Molybdenum Cofactor Biosynthesis Research Articles

Whole transcriptomic and proteomic analyses of an isogenic M. tuberculosis clinical strain with a naturally occurring 15 Kb genomic deletion.

Tuberculosis remains one of the most difficult to control infectious diseases in the world. Many different factors contribute to the complexity of this disease. These include the ability of the host to control the infection which may directly relate to nutritional status, presence of co-morbidities and genetic predisposition. Pathogen factors, in particular the ability of different Mycobacterium tuberculosis strains to respond to the harsh environment of the host granuloma, which includes low oxygen and nutrient availability and the presence of damaging radical oxygen and nitrogen species, also play an important role in the success of different strains to cause disease. In this study we evaluated the impact of a naturally occurring 12 gene 15 Kb genomic deletion on the physiology and virulence of M. tuberculosis. The strains denominated ON-A WT (wild type) and ON-A NM (natural mutant) were isolated from a previously reported TB outbreak in an inner city under-housed population in Toronto, Canada. Here we subjected these isogenic strains to transcriptomic (via RNA-seq) and proteomic analyses and identified several gene clusters with differential expression in the natural mutant, including the DosR regulon and the molybdenum cofactor biosynthesis genes, both of which were found in lower abundance in the natural mutant. We also demonstrated lesser virulence of the natural mutant in the guinea pig animal model. Overall, our findings suggest that the ON-A natural mutant is less fit to cause disease, but nevertheless has the potential to cause extended transmission in at-risk populations.

Shared function and moonlighting proteins in molybdenum cofactor biosynthesis.

The biosynthesis of the molybdenum cofactor (Moco) is a highly conserved pathway in bacteria, archaea and eukaryotes. The molybdenum atom in Moco-containing enzymes is coordinated to the dithiolene group of a tricyclic pyranopterin monophosphate cofactor. The biosynthesis of Moco can be divided into three conserved steps, with a fourth present only in bacteria and archaea: (1) formation of cyclic pyranopterin monophosphate, (2) formation of molybdopterin (MPT), (3) insertion of molybdenum into MPT to form Mo-MPT, and (4) additional modification of Mo-MPT in bacteria with the attachment of a GMP or CMP nucleotide, forming the dinucleotide variants of Moco. While the proteins involved in the catalytic reaction of each step of Moco biosynthesis are highly conserved among the Phyla, a surprising link to other cellular pathways has been identified by recent discoveries. In particular, the pathways for FeS cluster assembly and thio-modifications of tRNA are connected to Moco biosynthesis by sharing the same protein components. Further, proteins involved in Moco biosynthesis are not only shared with other pathways, but additionally have moonlighting roles. This review gives an overview of Moco biosynthesis in bacteria and humans and highlights the shared function and moonlighting roles of the participating proteins.

Comparative genomic analysis between Corynebacterium pseudotuberculosis strains isolated from buffalo.

Corynebacterium pseudotuberculosis is a Gram-positive, pleomorphic, facultative intracellular pathogen that causes Oedematous Skin Disease (OSD) in buffalo. To better understand the pathogenic mechanisms of OSD, we performed a comparative genomic analysis of 11 strains of C. pseudotuberculosis isolated from different buffalo found to be infected in Egypt during an outbreak that occurred in 2008. Sixteen previously described pathogenicity islands (PiCp) were present in all of the new buffalo strains, but one of them, PiCp12, had an insertion that contained both a corynephage and a diphtheria toxin gene, both of which may play a role in the adaptation of C. pseudotuberculosis to this new host. Synteny analysis showed variations in the site of insertion of the corynephage during the same outbreak. A gene functional comparison showed the presence of a nitrate reductase operon that included genes involved in molybdenum cofactor biosynthesis, which is necessary for a positive nitrate reductase phenotype and is a possible adaptation for intracellular survival. Genomes from the buffalo strains also had fusions in minor pilin genes in the spaA and spaD gene cluster (spaCX and spaYEF), which could suggest either an adaptation to this particular host, or mutation events in the immediate ancestor before this particular epidemic. A phylogenomic analysis confirmed a clear separation between the Ovis and Equi biovars, but also showed what appears to be a clustering by host species within the Equi strains.

