Mongolica Litv Research Articles

Accumulation of carbon and nitrogen in the plant–soil system after afforestation of active sand dunes in China's Horqin Sandy Land

Afforestation of drylands is a potentially effective option to sequester carbon and to restore degraded soils and ecosystems. In China's Horqin Sandy Land, we investigated the effects of afforestation using Mongolian pine (Pinus sylvestris var. mongolica Litv.) in areas with active sand dunes on carbon (C) and nitrogen (N) storage in the plant–soil system. The 28- and 38-year-old plantations had 72 and 160 times the ecosystem biomass C storage, respectively, of areas with active sand dunes; the corresponding ecosystem biomass N storage was 48 and 105 times the value for areas with active dunes, versus 1.8 and 2.3 times for soil total C (organic plus inorganic) storage and 1.4 and 1.5 times for soil total N storage. The C and N accumulation rates in the plant–soil system were 678kgCha−1y−1 and 23kgNha−1y−1, respectively, over 38 years. The remarkable effects of afforestation on soil C and N primarily appeared in the upper 20cm of the soil. Our results indicated that afforestation of active sand dunes with Mongolian pine has high potential to sequester C and N in the plants and the soil. The biomass played a more important role than the soil for C sequestration, but the soil played a more important role than the biomass for N sequestration.

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China.

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report.

Afforestation effects on soil microbial abundance, microbial biomass carbon and enzyme activity in dunes of Horqin Sandy Land, northeastern China

In order to investigate the effects of afforestation on soil microbial abundance, microbial biomass carbon and enzyme activity in sandy dunes, 20-year-old Pinus sylvestris var. mongolica Litv. (PSM) and Populus simonii Carriere (PSC) mature forests were selected in Horqin Sandy Land, and mobile dunes was set as a control (CK). Results show that PSM and PSC plantations can improve soil physicochemical properties and significantly increase microbiological activity in mobile dunes. Soil microbial abundance, microbial biomass carbon and enzyme activity show an order of PS>PSM>CK. Total soil microbial abundance in PSM and PSC was respectively 50.16 and 72.48 times more than that in CK, and the differences were significant among PSM, PSC and CK. Soil microbial biomass carbon in PSM and PSC was respectively 23.67 and 33.34 times more than that in CK, and the difference was insignificant between PSM and PSC. Soil enzyme activity, including dehydrogenase (DEH), peroxidase (PER), protease (PRO), urease (URE) and cellobiohydrolase (CEL) in PSM and PSC were respectively 19.00 and 27.54, 4.78 and 9.89, 4.05 and 8.67, 29.93 and 37.46, and 9.66 and 13.42 times of that in CK. P. sylvestris and P. simonii can effectively improve soil physicochemical and microbiological properties in sandy dunes and fix mobile dunes in Horqin Sandy Land. The C mic :C ratio is an applicable indicator to estimate soil stability and soil water availability, and based on an overall consideration of plantation stability and sustainability, P. sylvestris is better than P. simonii in fixing mobile dunes in sandy land.

Physiological and Protein Responses to Drought in Four Pine Seedlings

Abstract Physiological and protein responses to drought stress in four pine seedlings, Pinus armandi Franch. (Pa), Pinus tabulaeformis Carr. (Pt), Pinus bungeana Zucc. ex Endl. (Pb) and Pinus sylvestris L. var. mongolica Litv. (Ps), were investigated using differential proteomics and water physiological indices. Firstly, the water physiological data showed that the decline rate of net photosynthesis rate, stomatal conductance, leaf water potential, turgor pressure except for under moderate drought stress was as follows: Pa>Ps>Pt>Pb. Pb and Pa always maintained the highest and lowest swelling pressure, respectively. Secondly, cluster analysis of 343 proteins indicated that the four pine species were classified into three groups with a genetic distance coefficient of 0.065. That is, five-needle-pine group (Pa), three-needle-pine group (Pb), two-needle-pine group (Pt and Ps), and the genetic distance between Pb and Pa was the farthest. The result was consistent with the declined rate in above physiological indices. Finally, for the differential proteomics analyzed, a total of 13 different proteins (P values < 0.01) changed significantly, the number of differentially expressed proteins was more in Pa (accounting for 46.2%) than the other three species, and 8 proteins were identified using matrix-assisted laser desorption/ionization time -of-flight mass spectrometry (MALDI-TOF-MS). These proteins are quite diverse in their functions and involved in photosynthesis, osmotic regulation and functioning as signal transduction. These results suggested that the sensitivities of the four pine species to drought were possibly related to genetic distance.

