Human FUSE binding protein 3 gene (FBP3). Map position 9q33-34.1.

Abstract

Human FUSE binding protein 3 belongs to a family of homologous gene regulatory proteins (FBP, FBP2 and FBP3) which bind sequence-speci®cally to only one strand of the far upstream element (FUSE) and act as transcription factors [1]. In this report, monochromosomal somatic cell and radiation hybrid mapping panels were used to assign the human FUSE binding protein 3 gene (FBP3) to chromosome 9q33-34.1. A 404-bp fragment of the FBP3 gene (EMBL accession number U69127) was ampli®ed using speci®c primers: FUSA3 (GTATAAGCTCTGGGATTCTTTTTG) and FUSA6 (ATACAAACCCTACAAAATGCCCC), designed to the 39 UTR and identity con®rmed by sequencing. These primers were used to screen both a monochromosomal somatic cell hybrid DNA panel [2] and the Genebridge 4 radiation hybrid panel [3] (HGMP-RC, Cambridge, UK) by PCR. The monochromosomal hybrid DNA panel localized the FBP3 gene to human chromosome 9. The results of the Genebridge 4 radiation hybrid panel screening were analysed via the Radiation Hybrid Mapping Environment (RHyME) at the HGMP (http://menu.hgmp.mrc.ac.uk/menu-bin/RHyME/RHyME.pl). This further de®ned the regional localization of the FBP3 gene on chromosome 9 close to the framework marker D9S159 (lod score . 3.0) located in the chromosome band 9q33-34.1 according the GDB internet site.