Characterization of moaC and a nontarget gene fragments of food‐borne pathogen Alcaligenes sp. JG3 using degenerate colony and arbitrary PCRs

AbstractAlcaligenes faecalis, is an opportunistic, pathogenic, Gram‐negative, food‐borne bacterium appearing to be of public health importance due to its resistance to common antibiotics and frequent involvement in nosocomial infections and water contamination. Yet, the Betaproteobacterium showed potential benefit in fat degradation of food waste. It is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. In this study, a degenerate colony and an arbitrary PCR‐based methods were involved in gene isolation steps. We designed a pair of degenerate primers to detect moaC (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) and two gene specific primers to amplify 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) ends of glpD of strain JG3 using degenerate colony and arbitrary PCR methods, respectively. The developed degenerate colony PCR resulted amplification of targeted 421‐bp DNA, while the set arbitrary PCR resulted in non‐targeted 436‐bp DNA. Deduced amino acid analysis showed that both sequences shared 94% amino acid similarity with molybdenum cofactor biosynthesis (MoaC) of Pseudomonas stutzeri and benzoate membrane transporter (BenE) of A. faecalis, respectively.Practical applicationsIt is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. However, information about these genes in pathogenic, food‐borne, Gram‐negative Alcaligenes sp. JG3 bacterium originated from root of Zea mays is barely found. A pair of degenerate primers (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) designed in this study could detect 421‐bp moaC gene fragment using degenerate colony PCR, while another pair of gene specific primers 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) aiming to amplify ends of glpD of Alcaligenes sp. JG3 detected a nontargeted, 436‐bp benE gene of the strain using an arbitrary PCR method.

Shared Sulfur Mobilization Routes for tRNA Thiolation and Molybdenum Cofactor Biosynthesis in Prokaryotes and Eukaryotes.

Modifications of transfer RNA (tRNA) have been shown to play critical roles in the biogenesis, metabolism, structural stability and function of RNA molecules, and the specific modifications of nucleobases with sulfur atoms in tRNA are present in pro- and eukaryotes. Here, especially the thiomodifications xm5s2U at the wobble position 34 in tRNAs for Lys, Gln and Glu, were suggested to have an important role during the translation process by ensuring accurate deciphering of the genetic code and by stabilization of the tRNA structure. The trafficking and delivery of sulfur nucleosides is a complex process carried out by sulfur relay systems involving numerous proteins, which not only deliver sulfur to the specific tRNAs but also to other sulfur-containing molecules including iron–sulfur clusters, thiamin, biotin, lipoic acid and molybdopterin (MPT). Among the biosynthesis of these sulfur-containing molecules, the biosynthesis of the molybdenum cofactor (Moco) and the synthesis of thio-modified tRNAs in particular show a surprising link by sharing protein components for sulfur mobilization in pro- and eukaryotes.

Genome Information of Maribacter dokdonensis DSW-8 and Comparative Analysis with Other Maribacter Genomes.

Maribacter dokdonensis DSW-8 was isolated from the seawater off Dokdo in Korea. To investigate the genomic features of this marine bacterium, we sequenced its genome and analyzed the genomic features. After de novo assembly and gene prediction, 16 contigs totaling 4,434,543 bp (35.95% G+C content) in size were generated and 3,835 protein-coding sequences, 36 transfer RNAs, and 6 ribosomal RNAs were detected. In the genome of DSW-8, genes encoding the proteins associated with gliding motility, molybdenum cofactor biosynthesis, and utilization of several kinds of carbohydrates were identified. To analyze the genomic relationships among Maribacter species, we compared publically available Maribacter genomes, including that of M. dokdonensis DSW-8. A phylogenomic tree based on 1,772 genes conserved among the eight Maribacter strains showed that Maribacter speices isolated from seawater are distinguishable from species originating from algal blooms. Comparison of the gene contents using COG and subsystem databases demonstrated that the relative abundance of genes involved in carbohydrate metabolism are higher in seawater-originating strains than those of algal blooms. These results indicate that the genomic information of Maribacter species reflects the characteristics of their habitats and provides useful information for carbon utilization of marine flavobacteria.

