Monochromosomal Somatic Cell Hybrid Research Articles

Human NORs, comprising rDNA arrays and functionally conserved distal elements, are located within dynamic chromosomal regions.

Human nucleolar organizer regions (NORs), containing ribosomal gene (rDNA) arrays, are located on the p-arms of acrocentric chromosomes (HSA13-15, 21, and 22). Absence of these p-arms from genome references has hampered research on nucleolar formation. Previously, we assembled a distal junction (DJ) DNA sequence contig that abuts rDNA arrays on their telomeric side, revealing that it is shared among the acrocentrics and impacts nucleolar organization. To facilitate inclusion into genome references, we describe sequencing the DJ from all acrocentrics, including three versions of HSA21, ∼3 Mb of novel sequence. This was achieved by exploiting monochromosomal somatic cell hybrids containing single human acrocentric chromosomes with NORs that retain functional potential. Analyses revealed remarkable DJ sequence and functional conservation among human acrocentrics. Exploring chimpanzee acrocentrics, we show that "DJ-like" sequences and abutting rDNA arrays are inverted as a unit in comparison to humans. Thus, rDNA arrays and linked DJs represent a conserved functional locus. We provide direct evidence for exchanges between heterologous human acrocentric p-arms, and uncover extensive structural variation between chromosomes and among individuals. These findings lead us to revaluate the molecular definition of NORs, identify novel genomic structural variation, and provide a rationale for the distinctive chromosomal organization of NORs.

An interstitial deletion-insertion involving chromosomes 2p25.3 and Xq27.1, near SOX3, causes X-linked recessive hypoparathyroidism

X-linked recessive hypoparathyroidism, due to parathyroid agenesis, has been mapped to a 906-kb region on Xq27 that contains 3 genes (ATP11C, U7snRNA, and SOX3), and analyses have not revealed mutations. We therefore characterized this region by combined analysis of single nucleotide polymorphisms and sequence-tagged sites. This identified a 23- to 25-kb deletion, which did not contain genes. However, DNA fiber-FISH and pulsed-field gel electrophoresis revealed an approximately 340-kb insertion that replaced the deleted fragment. Use of flow-sorted X chromosome-specific libraries and DNA sequence analyses revealed that the telomeric and centromeric breakpoints on X were, respectively, approximately 67 kb downstream of SOX3 and within a repetitive sequence. Use of a monochromosomal somatic cell hybrid panel and metaphase-FISH mapping demonstrated that the insertion originated from 2p25 and contained a segment of the SNTG2 gene that lacked an open reading frame. However, the deletion-insertion [del(X)(q27.1) inv ins (X;2)(q27.1;p25.3)], which represents a novel abnormality causing hypoparathyroidism, could result in a position effect on SOX3 expression. Indeed, SOX3 expression was demonstrated, by in situ hybridization, in the developing parathyroid tissue of mouse embryos between 10.5 and 15.5 days post coitum. Thus, our results indicate a likely new role for SOX3 in the embryonic development of the parathyroid glands.

An activity associated with human chromosome 21 permits nuclear colocalization of the adenovirus E1B-55K and E4orf6 proteins and promotes viral late gene expression.

The adenovirus E1B-55K and E4orf6 proteins cooperate during virus infection while performing several tasks that contribute to a productive infection, including the selective nucleocytoplasmic transport of late viral mRNA. Previous studies have shown that the E4orf6 protein retains the E1B-55K protein in the nucleus of human and monkey cells, but not in those of rodents, suggesting that primate-specific cellular factors contribute to the E4orf6-mediated retention of the E1B-55K protein in the nucleus. In an effort to identify these proposed primate-specific cellular factors, the interaction of the E1B-55K and E4orf6 proteins was studied in a panel of stable human-rodent monochromosomal somatic cell hybrids. Analysis of this panel of cell lines has demonstrated the existence of an activity associated with human chromosome 21 that permits the E1B-55K and E4orf6 proteins to colocalize in the nucleus of a rodent cell. Additional hybrid cells bearing portions of human chromosome 21 were used to map this activity to a 10-megabase-pair segment of the chromosome, extending from 21q22.12 to a region near the q terminus. Strikingly, this region also facilitates the expression of adenovirus late genes in a rodent cell background while having little impact on the expression of early viral genes.