Urban Forests Carbon Storage and Sequestration Benefits in Changchun City, Based on i-Tree Model

The study area and plant 928786 trees, of which the most enjoy trees, accounting for about 45.6% of the total number of trees in the city. Eight of the region in the study area covered 2.7-7.9% of trees. Salix matsudana, Populus pseudo-simonii, Pinus sylvestnis var. mongolica Litv, Pinus tabulaeformis var.mukdensis Uyeki and Prunus persica f. rubro-plena is the most important species, they represent 32.2% of the number of all the trees, leaves area of 50.6% and 43.1% of the leaf biomass. The city a lot of trees concentrated in diameter at breast height 15.3-38.1 cm. In general, the tree is younger Changchun city (50.7% of DBH less than 23 cm). A large part of Changchun city area (accounting for 54% of the whole city) is by impervious material, asphalt, cement, stone cover, and the remaining 46% is permeable ground, herb areas, lawns and a small proportion of the pond, artificial lakes and rivers.

Method on Distinguishing Permafrost and Talik Regions in the Great Khingan Mountains by Analyzing the Characteristics of Specific Plants

In the fieldwork in the Great Khingan Mountains, it is practical and easy to distinguish permafrost region or talik region by analyzing the characteristics of the plants growing on them. Generally speaking, permafrost there tends to degenerate from south to north, but there are some individual places where remind original ecology of permafrost. After permafrost degenerate into the talik region, the condition of plant growth has changed. We can distinguish permafrost and talik region by the difference of plants growing status there. Some common species that specifically grow in permafrost or talik region have also been listed and introduced in this paper. Specifically, plants growing in permafrost region include larix gmelini, birch, vaccinium uliginosum, ledum palustre, vaccinium vitis-idaea, bilberry, pinus sylvestnis var. mongolica litv, low birch thicket, adina racemosa and so on. Meanwhile the plants live in talik region include peridium aquilinum, xylosma racemosum, daylily, milkvetch. The list of plants can be used to distinguish permafrost region and talik in the field. It is crucial for constructions to recognize if the construction area is permafrost or talik region. The change of talik has its two sides to constructions. On the upside, it can increase groundwater storage, and we can regard the future projects as thawing projects. On the downside, existing projects would arise thawing settlement.

EFFECT OF ENZYME TREATMENT ON THE MECHANICAL PROPERTIES OF WOOD CELL WALLS BY NANOINDENTATION

The objective of this research was to study the changes in hardness and elastic modulus of wood cell walls treated with enzymes. Such changes greatly influence the properties of paper and wood composites. Two enzymes, hemicellulase and lipase, were selected for the treatment. Poplar samples (Populus euramevicana) were treated with hemicellulase, while samples of southern yellow pine (Pinus spp.) and Mongolia scotch pine (Pinus sylvestris L. var. mongolica Litv.) were treated with lipase. Mechanical properties of both treated samples were investigated by nanoindentation. The results showed some changes in the hardness and elastic modulus of the poplar cell wall treated by hemicellulase. Hardness and elastic modulus values of southern yellow pine and Mongolia scotch pine cell walls treated by lipase decreased with increasing amounts of the enzyme.

Mongolian pine plantations enhance soil physico-chemical properties and carbon and nitrogen capacities in semi-arid degraded sandy land in China