Identification of a protein-protein interaction network downstream of molybdenum cofactor biosynthesis in Arabidopsis thaliana

The molybdenum cofactor (Moco) is ubiquitously present in all kingdoms of life and vitally important for survival. Among animals, loss of the Moco-containing enzyme (Mo-enzyme) sulphite oxidase is lethal, while for plants the loss of nitrate reductase prohibits nitrogen assimilation. Moco is highly oxygen-sensitive, which obviates a freely diffusible pool and necessitates protein-mediated distribution. During the highly conserved Moco biosynthesis pathway, intermediates are channelled through a multi-protein complex facilitating protected transport. However, the mechanism by which Moco is subsequently transferred to apo-enzymes is still unclear. Moco user enzymes can be divided into two families: the sulphite oxidase (SO) and the xanthine oxidoreductase (XOR) family. The latter requires a final sulphurisation of Moco catalysed via ABA3. To examine Moco transfer towards apo-Mo-enzymes, two different and independent protein-protein interaction assays were performed in vivo: bimolecular fluorescence complementation and split luciferase. The results revealed a direct contact between Moco producer molybdenum insertase CNX1, which represents the last biosynthesis step, and members of the SO family. However, no protein contact was observed between Moco producer CNX1 and apo-enzymes of the XOR family or between CNX1 and the Moco sulphurase ABA3. Instead, the Moco-binding protein MOBP2 was identified as a mediator between CNX1 and ABA3. This interaction was followed by contact between ABA3 and enzymes of the XOR family. These results allow to describe an interaction matrix of proteins beyond Moco biosynthesis and to demonstrate the complexity of transferring a prosthetic group after biosynthesis.

Novel Metal Cation Resistance Systems from Mutant Fitness Analysis of Denitrifying Pseudomonas stutzeri.

Metal ion transport systems have been studied extensively, but the specificity of a given transporter is often unclear from amino acid sequence data alone. In this study, predicted Cu(2+) and Zn(2+) resistance systems in Pseudomonas stutzeri strain RCH2 are compared with those experimentally implicated in Cu(2+) and Zn(2+) resistance, as determined by using a DNA-barcoded transposon mutant library. Mutant fitness data obtained under denitrifying conditions are combined with regulon predictions to yield a much more comprehensive picture of Cu(2+) and Zn(2+) resistance in strain RCH2. The results not only considerably expand what is known about well-established metal ion exporters (CzcCBA, CzcD, and CusCBA) and their accessory proteins (CzcI and CusF), they also reveal that isolates with mutations in some predicted Cu(2+) resistance systems do not show decreased fitness relative to the wild type when exposed to Cu(2+) In addition, new genes are identified that have no known connection to Zn(2+) (corB, corC, Psest_3226, Psest_3322, and Psest_0618) or Cu(2+) resistance (Mrp antiporter subunit gene, Psest_2850, and Psest_0584) but are crucial for resistance to these metal cations. Growth of individual deletion mutants lacking corB, corC, Psest_3226, or Psest_3322 confirmed the observed Zn-dependent phenotypes. Notably, to our knowledge, this is the first time a bacterial homolog of TMEM165, a human gene responsible for a congenital glycosylation disorder, has been deleted and the resulting strain characterized. Finally, the fitness values indicate Cu(2+)- and Zn(2+)-based inhibition of nitrite reductase and interference with molybdenum cofactor biosynthesis for nitrate reductase. These results extend the current understanding of Cu(2+) and Zn(2+) efflux and resistance and their effects on denitrifying metabolism. In this study, genome-wide mutant fitness data in P. stutzeri RCH2 combined with regulon predictions identify several proteins of unknown function that are involved in resisting zinc and copper toxicity. For zinc, these include a member of the UPF0016 protein family that was previously implicated in Ca(2+)/H(+) antiport and a human congenital glycosylation disorder, CorB and CorC, which were previously linked to Mg(2+) transport, and Psest_3322 and Psest_0618, two proteins with no characterized homologs. Experiments using mutants lacking Psest_3226, Psest_3322, corB, corC, or czcI verified their proposed functions, which will enable future studies of these little-characterized zinc resistance determinants. Likewise, Psest_2850, annotated as an ion antiporter subunit, and the conserved hypothetical protein Psest_0584 are implicated in copper resistance. Physiological connections between previous studies and phenotypes presented here are discussed. Functional and mechanistic understanding of transport proteins improves the understanding of systems in which members of the same protein family, including those in humans, can have different functions.

Radical S-Adenosylmethionine Enzymes in Human Health and Disease.

Radical S-adenosylmethionine (SAM) enzymes catalyze an astonishing array of complex and chemically challenging reactions across all domains of life. Of approximately 114,000 of these enzymes, 8 are known to be present in humans: MOCS1, molybdenum cofactor biosynthesis; LIAS, lipoic acid biosynthesis; CDK5RAP1, 2-methylthio-N(6)-isopentenyladenosine biosynthesis; CDKAL1, methylthio-N(6)-threonylcarbamoyladenosine biosynthesis; TYW1, wybutosine biosynthesis; ELP3, 5-methoxycarbonylmethyl uridine; and RSAD1 and viperin, both of unknown function. Aberrations in the genes encoding these proteins result in a variety of diseases. In this review, we summarize the biochemical characterization of these 8 radical S-adenosylmethionine enzymes and, in the context of human health, describe the deleterious effects that result from such genetic mutations.

