Characterization of moaC and a nontarget gene fragments of food‐borne pathogen Alcaligenes sp. JG3 using degenerate colony and arbitrary PCRs

Abstract

AbstractAlcaligenes faecalis, is an opportunistic, pathogenic, Gram‐negative, food‐borne bacterium appearing to be of public health importance due to its resistance to common antibiotics and frequent involvement in nosocomial infections and water contamination. Yet, the Betaproteobacterium showed potential benefit in fat degradation of food waste. It is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. In this study, a degenerate colony and an arbitrary PCR‐based methods were involved in gene isolation steps. We designed a pair of degenerate primers to detect moaC (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) and two gene specific primers to amplify 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) ends of glpD of strain JG3 using degenerate colony and arbitrary PCR methods, respectively. The developed degenerate colony PCR resulted amplification of targeted 421‐bp DNA, while the set arbitrary PCR resulted in non‐targeted 436‐bp DNA. Deduced amino acid analysis showed that both sequences shared 94% amino acid similarity with molybdenum cofactor biosynthesis (MoaC) of Pseudomonas stutzeri and benzoate membrane transporter (BenE) of A. faecalis, respectively.Practical applicationsIt is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. However, information about these genes in pathogenic, food‐borne, Gram‐negative Alcaligenes sp. JG3 bacterium originated from root of Zea mays is barely found. A pair of degenerate primers (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) designed in this study could detect 421‐bp moaC gene fragment using degenerate colony PCR, while another pair of gene specific primers 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) aiming to amplify ends of glpD of Alcaligenes sp. JG3 detected a nontargeted, 436‐bp benE gene of the strain using an arbitrary PCR method.