Identification and characterization of human taste receptor genes belonging to the TAS2R family

The sense of taste is a chemosensory system responsible for basic food appraisal. Humans distinguish between five primary tastes: bitter, sweet, sour, salty and umami. The molecular events in the perception of bitter taste are believed to start with the binding of specific water-soluble molecules to G-protein-coupled receptors encoded by the TAS2R/T2R family of taste receptor genes. TAS2R receptors are expressed at the surface of taste receptor cells and are coupled to G proteins and second messenger pathways. We have identified, cloned and characterized 11 new bitter taste receptor genes and four new pseudogenes that belong to the human TAS2R family. Their encoded proteins have between 298 and 333 amino acids and share between 23 and 86% identity with other human TAS2R proteins. Screening of a mono-chromosomal somatic cell hybrid panel to assign the identified bitter taste receptor genes to human chromosomes demonstrated that they are located in chromosomes 7 and 12. Including the 15 sequences identified, the human TAS2R family is composed of 28 full-length genes and 16 pseudogenes. Phylogenetic analyses suggest a classification of the TAS2R genes in five groups that may reflect a specialization in the detection of specific types of bitter chemicals.

Sequence and phylogeny of HERV-W pol fragments.

A new human endogenous retroviral family (HERV-W) has been described that is related to multiple sclerosis-associated retrovirus (MSRV) sequences that have been identified in particles recovered from monocyte cultures from patients with multiple sclerosis. Using the PCR approach with a human monochromosomal somatic cell hybrid DNA panel, 24 pol fragments of the HERV-W family from chromsomes 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 20, 21, X, and Y were identified and analyzed. They showed a high degree of nucleotide sequence similarity (89.3-91.3%) with that of the HERV-W. Translation of the pol fragments showed no frameshift and termination codon by deletion/insertion or point mutation in some clones: HWP4-1, HWP4-2 from chromosome 4, and HWPX-1 from chromosome X. Phylogenetic analysis of the HERV-W family indicates that the pol fragments have evolved independently among chromosomes or represent separate integration events during primate evolution.

Human endogenous retrovirus HERV-W family: chromosomal localization, identification, and phylogeny.

A new human endogenous retroviral family (HERV-W) has been described that is related to multiple sclerosis-associated retrovirus sequences that have been identified in particles recovered from monocyte cultures from patients with multiple sclerosis. Using the polymerase chain reaction approach with a human monochromosomal somatic cell hybrid DNA panel, 15 env fragments of the HERV-W family from chromosomes 1, 3, 4, 5, 6, 7, 12, 14, 17, 20, and X were identified and analyzed. These env fragments showed a high degree of nucleotide sequence similarity (91.6-99.6%) to that of HERV-W. Translation of the env fragments showed no frameshift and termination codons by deletion/insertion or point mutation in some clones (W-1-1, W-3-8, W-4-1, W-7-1, W-14-1, W-17-5, W-20-9, and W-X-3). Phylogenetic analysis of the HERV-W family indicates that the HERV-W env fragments divided into five groups through evolutionary divergence in the primate genome. In group IV, a clone (W-12-2) on chromosome 12 shared 100% sequence identity with a clone (W-17-5) on chromosome 17, suggesting either a retrotransposition or a chromosomal translocation in the last 2 to 5 million years.