Structural Framework for Metal Incorporation during Molybdenum Cofactor Biosynthesis

The molybdenum cofactor (Moco) is essential forthecatalytic activity of all molybdenum-containing enzymes with the exception of nitrogenase. Moco biosynthesis follows an evolutionarily highly conserved pathway and genetic deficiencies in the corresponding human enzymes result in Moco deficiency, which manifests itself in severe neurological symptoms and death in childhood. In humans the final steps of Moco biosynthesis are catalyzed by gephyrin, specifically the penultimate adenylation of molybdopterin (MPT) by its N-terminal G domain (GephG) and the final metal incorporation by its C-terminal E domain (GephE). To better understand the poorly defined molecular framework of this final step, we determined high-resolution crystal structures of GephE in the apo state and in complex with ADP, AMP, and molybdate. Our data provide novel insights into the catalytic steps leading to final Moco maturation, namely deadenylation as well as molybdate binding and insertion.

Capturing a Cryptic Biosynthetic Intermediate Reveals Novel Enzyme Functions in Molybdenum Cofactor Biosynthesis

Capturing a Cryptic Biosynthetic Intermediate Reveals Novel Enzyme Functions in Molybdenum Cofactor Biosynthesis

Molecular characterization of novel immunodominant molybdenum cofactor biosynthesis protein C1 (Rv3111) from Mycobacterium tuberculosis H37Rv

BackgroundIn the molybdenum cofactor biosynthesis pathway, MoaA and MoaC catalyze the first step of transformation of GTP to cPMP. In M. tuberculosis H37Rv, three different genes (Rv3111, Rv0864 and Rv3324c) encode for MoaC homologs. Out of these three only MoaC1 (Rv3111) is secretory in nature. MethodsWe have characterized MoaC1 protein through biophysical, in-silico, and immunological techniques. ResultsWe have characterized the conformation and thermodynamic stability of MoaC1, and have established its secretory nature by demonstrating the presence of anti-MoaC1 antibodies in human tuberculosis patients' sera. Further, MoaC1 elicited a dominant Th1 immune response in mice characterized by increased induction of IL-2 and IFN-γ. ConclusionIntegrating these results, we conclude that MoaC1 is a structured secretory protein capable of binding with GTP and eliciting induced immune response. General significanceThis study would be useful for the development of vaccines against tuberculosis and to improve methods used for diagnosis of tuberculosis.

The molybdenum cofactor biosynthesis complex interacts with actin filaments via molybdenum insertase Cnx1 as anchor protein in Arabidopsis thaliana

The pterin based molybdenum cofactor (Moco) plays an essential role in almost all organisms. Its biosynthesis is catalysed by six enzymes in a conserved four step reaction pathway. The last three steps are located in the cytoplasm, where a multimeric protein complex is formed to protect the intermediates from degradation. Bimolecular fluorescence complementation was used to test for cytoskeleton association of the Moco biosynthesis enzymes with actin filaments and microtubules using known cytoskeleton associated proteins, thus permitting non-invasive in vivo studies. Coding sequences of binding proteins were cloned via the GATEWAY system. No Moco biosynthesis enzyme showed any interaction with microtubules. However, alone the two domain protein Cnx1 exhibited interaction with actin filaments mediated by both domains with the Cnx1G domain displaying a stronger interaction. Cnx6 showed actin association only if unlabelled Cnx1 was co-expressed in comparable amounts. So Cnx1 is likely to be the anchor protein for the whole biosynthesis complex on actin filaments. A stabilization of the whole Moco biosynthesis complex on the cytoskeleton might be crucial. In addition a micro-compartmentation might either allow a localisation near the mitochondrial ATM3 exporter providing the first Moco intermediate or near one of the three molybdate transporters enabling efficient molybdate incorporation.

Moco biosynthesis and the ATAC acetyltransferase engage translation initiation by inhibiting latent PKR activity.