Horqin Sandy Land is a seriously desertified and an ecologically fragile region of China. Soil degradation and desertification in this region are the result of several decades of overgrazing, non-manure cropping with short fallow, and arbitrary land use and management. We investigated whether the afforestation of active sand dunes with Mongolian pine (Pinus sylvestris var. mongolica Litv.) enhances the carbon (C) and nitrogen (N) storages and the overall soil quality. We compared soil physico-chemical properties, and C and N storages in the total and light fraction soil organic matter of active sand dunes, and of 25- and 35-year-old plantations. Soil water holding capacity, fine particle content and nutrients were significantly higher in plantations than in active sand dunes, with greater improvements occurring in the top 5cm than in the 5–15cm layer of the soil profile. Soil C and total N storages were 6.1 and 3.7 folds in 25-year-old, and 10.2 and 5.3 folds in 35-year-old plantations compared to active sand dunes, respectively. Carbon and N storages in the light fraction were 20.9 and 15.8 folds in 25-year-old, and 36.1 and 25.0 folds in 35-year-old plantations, respectively, relative to active sand dunes. The light fraction played an important role in soil C sequestration and its amount is an indicator of the effects of afforestation on C storage in sandy soil. The upper 15cm of the soil profile in the 35-year-old plantations of Mongolian pine has the capacity to sequester significant amount of C in the region, potentially offsetting part of the carbon that has been lost due to desertification over the past century in the Horqin Sandy Land. Our results conclude that afforestation with Mongolian pine has had positive impacts on soil quality and has increased the capacity for soil C sequestration in semi-arid degraded areas.

English

A large number of carbons are released into the atmosphere from forest fires per year, which has a significant influence on carbon cycle and storage. In this study, we examined the spatio-temporal patterns of forest fires from 1980 to 1999 in Daxing’an Mountain of Heilongjiang Province, China and estimated the carbon emissions from forest fires based on both field research and laboratory experiments. The results show that (1) burned areas of larch (Larix gmelinii Rupr.), Mongolian pine (Pinus sylvestris L. var. mongolica Litv.), white birch (Betula platyphylla Suk.), mixed broadleaved-conifer (L. gmelinii & B. platyphylla) and Mongolian oak (Quercus mongolica Fish.) forests were 437 947, 20 939, 142 527, 168 532 and 1 375 hm2 during 1980 to 1999 period, respectively. The fuel consumed based on these forests were 29.0 to 46.5, 16.7 to 26.5, 18.1 to 26.5, 31.9 to 51.4 and 24.5 to 40.3 Mg hm-2, respectively; (2) the total carbon emissions from forest fires of the forest types in Daxing’an Mountain was 3.8 to 5.9 Tg during this period. Two thirds of the total amounts were caused by larch forests, while 1/4 came from white birch forests and the rest from other forest types; (3) the amounts of CO2 released from forest fires for these 20 years were 13.9 to 21.6 Tg. The estimates were incomplete or could be low because the emissions from the burning of dead organic matter (litter, dead wood, etc.) were not included in this calculation and therefore, the net carbon balance was calculated.   Key words: biomass, carbonaceous gases, CO2 emissions, forest fires.

Evaluation of ACQ-D treated Chinese fir and Mongolian Scots pine with different post-treatments after 20 months of exposure

The field test of alkaline copper quat-type D (ACQ-D) treated Chinese fir ( Cunninghamia lanceolata Hook.) and Mongolian Scots pine ( Pinus sylvestris Linn. var. mongolica Litv.) stakes after different post-treatments was performed in two test plots (Chengdu and Guangzhou, China). The ACQ-D treatments used two concentration levels (0.5 and 1.1%) and four different post-treatments: air drying for 1 month (AD), conditioning at 70 °C and 80% relative humidity for 24 h (HC), oven drying at 110 °C for 24 h (DO) and boiling in water for 15 h (HW). The decay and termite ratings of the stakes after 6 and 20 months of exposure were recorded according to the method described in AWPA standard E07-07. The copper retention and compression strength parallel to grain before and after exposure were also compared. The results showed that Chinese fir had slightly better natural durability than Mongolian Scots pine but the untreated sapwood stakes for both wood species were mostly destroyed after 20 months exposure. After ACQ-D treatment, the sapwood of both wood species showed much better biological performance. Among the four post-treatments, HC exhibited the best performance by showing excellent biological resistance, less copper depletion and a slight reduction in compression strength after 20 months outdoor exposure. While the performance of the other post-treated stakes were impaired heavily in some cases in terms of wood species, test plots and the concentration levels of ACQ-D solutions. Furthermore, the study confirms that ACQ-D treated plantation-grown Chinese fir could be used for outdoor above ground and ground-contact applications.