Characterization of Nonfunctional V1R-like Pheromone Receptor Sequences in Human

The vomeronasal organ (VNO) or Jacobson's organ is responsible in terrestrial vertebrates for the sensory perception of pheromones, chemicals that elicit stereotyped behaviors among individuals of the same species. Pheromone-induced behaviors and a functional VNO have been described in a number of mammals, but the existence of this sensory system in human is still debated. Recently, two nonhomologous gene families, V1R and V2R, encoding pheromone receptors have been identified in rat. These receptors belong to the seven-transmembrane domain G-protein-coupled receptor superfamily. We sought to characterize V1R-like genes in the human genome. We have identified seven different human sequences by PCR and library screening with rodent sequences. These human sequences exhibit characteristic features of V1R receptors and show 52%–59% of amino acid sequence identity with the rat sequences. Using PCR on a monochromosomal somatic cell hybrid panel and/or FISH, we demonstrate that these V1R-like sequences are distributed on chromosomes 7, 16, 20, 13, 14, 15, 21, and 22 and possibly on additional chromosomes. One sequence hybridizes to pericentromeric locations on all the acrocentric chromosomes (13, 14, 15, 21, and 22). All of the seven V1R-like sequences analyzed show interrupted reading frames, indicating that they represent nonfunctional pseudogenes. The preponderence of pseudogenes among human V1R sequences and the striking anatomical differences between rodent and human VNO raise the possibility that humans may have lost the V1R/VNO-mediated sensory functions of rodents.[Sequence data from this article have been deposited with the DDBJ/EMBL/GenBank Data Libraries under accession nos. U73852–73853 andAF253312–253316.]

Characterization of nonfunctional V1R-like pheromone receptor sequences in human.

The vomeronasal organ (VNO) or Jacobson's organ is responsible in terrestrial vertebrates for the sensory perception of pheromones, chemicals that elicit stereotyped behaviors among individuals of the same species. Pheromone-induced behaviors and a functional VNO have been described in a number of mammals, but the existence of this sensory system in human is still debated. Recently, two nonhomologous gene families, V1R and V2R, encoding pheromone receptors have been identified in rat. These receptors belong to the seven-transmembrane domain G-protein-coupled receptor superfamily. We sought to characterize V1R-like genes in the human genome. We have identified seven different human sequences by PCR and library screening with rodent sequences. These human sequences exhibit characteristic features of V1R receptors and show 52%-59% of amino acid sequence identity with the rat sequences. Using PCR on a monochromosomal somatic cell hybrid panel and/or FISH, we demonstrate that these V1R-like sequences are distributed on chromosomes 7, 16, 20, 13, 14, 15, 21, and 22 and possibly on additional chromosomes. One sequence hybridizes to pericentromeric locations on all the acrocentric chromosomes (13, 14, 15, 21, and 22). All of the seven V1R-like sequences analyzed show interrupted reading frames, indicating that they represent nonfunctional pseudogenes. The preponderence of pseudogenes among human V1R sequences and the striking anatomical differences between rodent and human VNO raise the possibility that humans may have lost the V1R/VNO-mediated sensory functions of rodents.

Identification and phylogeny of novel human endogenous retroviral sequences belonging to the HERV-W family on the human X chromosome.

A new family (HERV-W) ofhuman endogenous retroviruses (HERVs) has recently been described that is related to MSRV (multiple sclerosis related retrovirus) sequences that have been identified in particles recovered from monocyte cultures from patients with multiple sclerosis. We investigated the pol fragment of HERV-W on the human X chromosome by the polymerase chain reaction (PCR) using a monochromosomal somatic cell hybrid DNA panel and compared these with related sequences in the genome database. We identified three novel sequences on the human X chromosome, HWXI, HWX3, and HWX5, which have a high degree of homology (88-98%) with the MSRV pol fragment and with seven other sequences. HWX5, like MSRV, has an uninterrupted open reading frame. Phylogenetic analysis showed HWX5 to be related to the HWX1, HWX3, and BAC clone B353C18 sequences with 91-93% homology. The ratio of synonymous to nonsynonymous substitutions indicated that negative selective pressure is acting on HWX5. Further studies on the structure and expression of this sequence are indicated.

Cloning of the human kidney PAH transporter: narrow substrate specificity and regulation by protein kinase C.