Molybdenum cofactor (Moco) biosynthesis is linked to c-Jun N-terminal kinase (JNK) signaling in Drosophila through MoaE, a molybdopterin (MPT) synthase subunit that is also a component of the Ada Two A containing (ATAC) acetyltransferase complex. Here, we show that human MPT synthase and ATAC inhibited PKR, a double-stranded RNA-dependent protein kinase, to facilitate translation initiation of iron-responsive mRNA. MPT synthase and ATAC directly interacted with PKR and suppressed latent autophosphorylation of PKR and its downstream phosphorylation of JNK and eukaryotic initiation factor 2α (eIF2α). The suppression of eIF2α phosphorylation via MPT synthase and ATAC prevented sequestration of the guanine nucleotide exchange factor eIF2B, which recycles eIF2-GDP to eIF2-GTP, resulting in the promotion of translation initiation. Indeed, translation of the iron storage protein, ferritin, was reduced in the absence of MPT synthase or ATAC subunits. Thus, MPT synthase and ATAC regulate latent PKR signaling and link transcription and translation initiation.

Mechanistic Investigation of cPMP Synthase in Molybdenum Cofactor Biosynthesis Using an Uncleavable Substrate Analogue.

Molybdenum cofactor (Moco) is essential for all kingdoms of life, plays central roles in various biological processes, and must be biosynthesized de novo. During its biosynthesis, the characteristic pyranopterin ring is constructed by a complex rearrangement of guanosine 5'-triphosphate (GTP) into cyclic pyranopterin monophosphate (cPMP) through the action of two enzymes, MoaA and MoaC. Recent studies revealed that MoaC catalyzes the majority of the transformation and produces cPMP from a unique cyclic nucleotide, 3',8-cyclo-7,8-dihydro-GTP (3',8-cH2GTP). However, the mechanism by which MoaC catalyzes this complex rearrangement is largely unexplored. Here, we report the mechanistic characterization of MoaC using an uncleavable substrate analogue, 3',8-cH2GMP[CH2]PP, as a probe to investigate the timing of cyclic phosphate formation. Using partially active MoaC variants, 3',8-cH2GMP[CH2]PP was found to be accepted by MoaC as a substrate and was converted to an analogue of the previously described MoaC reaction intermediate, suggesting that the early stage of catalysis proceeds without cyclic phosphate formation. In contrast, when it was incubated with wt-MoaC, 3',8-cH2GMP[CH2]PP caused mechanism-based inhibition. Detailed characterization of the inhibited MoaC suggested that 3',8-cH2GMP[CH2]PP is mainly converted to a molecule (compound Y) with an acid-labile triaminopyrimidinone base without an established pyranopterin structure. MS analysis of MoaC treated with 3',8-cH2GMP[CH2]PP provided strong evidence that compound Y forms a tight complex with MoaC likely through a covalent linkage. These observations are consistent with a mechanism in which cyclic phosphate ring formation proceeds in concert with the pterin ring formation. This mechanism would provide a thermodynamic driving force to complete the formation of the unique tetracyclic structure of cPMP.

Determining Roles of Accessory Genes in Denitrification by Mutant Fitness Analyses.

Enzymes of the denitrification pathway play an important role in the global nitrogen cycle, including release of nitrous oxide, an ozone-depleting greenhouse gas. In addition, nitric oxide reductase, maturation factors, and proteins associated with nitric oxide detoxification are used by pathogens to combat nitric oxide release by host immune systems. While the core reductases that catalyze the conversion of nitrate to dinitrogen are well understood at a mechanistic level, there are many peripheral proteins required for denitrification whose basic function is unclear. A bar-coded transposon DNA library from Pseudomonas stutzeri strain RCH2 was grown under denitrifying conditions, using nitrate or nitrite as an electron acceptor, and also under molybdenum limitation conditions, with nitrate as the electron acceptor. Analysis of sequencing results from these growths yielded gene fitness data for 3,307 of the 4,265 protein-encoding genes present in strain RCH2. The insights presented here contribute to our understanding of how peripheral proteins contribute to a fully functioning denitrification pathway. We propose a new low-affinity molybdate transporter, OatABC, and show that differential regulation is observed for two MoaA homologs involved in molybdenum cofactor biosynthesis. We also propose that NnrS may function as a membrane-bound NO sensor. The dominant HemN paralog involved in heme biosynthesis is identified, and a CheR homolog is proposed to function in nitrate chemotaxis. In addition, new insights are provided into nitrite reductase redundancy, nitric oxide reductase maturation, nitrous oxide reductase maturation, and regulation.