Application of Different Post-Treatments to Improve the Leaching Resistance of ACQ-D Treated Wood

Chinese fir (Cunninghamia lanceolata Hook.) and Mongolian Scots pine (Pinus sylvestris Linn. var. mongolica Litv.) with dimension of 19.019.0450.0 mm were treated with two concentrations of amine copper quat-type D (ACQ-D) solutions (0.5%, 1.0%) respectively and post-treated with three different methods including humidity chamber, drying oven and hot water bath. The effects of these variables on copper leaching from ACQ-D treated wood were investigated according to the leaching test of AWPA E11. The results showed that post-treatment could improve the leaching resistance of ACQ-D treated wood effectively compared to the specimens those were leached immediately after impregnation. After some promising post-treatments, copper leaching from the treated wood was not only associated with the joint effects of retentions, wood species and different locations in the treated wood, but also influenced by the special fixation mechanisms in different post-treatments.

Study of the Influence of Anatomical Characteristics on Dyeing Effects of Plantation Pinus sylvestnis var. mongolica litv. Veneer

This paper takes plantation pinus sylvestnis var. mongolica litv. as study object, determines main anatomical factors influencing wood dyeing effects by measuring the related indexes of wood anatomical structure and dyeing effects, making a multiple regression analysis of them and analyzing the correlation variation law between wood anatomical structure and dyeing effects. The results show that there is a high correlation between pinus sylvestnis var. mongolica litv. dyeing effects and wood anatomical factors and the multiple correlation coefficients between anatomical factors and various dyeing effect indexes are between 0.573 and 0.786. The main anatomical factors influencing pinus sylvestnis var.mongolica litv.dyeing effects are tracheid proportion, wood ray proportion, resin canal proportion and late wood tracheid length, etc.

Comparative temporal analyses of the Pinus sylvestris L. var. mongolica litv. apical bud proteome from dormancy to growth

Bud dormancy in perennial plants adapts to environmental and seasonal changes. Bud dormancy is of ecological interest because it affects forest population growth characteristics and is of economical interest because it impacts wood production levels. To understand Pinus sylvestris L. var. mongolica litv. bud-dormancy and bud-burst mechanisms, we characterized the proteomes of their apical buds at the four critical stages that occur during the dormancy-to-growth transition. Ninety-six proteins with altered expression patterns were identified using NanoLC-ESI-MS/MS. The majority of these proteins (57%) are involved in metabolic and other cellular processes. For 28% of the proteins, a function could not be assigned. However, because their expression levels changed, they may be potential candidate bud development- or dormancy-related proteins. Of the 75 non-redundant bud proteins identified, ascorbate peroxidase, pathogenesis-related protein PR-10, and heat shock proteins dramatically increased during August and November, suggesting that they may involved in the initiation of bud dormancy. Conversely, S-adenosylmethionine synthetase, abscisic acid/stress-induced proteins, superoxide dismutase (SOD), caffeoyl-CoA O-methyltransferase, actin, and type IIIa membrane protein cp-wap13 had greater expression levels during April, suggesting that they may be involved in the initiation of bud dormancy-release. Cell division cycle protein 48 and eukaryotic initiation factors 4A-15 and 4A had greater expression levels during May, suggesting that they may regulate cell proliferate and differentiation in the shoot apical meristem. These observations provide insights into the molecular mechanisms that induce or break bud dormancy.

Organic carbon in soil physical fractions under different-aged plantations of Mongolian pine in semi-arid region of Northeast China

In order to understand the changes of surface soil carbon (C) storage following the afforestation of sandy grasslands, we used physical fractionation procedures to quantify C concentrations and sucrase enzyme activity in bulk soil and different particle fractions along two replicate chronosequences of Mongolian pine ( Pinus sylvestris var. mongolica Litv.) plantations in the southeastern Keerqin Sand Lands, Northeast China. Carbon concentration in bulk topsoil (0–15 cm) initially decreased following afforestation of grassland and subsequently increased as the forest matured. In general, this pattern of C concentration changes was associated with all particle-size fractions (except clays) and both macro- and microaggregates. The patterns of topsoil C were also influenced by wind erosion and deposition, with marked increases in the relative mass of silt and fine sand fractions occurring during forest development. The loss of aggregates immediately following afforestation was counteracted by formation of aggregates as the forests developed, contributing to the stabilization of carbon. To enhance soil C storage during afforestation of sandy soils in such semi-arid regions it is recommended to minimize disruption of grassland vegetation during the planting stage.

