better understanding of the various clinical manifestations of autoinflammation.

Epigenetics and familial mediterranean fever

Abstract: Throughout the last 20 years, the concept of auto-inflammation is developed, culminating with the finding of how gene mutations of Mediterranean Fever (MEFV) seemed to be causally linked to Familial Mediterranean fever (FMF). The autoinflammatory illnesses presently constitute a wide variety of disorders that have mutual signs of frequent fever, the incidence of hyper-reactive immune cells of hereditary origin, and indicators of inflammation that may occur systemically or specific to an organ with no autoimmunity specific infection.The key causes of the unregulated inflammation are the myeloid innate immune cells which mainly induced production of excessive inflammatory cytokines as IL-1β and IL-18. Deficiencies through various signalling mechanisms regulating innate immune response, especially a single and even multiple inflammasomes hyperreactivity, remain the essence of pathological autoinflammatory phenotype.While FMF would be a monogenic autoinflammatory syndrome, it is genetically complicated and affected by environmental influences. Lately, epigenetic dysregulation has appeared to be a further cause of pathogenesis. Throughout this survey, we are addressing the epigenetic involvement pathways within (FMF).

Low Referral Rates for Genetic Assessment of Patients With Multiple Adenomas in United Kingdom Bowel Cancer Screening Programs

Approximately 1 in 20 cases of colorectal cancer are caused by monogenic syndromes. Published guidelines recommend that patients with 10 or more adenomas be referred for genetic testing, based on evidence that colorectal cancer risk is associated with adenoma multiplicity. The aim of this study was to determine adherence to guidelines on referral for genetic screening in patients with 10 or more adenomas. A cross-sectional study was performed of prospectively collected data from the UK Bowel Cancer Screening Programme between May 2007 and June 2018. Only histologically confirmed adenomas were included. Clinicopathological data were recorded from patient records, and referrals to clinical genetics services were ascertained. Data were obtained from 3 centers in London, United Kingdom. A total of 17,450 subjects underwent colonoscopy following an abnormal fecal occult blood test. We quantified patients with 10 or more adenomas and the proportion referred for genetic screening. The adenoma detection rate was 50.6% among 17,450 patients who underwent colonoscopy (8831 had 1 or more adenomas). Three hundred forty-seven patients (2.0%) had 10 or more adenomas. Patients with 10 or more adenomas were more likely to be male than those with fewer than 10 adenomas (76.9% vs 53.4%; p < 0.0001). A family history was collected in 37.8% of the multiple adenoma population. Of 347 patients with 10 or more adenomas, 28 (8.1%) were referred for genetic assessment. All 3 screening centers were in a single city. No genetic outcome data were available to permit analysis of actual rates of inherited cancer syndromes in this population. In this study, almost 1 in 50 patients had 10 or more adenomas. Despite guidelines advising genetic testing in this group, referral rates are low. A referral pathway and management strategies should be established to address this patient population. See Video Abstract at http://links.lww.com/DCR/B630. ANTECEDENTES:Aproximadamente uno de cada veinte casos de cáncer colorrectal son causados por síndromes monogénicos. Las pautas publicadas recomiendan que los pacientes con diez o más adenomas sean derivados para pruebas genéticas, basándose en la evidencia de que el riesgo de cáncer colorrectal está asociado con la multiplicidad de adenomas.OBJETIVO:El objetivo de este estudio fue determinar la adherencia a las guías de derivación para cribado genético en pacientes con diez o más adenomas.DISEÑO:Se realizó un estudio transversal de datos recolectados prospectivamente del Programa de Detección de Cáncer de Intestino del Reino Unido entre mayo de 2007 y junio de 2018. Solo se incluyeron los adenomas confirmados histológicamente. Los datos clínico-patológicos se registraron a partir de los registros de los pacientes y se determinaron las derivaciones a los servicios de genética clínica.AJUSTE ENTORNO CLINICO:Los datos se obtuvieron de tres centros en Londres, Reino Unido.PACIENTES:Un total de 17.450 17450 sujetos pacientes se sometieron a una colonoscopia después de una prueba de sangre oculta en heces anormal positiva.PRINCIPALES MEDIDAS DE RESULTADO VOLARACION:cuantificamos los pacientes con diez o más adenomas y la proporción remitida para cribado genético.RESULTADOS:La tasa de detección de adenomas fue del 50,6% entre 17.450 17450 pacientes que se sometieron a colonoscopia (8.831 8831 tenían uno o más adenomas). 347 pacientes (2,0%) tenían 10 o más adenomas. Los pacientes con 10 o más adenomas tenían más probabilidades de ser hombres que aquellos con menos de 10 adenomas (76,9% frente versus a 53,4%; p <0,0001). Se recogieron antecedentes familiares en el 37,8% de la población de adenomas múltiples. De 347 pacientes con 10 o más adenomas, 28 (8,1%) fueron remitidos para evaluación genética.LIMITACIONES:Los tres centros de detección se encontraban en una sola ciudad. No se disponía de datos de resultados genéticos que permitieran el análisis de las tasas reales de síndromes de cáncer hereditario en esta población.CONCLUSIONES:En este estudio, casi uno de cada cincuenta pacientes tenía diez o más adenomas. A pesar de las pautas que recomiendan las pruebas genéticas en este grupo, las tasas de derivación son bajas. Se debe establecer una vía de derivación y estrategias de manejo para abordar esta población de pacientes. Consulte Video Resumen en http://links.lww.com/DCR/B630.

Clinical delineation of SETBP1 haploinsufficiency disorder.