Conserved from fish to mammals, renal proximal tubule organic anion secretion plays an important role in drug and xenobiotic elimination. Studies with the model substrate p-aminohippurate (PAH) have suggested that a basolateral PAH/alpha-ketoglutarate exchanger imports diverse organic substrates into the proximal tubule prior to apical secretion. cDNAs encoding PAH transporters have been cloned recently from rat and flounder. Here we report the cloning of a highly similar human PAH transporter (hPAHT) from human kidney. By Northern blot analysis and EST database searching, hPAHT mRNA was detected in kidney and brain. PCR-based monochromosomal somatic cell hybrid mapping placed the hPAHT gene on chromosome 11. When expressed transiently in vitro, hPAHT catalyzed time-dependent and saturable [3H]PAH uptake (Km of approximately 5 microM). Preincubation with unlabeled alpha-ketoglutaric or with glutaric acid stimulated tracer PAH uptake, and preincubation with unlabeled PAH stimulated tracer alpha-ketoglutarate uptake, results that are consistent with PAH/alpha-ketoglutarate exchange. Several structurally diverse organic anions cis-inhibited PAH uptake. Like rat OAT1 organic anion transporter, hPAHT was inhibited by furosemide, indomethacin, probenecid, and alpha-ketoglutarate. Unlike OAT1, hPAHT was not inhibited by prostaglandins or methotrexate (MTX). Moreover, tracer PGE2 and MTX were not transported, indicating that the substrate specificity for transport by hPAHT is not broad. PAH uptake was inhibited by phorbol 12-myristate 13-acetate (PMA) in a dose- and time-dependent fashion, but not by the inactive 4alpha-phorbol-12,13 didecanoate. PMA-induced inhibition was blocked by staurosporine. Thus the protein kinase C-mediated inhibition of basolateral organic anion entry previously reported in intact tubules is likely due, at least in part, to direct modulation of the PAH/alpha-ketoglutarate exchanger.

Human golgin-95 gene (GOLGA2). Map position 9q32-34.1.

Golgin-95 is a 95-kD protein which was ®rst identi®ed in the sera of patients with autoimmune diseases such as systematic lupus erythematous (SLE) [1]. Its exact function is unknown, but it has been inplicated in the processing and transport of proteins through the Golgi complex. In this report, monochromosomal somatic cell and radiation hybrid mapping panels were used to assign the human Golgin-95 gene to chromosome 9q32-34.1. A 226-bp fragment of the GOLGA2 gene (EMBL accession number L06147) was ampli®ed using speci®c primers: GOLF (TACCGGGCTGACGAGAATGA) and GOLR (AGTGGCCAGCTTTTAGATGA), designed to the 39 UTR and identity con®rmed by sequencing. These primers were used to screen both a monochromosomal somatic cell hybrid DNA panel [2] and the Genebridge 4 radiation hybrid panel [3] (HGMP-RC, Cambridge, UK) by PCR. The monochromosomal hybrid DNA panel localized the GOLGA2 gene to human chromosome 9. The results of the Genebridge 4 radiation hybrid panel screening were analyised via the Radiation Hybrid Mapping Environment (RHyME) at the HGMP khttp://menu.hgmp.mrc.ac.uk/menu-bin/RHyME/RHyME.pll. This further de®ned the regional localization of the GOLGA2 gene on chromosome 9 close to the framework marker D9S290 (lod score .3.0) located in the chromosome band 9q32-34.1 according the GDB internet site.

Human FUSE binding protein 3 gene (FBP3). Map position 9q33-34.1.