Changes in soil nitrogen availability due to stand development and management practices on semi‐arid sandy lands, in northern China

AbstractSoil nitrogen (N) availability is one of the limiting factors for plant growth on sandy lands. Little is known about impacts of afforestation on soil N availability and its components in southeastern Keerqin sandy lands, China. In this study, we measured N transformation under sandy Mongolian pine (Pinus sylvestris var. mongolica Litv.) plantations of different ages (grassland, young, middle‐aged, close‐to‐mature) and management practices (non‐grazing and free‐grazing) during the growing seasons using the ion exchange resin bag method. Results showed that, for all plots and growing season, soil NH‐N, NO‐N, mineral N, and relative nitrification index, varied from 0·18 to 1·54, 0·96 to 22·05, 1·23 to 23·58 µg d−1 g−1 dry resin, and 0·76 to 0·97, respectively, and NO‐N dominated the available N amount due to intense nitrification in these ecosystems. In general, the four indices significantly increased in the oldest plantation, with corresponding values in non‐grazing sites lower than those in free‐grazing sites (p < 0·05). Our studies indicated that it is a slow, extended process to achieve improvement in soil quality after afforestation of Mongolian pine in the study area. Copyright © 2009 John Wiley & Sons, Ltd.

Modelling three‐dimensional architecture of pine tree (Pinus sylvestris linn, van mongolica litv.) in a semiarid area

A dynamic model for three‐dimensional (3D) simulation of pine tree (Pinus sylvestris Linn, var. mongolica Litv) architecture based on dual‐scale automata is presented. The developmental sequence of pine trees was analysed qualitatively by identification of types of organs and elementary units. A dual‐scale automata model was used to describe the topological structure of the pine tree. The model is a collection of a large number of elementary units corresponding to the organs of the tree. The time step of simulation is set for 1 year. The model stochastically simulates the 3D architecture of a pine tree crown based on the Monte Carlo method and has been pa‐ram eterised for juvenile pine trees. Topological and geometrical parameters were calculated using a large amount of field data of branch number and internode lengths and diameters for 1‐ to 6‐year‐old pine trees. Visualisation of a 3D pine tree is presented. The model provides a good quantitative description of the 3D architecture of a single pine tree crown.

Soil animals and nitrogen mineralization under sand-fixation plantations in Zhanggutai region, China

The effects of soil animals on soil nitrogen (N) mineralization and its availability were studied by investigating soil animal groups and their amounts of macro-faunas sorted by hand, and middle and microfaunas distinguished with Tullgren and Baermann methods under three Pinus sylvestris var. mongolica Litv. plantations in Zhanggutai sandy land, China. In addition, soil N mineralization rate was also measured with PVC closed-top tube in situ incubation method. The soil animals collected during growing season belonged to 13 orders, 5 groups, 4 phyla, whose average density was 86 249.17 individuals·m−2. There were significant differences in soil animal species, densities, diversities and evenness among three plantations. Permanent grazing resulted in decrease of soil animal species and diversity. The average ammonification, nitrification and mineralization rates were 0.48 g·m−2·a−1, 3.68 g·m−2·a−1 and 4.16 g·m−2·a−1, respectively. The ammonification rate in near-mature forest was higher than that in middle-age forests, while the order of nitrification and net mineralization rates was: middle-age forest without grazing < middle-age forest with grazing < near-mature forest with grazing (P<0.05). Soil N mineralization rate increased with soil animal amounts, but no significant relationship with diversity. The contribution of soil animals to N mineralization was different for different ecosystems due to influences of complex factors including grazing, soil characteristics, the quality and amount of litter on N mineralization.

