Human golgin-95 gene (GOLGA2). Map position 9q32-34.1.

Abstract

Golgin-95 is a 95-kD protein which was ®rst identi®ed in the sera of patients with autoimmune diseases such as systematic lupus erythematous (SLE) [1]. Its exact function is unknown, but it has been inplicated in the processing and transport of proteins through the Golgi complex. In this report, monochromosomal somatic cell and radiation hybrid mapping panels were used to assign the human Golgin-95 gene to chromosome 9q32-34.1. A 226-bp fragment of the GOLGA2 gene (EMBL accession number L06147) was ampli®ed using speci®c primers: GOLF (TACCGGGCTGACGAGAATGA) and GOLR (AGTGGCCAGCTTTTAGATGA), designed to the 39 UTR and identity con®rmed by sequencing. These primers were used to screen both a monochromosomal somatic cell hybrid DNA panel [2] and the Genebridge 4 radiation hybrid panel [3] (HGMP-RC, Cambridge, UK) by PCR. The monochromosomal hybrid DNA panel localized the GOLGA2 gene to human chromosome 9. The results of the Genebridge 4 radiation hybrid panel screening were analyised via the Radiation Hybrid Mapping Environment (RHyME) at the HGMP khttp://menu.hgmp.mrc.ac.uk/menu-bin/RHyME/RHyME.pll. This further de®ned the regional localization of the GOLGA2 gene on chromosome 9 close to the framework marker D9S290 (lod score .3.0) located in the chromosome band 9q32-34.1 according the GDB internet site.