Human FUSE binding protein 3 belongs to a family of homologous gene regulatory proteins (FBP, FBP2 and FBP3) which bind sequence-speci®cally to only one strand of the far upstream element (FUSE) and act as transcription factors [1]. In this report, monochromosomal somatic cell and radiation hybrid mapping panels were used to assign the human FUSE binding protein 3 gene (FBP3) to chromosome 9q33-34.1. A 404-bp fragment of the FBP3 gene (EMBL accession number U69127) was ampli®ed using speci®c primers: FUSA3 (GTATAAGCTCTGGGATTCTTTTTG) and FUSA6 (ATACAAACCCTACAAAATGCCCC), designed to the 39 UTR and identity con®rmed by sequencing. These primers were used to screen both a monochromosomal somatic cell hybrid DNA panel [2] and the Genebridge 4 radiation hybrid panel [3] (HGMP-RC, Cambridge, UK) by PCR. The monochromosomal hybrid DNA panel localized the FBP3 gene to human chromosome 9. The results of the Genebridge 4 radiation hybrid panel screening were analysed via the Radiation Hybrid Mapping Environment (RHyME) at the HGMP (http://menu.hgmp.mrc.ac.uk/menu-bin/RHyME/RHyME.pl). This further de®ned the regional localization of the FBP3 gene on chromosome 9 close to the framework marker D9S159 (lod score . 3.0) located in the chromosome band 9q33-34.1 according the GDB internet site.

Identification and phylogenetic analysis of novel human endogenous retroviral sequences belonging to the HERV-H family on human X and Y chromosomes.

HERV-H, a family of endogenous retroviral elements that has undergone successive expansions in the human genome, includes sequences that are expressed in placenta and T cells. With a PCR approach to the HERV-H using human monochromosomal somatic cell hybrid DNA, we identified 8 new HERV-H sequences on the X chromosome, and one novel HERV-H element, HY-1, the first reported such element on the Y chromosome, and compared these with sequences in the nucleotide sequence database. Phylogenetic analysis indicated that clone HX-1 and BAC clone 523A23 on the X chromosome were found to be in close relationship to the sequences of DJ088A21 on the human chromosome 7q31. This finding allows us to speculate that HERV-H elements may have evolved by intra-chromosomal spread. Our data may relevant to an understanding of human genomic plasticity.

Presence and phylogenetic analysis of HERV-K LTR on human X and Y chromosomes: evidence for recent proliferation.

The K group of human endogenous retroviruses (HERV-K) has been suggested to have a role in disease and has recently been shown to include long terminal repeat (LTR) elements that are human specific. Here we investigated the presence of HERV-K LTRs on the human X and Y chromosomes with the use of PCR on a monochromosomal somatic cell hybrid DNA panel. We report twelve such sequences on the X chromosome and ten sequences on the Y chromosome. Phylogenetic analysis reveals that clones X2, 4, 5, 6, 7, 11, 15 from the X chromosome and clones Y4, 5, 7, 10 from the Y chromosome are closely related to the human-specific members of Medstrand and Mager's cluster 9. The sequence of clone Y7 from the Y chromosome is identical with human-specific HERV-K LTR element (AC002350) from chromosome 12q24. The findings suggest recent proliferation and transposition of HERV-K LTR elements on these chromosomes. Such events may have contributed to structural change and genetic variation in the human genome. We draw attention to evolutionarily recent changes in homologies between X and Y chromosomes as a method of further investigating such transpositions.

Assignment of the human ARNO3 gene (PSCD3) to chromosome 7p21 by radiation hybrid mapping.

The chromosomal localization of the human ARNO3 gene (PSCD3) was determined using monochromosomal somatic cell hybrid and radiation hybrid mapping panel. PCR analysis of a hybrid DNA panel localized the ARNO3 gene to human chromosome 7. The analysis of the Genebridge4 radiation hybrid panel using PCR amplification located the ARNO3 gene between NIB1822 (9.5 cR) and D7S481 (5.5 cR) with a lod score of > 3.0. This region is located in the human chromosome band 7p21.

Many Tumors and Many Genes: Genetics of Uterine Leiomyomata

Many Tumors and Many Genes: Genetics of Uterine Leiomyomata

Genomic organization of the human C3a receptor.