Effects of Pinus sylvestris var. mongolica afforestation on soil phosphorus status of the Keerqin Sandy Lands in China

Few studies have considered the effects of afforestation on soil phosphorus (P) status in semiarid regions such as the Keerqin Sandy Lands in China, though plantations have been widely established on P-deficient sandy soils to control wind-induced desertification. Phosphorus fractions and acid phosphomonoesterase (AP) activities were compared in the rhizosphere and bulk soils (0–5 and 5–20 cm) under Mongolian pine ( Pinus sylvestris L. var. mongolica Litv.) plantations of different ages (15, 22, and 30 years old) and in bulk soils under grasslands to understand soil P behavior with Mongolian pine plantation development and to find out major factors controlling soil P cycling. Stand age and rhizosphere processes had similar effects on the soil P fractions. Labile inorganic P and phosphate absorbed on aluminum and iron oxides were not affected by stand age and rhizosphere processes. Rhizosphere effects of Mongolian pine accelerated the mineralization of organic P by increasing microbial and AP activities. Soil P properties in bulk and rhizosphere soils changed similarly with plantation development. In the first 15 years after afforestation, total organic P, calcium phosphate, labile organic P, microbial biomass P (MBP) concentrations, and AP activities were reduced sharply. About 73% of the reduction in total P came from mineralization of organic P and 24% came from solubilization of calcium phosphate. From 15 to 22 years onward, soil total organic P and calcium phosphate decreased gradually and labile organic P, MBP, and AP activities increased greatly, whereas total inorganic P remained constant. The results suggest that soil P pool was depleted with Mongolian pine plantation development, especially in the early stage. As the dominant form of soil P, organic P was the main source of available P and associated biological processes controlled soil P cycling under Mongolian pine plantations. To ensure sustainability of pine plantations, it is imperative that soil fertility is conserved by adding fertilizer, thinning, and protecting litterfall.

Small-Scale Spatial Variability of Soil Nutrients and Vegetation Properties in Semi-Arid Northern China

ABSTRACT A field experiment was conducted at Kezuohouqi County, Inner Mongolia Autonomous Region of China, which was located on the southeastern edge of the Horqin Sandy Land, to study the spatial variability of soil nutrients for a small-scale, nutrient-poor, sandy site in a semi-arid region of northern China; to investigate whether or not there were “islands of fertility” at the experimental site; and to determine the key nutrient elements that sustained ecosystem stability. Results obtained from geostatistical analysis indicated that the spatial distribution pattern of soil total nitrogen (STN) was far different from those of soil organic matter (SOM), total phosphorus (STP), and total potassium (STK). Compared to SOM, STP, and STK, STN had a lower structural heterogeneity ratio and a longer range, while other elements were all similar. In addition, STN had an isotropic spatial structure, whereas the others had an anisotropic spatial structure. The spatial structure patterns of herbage species, cover, and height also differed, indicating that spatial variability was subjected to different ecological factors. Differences in the spatial variability patterns among soil nutrients and vegetation properties showed that soil nutrients for a small-scale were not the primary limiting factors that influenced herbage spatial distribution patterns. Incorporating spatial distribution patterns of tree species, namely, Pinus sylvestris var. mongolica Litv. and shrub Lespedeza bicolor Turcz. in a research plot and using fractal dimension, SOM, STP, and STK were shown to contribute to the “islands of fertility” phenomenon, however STN was not, possibly meaning that nitrogen was a key limiting element. Therefore, during restoration of similar ecosystems more attention should be given to soil nitrogen.

Introduction of Canadian tree species to the Northeast of China

This paper describes the early results of the introduction of some Canadian tree species to Liaoning Province in Northeast China. Based on earlier trial results from the 1920s and testing over the last 20 years, some of the introduced conifers show strong adaptation to the new ecological and climatic conditions with normal flowering and fruiting, excellent growth rates, and resistance to local pests. Of the seventeen introduced species tested, eastern white pine (Pinus strobus L.), jack pine (Pinus banksiana Lamb.), and pitch pine (Pinus rigida Mill.), show the most promising results as compared to indigenous pine species (i.e., Pinus tabulaeformis Carr., P. koraiensis Sieb. et Zucc., and P. sylvestris var. mongolica Litv.). These findings have resulted in the implementation of large-scale planting programs of jack pine in the current five-year plan of the provincial forestry authority. In parallel with the seed source trials, seed production areas have been established by selecting promising sources and species for developing local landraces for future seed production. The application of this successful cooperation will not only increase the forest cover of Liaoning from the current 31% to 35%, improving the environment and wood supply, but also serve as a model for the region as well as for other jurisdictions. Key words: species introduction, seed source, ecological adaptability, landrace, seed production areas