SETBP1 haploinsufficiency disorder (MIM#616078) is caused by haploinsufficiency of SETBP1 on chromosome 18q12.3, but there has not yet been any systematic evaluation of the major features of this monogenic syndrome, assessing penetrance and expressivity. We describe the first comprehensive study to delineate the associated clinical phenotype, with findings from 34 individuals, including 24 novel cases, all of whom have a SETBP1 loss-of-function variant or single (coding) gene deletion, confirmed by molecular diagnostics. The most commonly reported clinical features included mild motor developmental delay, speech impairment, intellectual disability, hypotonia, vision impairment, attention/concentration deficits, and hyperactivity. Although there is a mild overlap in certain facial features, the disorder does not lead to a distinctive recognizable facial gestalt. As well as providing insight into the clinical spectrum of SETBP1 haploinsufficiency disorder, this reports puts forward care recommendations for patient management.

Fetal akinesia: The application of clinical exome sequencing in cases with decreased fetal movement

ObjectiveTo determine monogenic syndromes in cases of fetal akinesia in order to understand the genetic aetiology. Study designClinical trio exome sequencing (ES) was performed on DNA extracted from postnatal samples in 12 cases with fetal akinesia identified by prenatal ultrasound and a normal chromosomal micro-array analysis result. This test targets coding exons for 4200 clinically relevant disease-causing genes. The interpretation of variants was performed according to the guidelines of the American College of Medical Genetics. ResultsA definite molecular diagnosis was achieved in six (50 %) of the 12 cases using clinical trio ES. In five cases, the pathogenic variants were located in known fetal-akinesia-associated genes. In one case, the underlying pathogenic variants were in known disease genes that had not been linked to fetal akinesia previously. Six pregnancies were terminated by the parents, and six pregnancies were continued to term. ConclusionGenetic defects leading to fetal akinesia were found in half of the study cases using clinical trio ES. This information will be useful in genetic counselling with regard to prognosis and risk of recurrence.

Common genetic variants with fetal effects on birth weight are enriched for proximity to genes implicated in rare developmental disorders.

Birth weight is an important factor in newborn survival; both low and high birth weights are associated with adverse later-life health outcomes. Genome-wide association studies (GWAS) have identified 190 loci associated with maternal or fetal effects on birth weight. Knowledge of the underlying causal genes is crucial to understand how these loci influence birth weight and the links between infant and adult morbidity. Numerous monogenic developmental syndromes are associated with birth weights at the extreme ends of the distribution. Genes implicated in those syndromes may provide valuable information to prioritize candidate genes at the GWAS loci. We examined the proximity of genes implicated in developmental disorders (DDs) to birth weight GWAS loci using simulations to test whether they fall disproportionately close to the GWAS loci. We found birth weight GWAS single nucleotide polymorphisms (SNPs) fall closer to such genes than expected both when the DD gene is the nearest gene to the birth weight SNP and also when examining all genes within 258 kb of the SNP. This enrichment was driven by genes causing monogenic DDs with dominant modes of inheritance. We found examples of SNPs in the intron of one gene marking plausible effects via different nearby genes, highlighting the closest gene to the SNP not necessarily being the functionally relevant gene. This is the first application of this approach to birth weight, which has helped identify GWAS loci likely to have direct fetal effects on birth weight, which could not previously be classified as fetal or maternal owing to insufficient statistical power.

A hemizygous mutation in the FOXP3 gene (IPEX syndrome) resulting in recurrent X-linked fetal hydrops: a case report

BackgroundFetal hydrops is excessive extravasation of fluid into the third space in a fetus, which could be due to a wide differential of underlying pathology. IPEX (immune dysregulation, polyendocrinopathy, enteropathy, X-linked) syndrome primarily affects males. It is a monogenic primary immunodeficiency syndrome of X-linked recessive inheritance due to FOXP3 gene variants. It is characterised by the development of multiple autoimmune disorders in affected individuals.Case presentationWe present a rare cause of male fetal hydrops in the context of IPEX syndrome and discuss FOXP3 gene variants as a differential for ‘unexplained’ fetal hydrops that may present after the first trimester.Discussion and conclusionsIn all similar cases, the pathological process begins during intrauterine life. Furthermore, there are no survivors described. Consequently, this variant should be considered as a severe one, associated with intrauterine life onset and fatal course, i.e., the most severe IPEX phenotype.

Redirecting drug repositioning to discover innovative cosmeceuticals.

Skin appearance is essential for self-esteem and quality of life; consequently, skin care products represent a huge market. In particular, cosmeceuticals constitute a hybrid category of skin care formulations, at the interphase of cosmetics and pharmaceuticals, rationally designed to target (patho) physiological mechanisms aiming to enhance skin health and appearance. Cosmeceuticals are marketed as anti-ageing, anti-wrinkle, hair regrowth, skin whitening and wound healing agents with special emphasis on scar-free healing. An overview on recent cutting-edge advances concerning the discovery and development of enhanced performance cosmeceuticals by drug repositioning approaches is presented here. In this context, we propose "target repositioning," a new term, to highlight that druggable protein targets implicated in multiple diseases (hubs in the diseasome) can be exploited to accelerate the discovery of molecularly targeted cosmeceuticals that can promote skin health as an added benefit, which is a novel concept not described before. In this direction, emphasis is placed on the role of mouse models, for often untreatable skin diseases, as well as recent breakthroughs on monogenic rare skin syndromes, in promoting compound repositioning to innovative cosmeceuticals.