The human C3a receptor (C3aR) mediates the activation of cells by the potent proinflammatory chemoattractant C3a, an anaphylatoxin, generated in the early phase of an inflammatory reaction by proteolytic cleavage of the complement component C3. To understand the molecular mechanisms that regulate C3aR gene expression, we initiated studies to determine its genomic and mRNA organization. We now report the following novel findings: (1) The C3aR is a single-copy gene as shown by Southern hybridization of human genomic DNA. (2) Using PCR amplification of DNA from monochromosomal somatic cell hybrid and radiation hybrid panels, the C3aR locus was mapped to chromosome 12p13. (3) Genomic DNA clones encompassing the C3aR locus were isolated from a human genomic DNA library and characterized by restriction mapping, Southern blotting, PCR analysis and DNA sequencing. Comparison of the genomic with the known cDNA sequences revealed a single 6-kb intron sequence located 1 1 bp upstream of the ATG initiation codon. The open reading frame and the complete 3' untranslated region are encoded on a single exon.

Cloning, Expression Pattern, and Chromosomal Assignment to 16q23 of the Human γ-Adaptin Gene (ADTG)

Adaptins are important components of clathrin-coated vesicles transporting ligand–receptor complexes from the plasma membrane or from thetrans-Golgi network to lysosomes. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. We present the cloning and sequencing of the human γ-adaptin cDNA (HGMW-approved symbolADTG) consisting of 3723 bp with an open reading frame capable of encoding a protein of 825 amino acids, 98.9% identical to the mouse protein. Northern blot analysis of the mouse and human γ-adaptin genes revealed a ubiquitous and abundant expression, except in human adult lung. Using a monochromosomal somatic cell hybrid panel and fluorescencein situhybridization, we mapped this gene to human chromosome 16q23, which is syntenic with mouse chromosome 8, band D. In addition, we localized genes for two other components of the AP-1 adaptor, i.e., the medium (AP47) and small (AP19) subunits, to chromosomes 19 and 7, respectively. Expression analysis of these genes in human tissues revealed ubiquitously expressed transcripts of approximately 2.5 and 1.5 kb, respectively.

Molecular Cloning of the Gene for the Human Prostaglandin Transporter hPGT: Gene Organization, Promoter Activity, and Chromosomal Localization

Prostaglandins (PGs) play diverse and important roles in human health and disease. We recently identified the first known PG transporter cDNA in the rat (PGT) and human (hPGT). To aid in the analysis of any possible human disease caused by mutations in PGT, we have cloned and characterized the hPGT gene. The gene exists as a single copy in the human genome and is comprised of 14 exons distributed over ∼95 kb. Two introns disrupt putative trans-membrane spans of the coding region; each of these sites is near a highly conserved charged residue. The ∼250 bp immediately 5′ to the start of exon 1 contain a TATAAA sequence (TATA box), a transcription initiation (Inr) consensus (CTCANTCT), two Sp 1 sequences (GGGCGG), and a cAMP response element (CGGCGTCA). Ligation of ∼3.5 kb of 5′ flanking sequence to a luciferase reporter yielded >15-fold activity above background when expressed in A549 human lung epithelial cells. PCR-based monochromosomal somatic cell hybrid mapping and fluorescence in situ hybridization localized hPGT to chromosome 3q21. Three microsatellites were identified, one of which was demonstrated to be polymorphic in unrelated individuals and may be useful in evaluating PGT as a candidate gene in human disease.

Mapping and characterization of the eukaryotic early pregnancy factor/chaperonin 10 gene family.

Early pregnancy factor and mitochondrial chaperonin 10 have very different functions within mammals but the mature peptides have identical amino acid sequences. In order to understand the mechanisms by which identical proteins can have different functions and sites of activity, we have examined genomic DNA which could encode the protein. In most species studied, there is a large gene family of at least ten members with homology to the DNA sequence for this protein. Using a monochromosomal somatic cell hybrid panel, we have mapped the gene for human chaperonin 10 to chromosome 2. Other members of the human gene family map to several chromosomes. Chromosomes 1, 2 and 9 contain pseudogenes with Alu insertions while chromosome 16 has a pseudogene containing a short direct repeat flanking an insert. Chromosomes 1 and 16 may also carry a functional intronless copy of the EPF/Cpn10 sequence.