Mechanism of pyranopterin ring formation in molybdenum cofactor biosynthesis

The molybdenum cofactor (Moco) is essential for all kingdoms of life, plays central roles in various biological processes, and must be biosynthesized de novo. During Moco biosynthesis, the characteristic pyranopterin ring is constructed by a complex rearrangement of guanosine 5'-triphosphate (GTP) into cyclic pyranopterin (cPMP) through the action of two enzymes, MoaA and MoaC (molybdenum cofactor biosynthesis protein A and C, respectively). Conventionally, MoaA was considered to catalyze the majority of this transformation, with MoaC playing little or no role in the pyranopterin formation. Recently, this view was challenged by the isolation of 3',8-cyclo-7,8-dihydro-guanosine 5'-triphosphate (3',8-cH2GTP) as the product of in vitro MoaA reactions. To elucidate the mechanism of formation of Moco pyranopterin backbone, we performed biochemical characterization of 3',8-cH2GTP and functional and X-ray crystallographic characterizations of MoaC. These studies revealed that 3',8-cH2GTP is the only product of MoaA that can be converted to cPMP by MoaC. Our structural studies captured the specific binding of 3',8-cH2GTP in the active site of MoaC. These observations provided strong evidence that the physiological function of MoaA is the conversion of GTP to 3',8-cH2GTP (GTP 3',8-cyclase), and that of MoaC is to catalyze the rearrangement of 3',8-cH2GTP into cPMP (cPMP synthase). Furthermore, our structure-guided studies suggest that MoaC catalysis involves the dynamic motions of enzyme active-site loops as a way to control the timing of interaction between the reaction intermediates and catalytically essential amino acid residues. Thus, these results reveal the previously unidentified mechanism behind Moco biosynthesis and provide mechanistic and structural insights into how enzymes catalyze complex rearrangement reactions.

Human gephyrin is encompassed within giant functional noncoding yin-yang sequences.

Gephyrin is a highly-conserved gene that is vital for the organization of proteins at inhibitory receptors, molybdenum cofactor biosynthesis, and other diverse functions. Its specific function is intricately regulated and its aberrant activities have been observed for a number of human diseases. Here we report a remarkable yin-yang haplotype pattern encompassing gephyrin. Yin-yang haplotypes arise when a stretch of DNA evolves to present two disparate forms that bear differing states for nucleotide variations along their lengths. The gephyrin yin-yang pair consists of 284 divergent nucleotide states and both variants vary drastically from their mutual ancestral haplotype, suggesting rapid evolution. Several independent lines of evidence indicate strong positive selection on the region and suggest these high-frequency haplotypes represent two distinct functional mechanisms. This discovery holds potential to deepen our understanding of variable human-specific regulation of gephyrin while providing clues for rapid evolutionary events and allelic migrations buried within human history.

C-Terminal glycine-gated radical initiation by GTP 3',8-cyclase in the molybdenum cofactor biosynthesis.

The molybdenum cofactor (Moco) is an essential redox cofactor found in all kingdoms of life. Genetic mutations in the human Moco biosynthetic enzymes lead to a fatal metabolic disorder, Moco deficiency (MoCD). Greater than 50% of all human MoCD patients have mutations in MOCS1A, a radical S-adenosyl-l-methionine (SAM) enzyme involved in the conversion of guanosine 5'-triphosphate (GTP) into cyclic pyranopterin monophosphate. In MOCS1A, one of the frequently affected locations is the GG motif constituted of two consecutive Gly at the C-terminus. The GG motif is conserved among all MOCS1A homologues, but its role in catalysis or the mechanism by which its mutation causes MoCD was unknown. Here, we report the functional characterization of the GG motif using MoaA, a bacterial homologue of MOCS1A, as a model. Our study elucidated that the GG motif is essential for the activity of MoaA to produce 3',8-cH2GTP from GTP (GTP 3',8-cyclase), and that synthetic peptides corresponding to the C-terminal region of wt-MoaA rescue the GTP 3',8-cyclase activity of the GG-motif mutants. Further biochemical characterization suggested that the C-terminal tail containing the GG motif interacts with the SAM-binding pocket of MoaA, and is essential for the binding of SAM and subsequent radical initiation. In sum, these observations suggest that the C-terminal tail of MoaA provides an essential mechanism to trigger the free radical reaction, impairment of which results in the complete loss of catalytic function of the enzyme, and causes MoCD.

Identification of DNA-binding proteins that interact with the 5′-flanking region of the human d-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry

d-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5′-flanking region of this gene (−4289bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5′-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression.