MN1 Gene Research Articles

Meta-analysis combined with syntenic metaQTL mining dissects candidate loci for maize yield

Yield potential and stability improvement with the goal of ensuring global food security is an important priority. Yield has a quantitative nature and is controlled by quantitative trait loci (QTL) and environmental factors. An increasingly large number of maize yield QTL have been identified, and how to integrate and re-analyze them is challenging. To this end, we tried to combine QTL meta-analysis with homology-based cloning techniques to dissect candidate loci/genes for maize yield. We first collected maize yield-related QTL from public resources. Then, 351 collected QTL were iteratively projected and meta-analyzed to obtain metaQTL (MQTL). A total of 54 MQTL were identified and tended to cluster in the maize genome. Seven MQTL containing ten maize orthologs of rice yield genes were dissected and temporarily termed syntenic MQTL. Maize orthologs of three functionally-characterized rice yield genes, GIF1, WFP/IPA1, and DEP1, were specially selected to undergo phylogenetic, proliferation, and selective pattern analysis. The results showed that maize orthologs were closely related to rice yield genes and subjected to mixed selective pressures, including positive selection during selective sweeps. The power of the combined techniques reported here was primarily validated not only by the congruency of MQTL and recently reported maize yield QTL but also by mined syntenic MQTL containing the well-characterized Miniature1 (Mn1) gene for maize kernel size and weight determination. Maize MQTL, especially syntenic MQTL regions, could serve not only for QTL fine-mapping and cloning but also for the marker-assisted selection breeding program. The maize yield candidate loci/genes presented here also deserve further investigation and will provide clues to the molecular bases of grain yield. Additionally, the combined technique described here will find its way into further quantitative trait research.

BAALC and EVI1 Prognostic Gene Expression in Adult Acute Myeloid Leukemia Using the Amlprofiler Custom Microarray

AbstractAbstract 1420▪▪This icon denotes a clinically relevant abstract BackgroundHigh expression of several genes have been found to be prognostically relevant in AML, such as EVI1, BAALC, MN1 and ERG [1–4]. These studies have mostly reported cutpoints at expression level quartiles with the highest prognostic value. Translation to the clinic remains difficult because a quartile definition cannot be applied to an individual patient. Therefore, from a clinical practice point, standardization has remained an important objective. AimUsing a standardized microarray for gene expression profiling we set out to develop and validate expression cutpoints for the EVI1, BAALC, MN1 and ERG genes that best predict overall survival (OS) for intermediate cytogenetic risk cases, rather than normal karyotype. MethodsFor training purposes, we employed a cohort of 147 intermediate cytogenetic risk cases [5, 6], and an external dataset of 242 cases [7]. For validation purposes, a cohort of 215 intermediate cytogenetic risk cases was employed [6]. Expression of the EVI1, BAALC, MN1 and ERG genes was measured using a custom microarray (AMLprofiler) with IVD-grade reagents and Affymetrix DX2 equipment.For the BAALC, MN1 and ERG genes, cutpoints were considered from the 10th to 90th percentile in steps of 5%. Optimal cutpoints were selected by performing 100-fold cross validations of the expression data of the training cohort and external cohort. EVI1 has a discontinuous distribution of expression [1]. Because of the low prevalence of high-EVI1 in AML we did not perform cross validation but used the entire training cohort to derive the best cutpoint. ResultsFor BAALC the 30th percentile cutpoint was verified to be clinically relevant in the training and external cohorts (Figure 1). ERG had no significant splits in the training data, and around the 65th percentile in the external cohort (Figure 1). MN1 had a broad range of significant splits around its 30th expression percentile in the training cohort but none in the external cohort (Figure 1). Due to the lack of consistent results across datasets, we have not attempted a validation of ERG and MN1. The best EVI1 cutpoint in the training set was found to be the 6th percentile. This cutpoint turned out to be concordant with a previously developed Q-PCR cutpoint [8, 9].Validation of the BAALC and EVI1 cutpoints on the independent validation cohort of intermediate cytogenetic risk cases resulted in significantly more favorable OS for cases with low-BAALC expression (HR 0.686, p=0.0205, Figure 2) and worse OS for cases with high-EVI1 expression (HR 2.27, p=0.004, Figure 2).In a multivariable analysis, including age, gender, white blood cell count and, blast percentage in BM, high-EVI1 retained independent prognostic value [HR 2.39, p=.008] while low-BAALC retained independent prognostic value only within the group of low-EVI1 cases [HR 0.602, p=.015]. ConclusionFor BAALC and EVI1, but not for MN1 and ERG, clinically relevant cutpoints have been developed that remain independent prognostic factors in intermediate cytogenetic risk AML and which through their incorporation in the AMLprofiler assay can be used for standardized measurements across different laboratories. [Display omitted] [Display omitted] Disclosures:van Beers:skyline diagnostics: Employment, Equity Ownership, Patents & Royalties. Brand:skyline diagnostics: Employment, Equity Ownership. van Vliet:skyline diagnostics: Employment, Equity Ownership. Vietor:skyline diagnostics: CEO skyline diagnostics Other, Equity Ownership. Valk:skyline diagnostics: Equity Ownership. Lowenberg:skyline diagnostics: CSO skyline diagnostics Other, Equity Ownership.

Prognostic significance of combined MN1, ERG, BAALC, and EVI1 (MEBE) expression in patients with myelodysplastic syndromes

Overexpression of MN1, ERG, BAALC, and EVI1 (MEBE) genes in cytogenetically normal acute myeloid leukemia (AML) patients is associated with poor prognosis, but their prognostic effect in patients with myelodysplastic syndromes (MDS) has not been studied systematically. Expression data of the four genes from 140 MDS patients were combined in an additive score, which was validated in an independent patient cohort of 110 MDS patients. A high MEBE score, defined as high expression of at least two of the four genes, predicted a significantly shorter overall survival (OS) (HR 2.29, 95 % CI 1.3-4.09, P= .005) and time to AML progression (HR 4.83, 95 % CI 2.01-11.57, P< .001) compared to a low MEBE score in multivariate analysis independent of karyotype, percentage of bone marrow blasts, transfusion dependence, ASXL1, and IDH1 mutation status. In a validation cohort of 110 MDS patients, a high MEBE score predicted shorter OS (HR 1.77; 95 % CI 1.04-3.0, P= .034) and time to AML progression (HR 3.0, 95 % CI 1.17-7.65, P= .022). A high MEBE expression score is an unfavorable prognostic marker in MDS and is associated with an increased risk for progression to AML. Expression of the MEBE genes is regulated by FLI1 and c-MYC, which are potential upstream targets of the MEBE signature.

ERG, BAALC, and MN1 RNA Levels Are Correlatively Over-Expressed, and Relate to Risk-Defining Prognostic Mutations in Intermediate-Risk Acute Myeloid Leukemia

Abstract 1471 Introduction:A variety of prognostic molecular markers have been proposed for risk stratification of intermediate-risk AML, which includes patients with normal cytogenetics (CN) and patients with cytogenetic abnormalities other than the recurrent prognostically informative cytogenetic aberrations (CA). Acquired mutations of FLT3 ITD, NPM1, and CEBPA have well-established prognostic significance, and have been incorporated into consensus classification schemes. In addition, several gene expression markers (WT1, ERG, BAALC, and MN1) have been proposed as prognostic indicators, but with less extensive validation. Whether these new gene expression markers should be incorporated into proposed “molecular risk scores” for AML has not been well refined. In this study, we have determined the transcript levels of WT1, ERG, BAALC, and MN1 in AML patients, and correlated these quantitative levels with other validated clinical and laboratory prognostic indicators. Methods: Diagnostic blood or bone marrow samples were analyzed from 56 pre-treatment AML patients from our institution (48% male; median age 59). Metaphase cytogenetics showed 4 patients with inv(16), 4 with a monosomal karyotype, 25 with a CN karyotype and 23 with a CA karyotype (intermediate-risk cytogenetics). The expression levels of WT1, ERG, BAALC, and MN1 were quantified with TaqMan real-time PCR and normalized to ABL. The FLT3 ITD, NPM1, DNMT3A R882, CEBPA, and MLL PTD mutations were detected with either HRM, direct sequencing, and/or PCR fragment analysis. The WT1 SNP rs16754 was determined with a TaqMan genotyping assay. Results: In the 56 AML patients, the prevalence of the FLT3 ITD, NPM1, MLL-PTD, and DNMT3A R882 mutations were similar to previously reported values at 37%, 27%, 6%, and 13%, respectively. The frequency of patients carrying the minor allele of the WT1 SNP (combined heterozygous and homozygous) was 30%. Compared with their expression level in 29 normal control individuals, all four genes were significantly over-expressed in the AML patients, with mean RNA level differences of 1.98-log for WT1 (P<0.0001), 1.18-log for ERG (P<0.0001), 1.02-log for BAALC (P<0.0001), and 0.53-log for MN1 (P = 0.005). ERG, BAALC, and MN1 were expressed at low but detectable levels in 100% of the normal control samples, while WT1 was not detectably expressed in 48% of the controls. For all 4 genes, there were no significant differences in the expression levels between the CA & CN cytogenetic subclasses. As high transcript levels of WT1, ERG, BAALC, and MN1 have been proposed to impart a high risk AML phenotype, one might predict that the RNA levels of each of these 4 genes would correlate with one another. To confirm that hypothesis, we found a highly significant correlation of quantitative RNA levels among the ERG, BAALC, and MN1 genes (P <.004; R=0.42–0.72). WT1 RNA levels were highly correlated with ERG (P<0.0001; R=0.59), but less highly correlated with BAALC & MN1 (P=0.04; R=0.3). Categorization of the gene expression level as “high” or “low” (above or below the median) also revealed a similar relationship, in which ERG, BAALC, and MN1 RNA were all significantly correlated (P<0.01), but there was no significant correlation of WT1 RNA with the other 3 genes (P>0.9). Consistent with its role as a prognostic risk marker, ERG transcript levels were significantly lower in CN-AML patients with the low-risk NPM+/FLT3- genotype than in those with other genotypes (0.42 log expression difference; P<0.04). Consistent with WT1’s role as a risk marker, in the CA-AML patients, WT1 RNA levels were significantly higher in patients with the high-risk FLT3+ genotype than in those with other genotypes (1.3 log expression difference; P<0.04). Conclusions: To better define prognostic risk markers in AML, we have performed comprehensive mutation and gene expression analysis on 56 diagnostic AML samples. WT1, ERG, BAALC, and MN1 RNA were significantly over-expressed in AML patients compared to normal controls. ERG, BAALC, and MN1 RNA levels significantly correlated with one another. The prevalence of FLT3, NPM, DNMT3A, and MLL mutations in these AML patients was predictably high, and some of these well-characterized prognostic mutations were significantly associated with gene expression levels. Additional details on the relationship of these new prognostic RNA markers to the clinical outcome of this AML cohort will be reported at the meeting. Disclosures:No relevant conflicts of interest to declare.

ETV6 Is An Early T-Cell Progenitor (ETP) Specific Tumor Suppressor Gene in Adult T-ALL

Abstract 406T-cell acute lymphoblastic leukemia (T-ALL) is a heterogeneous disease in which genetic lesions coordinately affect cell proliferation, differentiation and survival of thymocytes. Although pediatric T-ALL has been extensively studied on the genomic level during the last decade, large scale genomic studies in adult T-ALL are sparse. Importantly, significant differences in treatment outcome are present between pediatric and adult T-ALL.Here we performed integrative analysis of gene expression, copy number alterations and mutation analysis on 58 adult T-ALL samples treated in the Eastern Cooperative Oncology Group (ECOG) E2993 protocol. Unsupervised and consensus clustering of microarray gene expression data in this series revealed the presence of 2 stable gene expression clusters resembling immature/ETP (n=30) and typical (n=28) T-ALL gene signatures. Indeed, gene set enrichment analysis (GSEA) confirmed that our ETP/immature adult T-ALL signature closely resembled the previously published ETP profiles. In this adult patient cohort, the immature/ETP patient samples were associated with poor outcome (5 year OS 36% for ETP and 58% for non ETP TALL, P=0.088). Additional supervised analyses revealed differential expression of ERAP2, a gene involved in the processing of MHC peptides, between early relapse and long time survivor adult T-ALL patients. Consistently low ERAP2 expression was associated poor prognosis in adult T-ALL (OS 26%, 36% and 78% for 1st 2nd and 3rd terciles respectively, P=0.016). In addition, absence of TCR gamma deletion (p=0.013) as well as the absence of biallelic CDKN2A/CDKN2B deletion (p=0.009) were shown to be poor prognostic markers in adult T-ALL.To gain additional insight in the biology of adult ETP T-ALL, we performed GSEA analysis using the immature/ETP gene expression profiles. This analysis revealed that the adult ETP T-ALL signature is more closely related to acute myeloid leukemia (AML) profiles as compared to ALL signatures. Given this, we hypothesized that myeloid specific genetic alterations might be uniquely present in ETP adult T-ALL. Mutation analysis of AML oncogenes and tumor suppressor genes revealed the presence of myeloid mutations targeting IDH1, IDH2, DNMT3A, FLT3 and N-RAS in 13/30 (43%) of adult ETP T-ALL cases, whereas only 1/28 (3.5%) typical adult T-ALL showed a mutation in N-RAS. Although these ETP adult T-ALL samples seem to have myeloid properties, they still retain T-lymphoid characteristics including activational NOTCH1 mutations in 12/30 (40%) of ETP adult T-ALLs. Of note, the myeloid specific genetic alterations were preferentially present in NOTCH1 wild type ETP adult T-ALL samples.Next, we used a systems biology approach to identify master regulators that might be able to drive the ETP signature identified in adult T-ALL. For this, we interrogated a T-ALL interactome that was constructed from gene expression profiles of 228 human T-ALL samples. This master regulator analysis identified MN1 as the key transcription factor driving the ETP signature. The MN1 gene was initially identified as fusion partner of TEL (ETV6) in patients with AML. Notably, MN1-TEL expression in multipotent progenitors induces both AML and T-ALL and mutation analysis of ETV6 in adult T-ALL revealed the presence of 10 ETV6 mutants (9 frameshift and 1 splice site mutation) in adult T-ALL. Analysis of bone marrow remission genomic DNA confirmed the somatic origin of ETV6 mutations (3 frameshift and 1 splice site) in each of the 4 patient samples with available material. Most notably, ETV6 mutations were exclusively present in the ETP subtype of adult T-ALL. In addition, 8/10 (80%) of ETV6 mutant ETP T-ALL cases were characterized mutations in NOTCH1, suggesting a specific interaction between the oncogenic NOTCH1 programs and the mutational loss of ETV6 in early T-cell transformation.In conclusion, our integrative genomic analyses in adult T-ALL unraveled a high prevalence of immature/early T-cell progenitor (ETP) T-ALLs, associates the pathogenesis of ETP-TALL with myeloid mutations and identifies ETV6 truncating alleles as the first ETP specific gene mutation that strongly interact with NOTCH1 in T-cell transformation. Disclosures:No relevant conflicts of interest to declare.

Establishment of a novel human myeloid leukemia cell line, AMU-AML1, carrying t(12;22)(p13;q11) without chimeric MN1-TEL and with high expression of MN1

In this study, we established and analyzed a novel human myeloid leukemia cell line, AMU-AML1, from a patient with acute myeloid leukemia with multilineage dysplasia before the initiation of chemotherapy. AMU-AML1 cells were positive for CD13, CD33, CD117, and HLA-DR by flow cytometry analysis and showed a single chromosomal abnormality, 46, XY, t(12;22)(p13;q11.2), by G-banding and spectral karyotyping. Fluorescent in situ hybridization analysis indicated that the chromosomal breakpoint in band 12p13 was in the sequence from the 5' untranslated region to intron 1 of TEL and that the chromosomal breakpoint in band 22q11 was in the 3' untranslated region of MN1. The chimeric transcript and protein of MN1-TEL could not be detected by reverse-transcriptase polymerase chain reaction or Western blot analysis. However, the MN1 gene was amplified to three copies detected by array comparative genomic hybridization analysis, and the expression levels of the MN1 transcript and protein were high in AMU-AML1 cells when compared with other cell lines with t(12;22)(p13;q11-12). Our data showed that AMU-AML1 cells contain t(12;22)(p13;q11.2) without chimeric fusion of MN1 and TEL. The AMU-AML1 cells gained MN1 copies and had high expression levels of MN1. Thus, the AMU-AML1 cell line is useful for studying the biological consequences of t(12;22)(p13;q11.2) lacking chimeric MN1-TEL.

Abstract 1694: Over expression of MN1 induces therapy resistance in a murine model of AML

Abstract Acute myeloid leukemia (AML) is an accumulation of immature myeloid precursors that leads to marrow failure and death. This disease affects approximately 12,000 people per year in the United States, causing 9,000 deaths. Despite decades of active research the overall 5 year survival remains a dismal 30-40%. The backbone of initial therapy for the last 30 years is combination chemotherapy containing cytarabine (Ara-C) and an anthracycline. Resistance is a major problem and most patients diagnosed with AML will ultimately die from resistant disease. The MN1 gene encodes a transcription co-factor that has been found over-expressed in multiple AML patient samples. There are several reports that over-expression of MN1 confers a worse prognosis in AML. High MN1 expressers are less likely to achieve a remission and have lower 3 year survival rates. Additionally, over expression of MN1 in murine bone marrow leads to AML in transplanted recipients and predicts for resistance to ATRA in elderly AML patients. However, the effect of MN1 over expression on response to standard chemotherapy is currently unknown. To answer this question we used a murine model of AML driven by MLL-ENL. Blasts were infected with retroviral vectors that contained MN1 and a GFP reporter. Partially infected blast populations were then exposed to various concentrations of either Ara-C or doxorubicin and the ratio of GFP positive and negative cells was compared to untreated controls. When blasts were exposed to 150 nM Ara-C the GFP+ percentage went from 21.10 (+/- 0.5302) in the control samples to 35.68 (+/-1.230) in the treated samples. This result was even more profound when cells were treated with 15 ng/ml doxorubicin where the percentage went from 21.10 (+/- 0.5302) to 80.27 (+/-1.615). Bother results were highly statistically significant by two tailed student's t test with p values of 0.004 and &amp;lt; 0.0001 respectively. Consistent with these data purified blast populations over expressing MN1 showed resistance to both doxorubicin and Ara-C. This effect was the result of reduced induction of apoptosis as MN1 over expressing blasts showed decreased levels of annexin V staining after exposure to vary amounts of Ara-C or doxorubicin. In order to determine if MN1 conferred resistance to Ara-C and doxorubicin in vivo we injected sublethally irradiated recipients with a partially infected population of blasts. Eight days after injection of blasts animals were treated with 100 mg/kg Ara-C plus 3 mg/kg doxorubicin daily for 5 days or observed. Animals treated with Ara-C plus doxorubicin had 90.58% (+/-0.6638) GFP+ blasts compared to 55.38% (+/-5.245) in control animals. This result was highly statistically significant with a p value of &amp;lt; 0.0001 by two tailed student's t test. These data suggest that over expression of MN1 in this model confers resistance to Ara-C and doxorubicin in vitro and in vivo and provides a biological explanation for the clinical observation that it confers a worse prognosis. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8 Suppl):Abstract nr 1694. doi:10.1158/1538-7445.AM2011-1694

Over Expression of MN1 Confers Resistance to Chemotherapy In Vitro and In Vivo

AbstractAbstract 969Acute myeloid leukemia (AML) is an accumulation of immature myeloid precursors that leads to progressive marrow failure and death. This disease affects approximately 12,000 people per year in the United States, causing 9,000 deaths. Despite decades of active research the overall 5 year survival remains a dismal 30–40%. The backbone of initial therapy for the last 30 years is combination chemotherapy containing cytarabine (Ara-C) and an anthracycline. Resistance to these therapies is a major problem and most patients diagnosed with AML will ultimately die from resistant disease.AML is characterized by heterogeneous genetic alterations that can be used to delineate prognosis. Using standard karyotyping techniques patients can be divided into good, intermediate and poor prognostic categories. There is a clear link between these chromosomal aberrations and response to chemotherapy as complete remission rates are significantly different between groups. Patients with no detectable cytogenetic abnormality fall into an intermediate prognostic group with a very heterogeneous outcome. Recent work has begun to uncover submicroscopic genetic alterations that effect prognosis for these patients. These alterations can be mutations, over or under expression of a particular gene.The MN1 gene encodes a transcription co-factor first identified by its involvement in a balanced translocation in a patient with a meningioma. Since its initial description it has been found over-expressed in multiple AML patient samples. There are several reports that over-expression of MN1 confers a worse prognosis in AML. High MN1 expressers were less likely to achieve a remission and had a lower 3 year survival rate. Additionally, over expression of MN1 in murine bone marrow leads to AML in transplanted recipients and predicts for resistance to ATRA in elderly AML patients. However, the effect of MN1 over expression on response to standard chemotherapy is currently unknown.To answer this question we used a murine model of AML driven by MLL-ENL. AML blasts were infected with retroviral vectors that contained MN1 and a GFP reporter. Partially infected blast populations were then exposed to various concentrations of either Ara-C or doxorubicin and the ratio of GFP positive and negative cells was compared to untreated controls. When blasts were exposed to 150 nM Ara-C the GFP+ percentage went from 21.10 (+/− 0.5302) in the control samples to 35.68 (+/−1.230) in the treated samples. This result was even more profound when cells were treated with 15 ng/ml doxorubicin where the percentage went from 21.10 (+/− 0.5302) to 80.27 (+/−1.615). Both results were highly statistically significant by two tailed student's t test with p values of 0.004 and <0.0001 respectively. Consistent results were obtained in multiple different infections and with separately derived MLL-ENL lines. These data demonstrate that blasts expressing MN1 had an advantage when exposed to either Ara-C or doxorubicin although the effect was far more pronounced with doxorubicin exposure. MN1 expressing blasts were also resistant to the combination of Ara-C and doxorubicin.In order to determine if MN1 conferred resistance to Ara-C and doxorubicin in vivo we injected sublethally irradiated, Ly5.1+ C57Bl6 recipients with a partially infected population of blasts. Ly5.1+ animals do not express the Ly5.2 allele; thus, staining cells for Ly5.2 allows differentiation of leukemic cells from endogenous marrow. Eight days after injection of blasts animals were treated with 100 mg/kg Ara-C plus 3 mg/kg doxorubicin daily for 5 days or observed. On day 6 animals were sacrificed and bone marrow from bilateral femurs was harvested, stained for Ly5.2 and analyzed by flow cytometery. Animals treated with Ara-C plus doxorubicin had 90.58% (+/−0.6638) Ly5.2+, GFP+ blasts compared to 55.38% (+/−5.245) in control animals. This result was highly statistically significant with a p value of <0.0001 by two tailed student's t test. This observation was reproducible in a separately derived MLL-ENL driven cell line.These data suggest that over expression of MN1 in this murine AML model confers resistance to both Ara-C and doxorubicin in vitro and in vivo and provides a biological explanation for the clinical observation that it confers a worse prognosis. The mechanisms involved in this resistance are currently under study. Disclosures:No relevant conflicts of interest to declare.

Favorable Prognostic Impact of NPM1 Mutations in Older Patients With Cytogenetically Normal De Novo Acute Myeloid Leukemia and Associated Gene- and MicroRNA-Expression Signatures: A Cancer and Leukemia Group B Study

To analyze the prognostic significance of NPM1 mutations, and the associated gene- and microRNA-expression signatures in older patients with de novo, cytogenetically normal acute myeloid leukemia (CN-AML) treated with intensive chemotherapy. One hundred forty-eight adults age >or= 60 years with de novo CN-AML, enrolled onto Cancer and Leukemia Group B protocols 9720 and 10201, were studied at diagnosis for NPM1, FLT3, CEBPA, and WT1 mutations, and gene- and microRNA-expression profiles. Patients with NPM1 mutations (56%) had higher complete remission (CR) rates (84% v 48%; P < .001) and longer disease-free survival (DFS; P = .047; 3-year rates, 23% v 10%) and overall survival (OS; P < .001; 3-year rates, 35% v 8%) than NPM1 wild-type patients. In multivariable analyses, NPM1 mutations remained independent predictors for higher CR rates (P < .001) and longer DFS (P = .004) and OS (P < .001), after adjustment for other prognostic clinical and molecular variables. Unexpectedly, the prognostic impact of NPM1 mutations was mainly observed in patients >or= 70 years. Gene- and microRNA-expression profiles associated with NPM1 mutations were similar across older patient age groups and similar to those in younger (< 60 years) patients with CN-AML. These profiles were characterized by upregulation of HOX genes and their embedded microRNAs and downregulation of the prognostically adverse MN1, BAALC, and ERG genes. NPM1 mutations have favorable prognostic impact in older patients with CN-AML, especially those age >or= 70 years. The gene- and microRNA-expression profiles suggest that NPM1 mutations constitute a marker defining a biologically homogeneous entity in CN-AML that might be treated with specific and/or targeted therapies across age groups.

Overexpression of BAALC and MN1 Predict Worse Outcome in De Novo AML with Partial Tandem Duplication of MLL.

Abstract 1002Poster Board I-24 Background and purpose:Overexpression of BAALC, MN1, or ERG gene has been described to have adverse impact on the outcome of acute myeloid leukemia (AML) with normal karyotype. The majority of patients with partial tandem duplication of MLL gene (MLL-PTD) had normal karyotypes. The prognostic relevance of overexpression of these genes in MLL-PTD AML was not clear. Aims:We aimed to (1) measure the mRNA expression levels of FLT3, BAALC, FHIT, MN1, and ERG genes in AML patients with MLL-PTD (2) compare the expression levels of these genes with normal controls, and (3) determine their prognostic significance. Patients and methods:Bone marrow samples from 93 de novo AML patients with MLL-PTD at diagnosis were analyzed. MLL-PTD was screened by Southern blot analysis or reverse transcriptase polymerase chain reaction (RT-PCR) then confirmed by real-time quantitative PCR (RQ-PCR). RQ-PCR assay with TaqMan probe was performed to measure the expression of FLT3, BAALC, FHIT, MN1, and ERG genes in MLL-PTD AML as well as in 34 normal controls for comparison. The expression levels of target genes were calculated as the copy number of each gene normalized to the copy number of ABL control gene (NCN). Positive and negative controls as well as standard curve constructs were included in each assay. Mutational analysis was performed by DNA/cDNA PCR followed by GeneScan analysis for detection of internal tandem duplication of FLT3 gene (FLT3/ITD). The expression levels of each target genes were dichotomized at the median value to low and high expression groups. The event-free and overall survivals (EFS and OS) were compared between the 2 groups. Results:The expression levels of mRNAs for FLT3, BAALC, FHIT, MN1, and ERG genes at diagnosis in MLL-PTD AML and 34 normal controls are shown in Table.GeneMLL-PTDNCN/100 ABL(Mean±SE)ControlsNCN/100 ABL(Mean±SE)PFLT3703.4±59.663.6±6.9<0.001BAALC377.2±81.927.2±4.8<0.001FHIT36.5±4.426.9±3.50.089MN122.5±2.95.3±0.8<0.001ERG251.1±23.6147.2±22.90.012MLL-PTD patients had significantly higher expression levels of FLT3, BAALC, MN1, and ERG compared to normal controls. The expression of FHIT was also higher than that of controls, but did not reach statistic significance. FLT3/ITD was present in 26 of 52 patients (50%). The expression levels of the above genes were not different between patients with FLT3/ITD and those without. The median age of the entire cohort was 56 years. The median EFS and OS of the 52 patients who received standard induction chemotherapy were 5.8 and 11.4 months, respectively. The complete remission (CR) rate was higher in the low expression group than that of high expression group for BAALC (P = 0.011). The CR rate was not significantly different between low and high expression groups for FLT3, FHIT, MN1, or ERG, and between FLT3/ITD(+) and (-) groups. There were no significant difference in EFS or OS between patients with FLT3/ITD and those without. Patients with high expression of BAALC had a significantly shorter survival than those with low expression group; the median EFS was 10.3 mons (95% CI: 5.9-14.7 mons) vs. 0 mon, P = 0.044 and the median OS was 16.4 mons (95% CI: 8.3-25.5 mons) vs. 10.9 mons (95% CI: 6.5-15.3 mons), P = 0.031. Patients with high expression of MN1 also had a poor outcome compared with low expression group; the median EFS was 10.9 mons (95% CI: 0-28.3 mons) vs. 4.1 mons (95% CI: 0-11.7mons), P = 0.002 and the median OS was 29.7 mons (95% CI: 0-70.7mons) vs.11.0 mons (95% CI: 10.7-11.3 mons), P = 0.024. The EFS and OS were not significantly different between low and high expression groups for FLT3, BAALC, FHIT, and ERG. Conclusions:Our results showed that MLL-PTD was associated with overexpression of FLT3, BAALC, MN1, and ERG. The patients with lower expression level of BAALC had a higher CR rate and patients with overexpression of BAALC or MN1 had poor EFS and OS. FLT3/ITD had no prognostic impact.Supported by grants NSC97-2314-B-182 -011-MY3, NSC96-2314-B-195-006-MY3, and MMH-E-96009. Disclosures:No relevant conflicts of interest to declare.

Detection of ERG and MN1 Gene Expression in Adult Patients with De Novo Acute myeloid Leukemia(AML) by Real-Time Quantitative Polymerase Chain Reaction and Its Clinical Significance.

Abstract 4706 IntrodutionCurrent study found that certain genetic abnormalities are related to the prognosis of AML, such as ERG and MN1 gene expression. However, little is known about the clinical significance of ERG and MN1 expression level in Chinese patients with AML and and their correlation. Patients and methodsA real time quantitative reverse transcriptase polymerase chain reaction method was established for detecting ERG and MN1 gene expression levels in 87 de novo AML patients. ResultsThe median expression levels of ERG and MN1 in AML patient were statistically higher than that in normal control group (P<0.001). ERG gene expression had no correlation with MN1 gene expression (P=0.194) in AML patients. ERG and MN1 gene expressions were equally distributed among the FAB subtypes (P=0.850 and 0.870). Spearman's rank correlation showed that leukocyte counts and lactate dehydrogenase were significantly related to high ERG expression (P=0.005 and 0.032), but not significant correlation was found between hemoglobin and platelet counts. The ERG expression level of cases with middle and low risk group was lower than that of cases with high risk group (P<0.036). There was no significant difference of CR rates in high and low ERG and MN1 expression groups after chemical theropy (P=0.968 and 0.695). During the follow-up of one year, the cumulative relapse rates of high ERG expression groups was significantly higher than that of low ERG expression groups(P=0.039), and high ERG expression cases have a significantly worse OS than low ERG expression cases(P=0.005). ConclusionsThere isn't a linear correlation between ERG gene expression and MN1 gene expression in AML. Overexpression of ERG gene is a independent prognositic factor for AML. Quantification of the two gene expression together is not more effective to the judgement of prognosis in AML. Disclosures:No relevant conflicts of interest to declare.

ERG Expression Is an Independent Prognostic Factor and Allows Refined Risk Stratification in Cytogenetically Normal Acute Myeloid Leukemia: A Comprehensive Analysis of ERG, MN1, and BAALC Transcript Levels Using Oligonucleotide Microarrays

Recently, several novel molecular prognostic markers were identified in cytogenetically normal acute myeloid leukemia (CN-AML). In addition to the well-known influence of FLT3, NPM1, and CEBPA mutations, high transcript levels of the ERG, BAALC, and MN1 genes have been associated with inferior outcomes, but the relative importance of these risk markers remains to be defined. We analyzed ERG, BAALC, and MN1 expression levels in a cohort of 210 patients with CN-AML who received intensive chemotherapy. Expression levels of ERG, BAALC, and MN1 were determined in bone marrow samples by using oligonucleotide microarrays. High transcript levels of ERG, BAALC, and MN1 were predictors for inferior overall survival (OS) and a lower rate of complete remissions (CRs). There were significant positive correlations between the expression levels of all three genes. ERG expression levels predicted OS in elderly patients (ie, age 60 years or older) with CN-AML (P = .006) as well as in younger patients (P = .013). In multivariate analyses, high ERG expression was independently associated with a lower CR rate (P = .013), shorter event-free survival (P = .008), and shorter OS (P = .005). Patients who had low ERG levels and absent FLT3 internal tandem duplication (ITD) had a 5-year OS of 44%, and patients who had high ERG expression and FLT3 ITD had a 5-year OS of only 5%. We analyzed a comprehensive set of molecular risk factors in a large, homogeneous CN-AML patient cohort. In this study, high ERG expression levels emerged as a strong negative prognostic factor and provided prognostic information in addition to established molecular markers.

Importance of FLT3 Mutations and Other Genetic Abnormalities in Normal Karyotype AML.

Cytogenetic findings at diagnosis are currently considered the most important prognostic factor in AML. By far, the most common cytogenetic finding, found in approximately 40–50% of patients, is a normal karyotype (defined as detection of only normal chromosomes in 20 or more marrow cells). Recent molecular analyses of leukemic blasts in cytogenetically normal AML (CN-AML) have revealed a striking heterogeneity with regard to the presence of acquired gene mutations and changes in gene expression. Multiple submicroscopic genetic alterations with prognostic significance have been discovered, including mutations of the FLT3 gene, both internal tandem duplications (ITDs) and point mutations (TKDs), partial tandem duplication (PTD) of the MLL gene, mutations in the NPM1, CEBPA, and WT1 genes, and high expression of the BAALC, ERG, and MN1 genes. Most of these abnormalities, except for mutations in NPM1 and CEBPA, have been associated with an adverse prognosis. CN-AML patients with FLT3 ITD, NPM1 wild type, or both have worse outcome in the range of 30% long-term survival, unless they also harbor CEBPA mutations. A high expression of the FLT3 ITD allele compared to the FLT3 wild type allele confers an especially poor prognosis. In contrast, CN-AML patients without a FLT3 ITD and with NPM1 mutations have a particularly good outcome in the range of 60% long-term survival, unless they present with high ERG expression. The prognostic significance of FLT3 TKD mutations is controversial, and, recently, the outcome of patients with the MLL PTD has improved when treated with induction therapy, including etoposide and post induction therapy with autologous transplantation. As a result, the 2008 World Health Organization classification of AML recommends evaluation of FLT3, NPM1, and CEBPA mutations in CN-AML. Application of gene expression profiling has also identified signatures that appear to separate CN-AML patients into prognostic subgroups, and, more recently, a microRNA expression signature was found to be associated with outcome in molecular high-risk CN-AML patients (i.e., those with FLT3 ITD, NPM1 wild type, or both). These and similar future findings are likely to have a major impact on the clinical management of CN-AML not only in prognostication, but also in selection of appropriate treatment, since many of the identified genetic alterations already constitute (e.g., FLT3 mutations for tyrosine kinase inhibitors) or will potentially become targets for specific therapeutic interventions.

The Impact of MN1 Over-Expression on the Outcome of Younger Patients with AML Treated with Intensive Chemotherapy with or without ATRA Therapy

Over-expression of the MN1 gene has been reported in AML, and appears to be associated with the inv(16) subgroup. In a study of 142 patients with normal karyotype (NK) it was found to be an adverse prognostic factor for CR and overall survival in older patients (Heuser et al Blood 2006, 108:3898). In addition over-expression correlates with unmutated NPM1 and resistance to ATRA in combination with chemotherapy in non-APL with NK (Heuser et al Blood 2007, 110:1639). The UK MRC 12 trial treated patients with standard induction of ADE/MAE/DAT followed by 2 or 3 consolidation courses (MACE/MidAc/ICE). Of the 3459 patients recruited to the trial 1097 were also randomised to receive ATRA 45mg/m2/d (d 1–60); all these patients received DAT chemotherapy. Diagnostic samples were available from 196 patients in the ATRA randomisation for a retrospective analysis of the prognostic impact of MN1 over-expression.Methods: cDNA was generated using random priming and MuLV reverse transcriptase (Applied Biosystems). MN1 exon 1 forward, ATTGACCTGGACTCGCTGATG (Carella et al. Leukemia , 2007, 21:1679) and MN1 exon2 reverse, TGCTGAGGCCTTGTTTGCA primers were used to measure RNA abundance, giving a product of 174bp. The expression of ABL was used as an endogenous control: primers NA4_abl_exon4 CGGCTCTCGGAGGAGACGTAGA and A2N_abl-exon2 CCCAACCTTTTCGTTGCACTGT (Emig et al, Leukemia 1999, 13:1825) resulting in a product of 386 bp. Both primer sets are intron spanning and do not function on genomic DNA. PCR reactions were carried out to ensure linear amplification using dilutions of an inv(16) patient sample across the expected range which enabled the relative concentrations of MN1 and ABL, and the expression relative to the standard sample, to be calculated.Results: The median age of patients was 46 years (range 17–68); median follow up was 7.1 years. 107/196 patients were randomised to receive ATRA. MN1 status, whether viewed as high/low, or as a continuous variable was not significantly associated with age, white blood count (WBC) or sex; patients with normal karyotype were found to have lower MN1 levels (p<0.0001), patients with inv(16) or adverse cytogenetics tended to have higher MN1 levels (p=0.001, p=0.0007). Patients with NPM1 mutations, or FLT3-ITD mutations tended to have lower MN1 levels (p<0.0001, p=0.02 respectively). There was no significant impact of MN1 levels on remission rates, overall survival (OS) or relapse in either univariate analyses or those adjusted for age, WBC, sex, cytogenetics, performance status, de Novo/Secondary disease, FLT3-ITD and NPM1 status (effect sizes per log increase in MN1: CR adjusted OR 0.80 (0.42–1.52) p=0.5; OS adjusted HR 0.92 (0.69–1.23) p=0.6; Relapse adjusted HR 1.20 (0.83–1.72) p=0.3). Results were similar if analyses were restricted to normal karyotype patients. Overall there was no significant effect of ATRA, as reported previously (Burnett et al ASH 2002 abstract 529). There was no significant interaction between MN1 level and ATRA treatment for CR (unadjusted p=0.7; adjusted p=0.8) or overall survival (unadjusted p=0.9; adjusted p=0.8). However, in adjusted analyses there was a suggestion that the effect of ATRA on relapse was greater in patients with low MN1 levels (adjusted p=0.08). Similarly, looking at the normal karyotype group only there was no evidence of interaction on CR (adjusted p=0.4) or OS (adjusted p=0.9), with a similar greater effect of ATRA on relapse in low MN1 level patients (adjusted p=0.02).Conclusions: The data show a possible interaction between MN1 and ATRA treatment on relapse when adjusted for other baseline variables, but no evidence of prognostic value, nor that any effect of ATRA is moderated by MN1 when considering remission or survival.

Clinical outcome of de novo acute myeloid leukaemia patients with normal cytogenetics is affected by molecular genetic alterations: a concise review

Normal cytogenetics are detected pretreatment in approximately 45% of patients with de novo acute myeloid leukaemia (AML); thus this constitutes the single largest cytogenetic group of AML. Recently, molecular genetic alterations with prognostic significance have been reported in these patients. They include internal tandem duplication of the FLT3 gene, partial tandem duplication of the MLL gene, mutations of the CEBPA and NPM1 genes and aberrant expression of the BAALC, ERG and MN1 genes. Additionally, gene-expression profiling has been applied to identify prognostically relevant subgroups. Substantial progress has been made in the understanding of molecular pathways deregulated in leukaemogenesis and how these defects can be targeted by novel therapeutic compounds. Here we critically review the molecular heterogeneity among AML patients with normal cytogenetics and discuss how these data may translate into a prognostic, molecular-based treatment stratification that may improve the currently unsatisfactory outcome of these patients.

Influence of new molecular prognostic markers in patients with karyotypically normal acute myeloid leukemia: recent advances

Molecular study of cytogenetically normal acute myeloid leukemia is among the most active areas of leukemia research. Despite having the same normal karyotype, adults with de-novo cytogenetically normal acute myeloid leukemia who constitute the largest cytogenetic group of acute myeloid leukemia, are very diverse with respect to acquired gene mutations and gene expression changes. These genetic alterations affect clinical outcome and may assist in selection of proper treatment. Herein we critically summarize recent clinically relevant molecular genetic studies of cytogenetically normal acute myeloid leukemia. NPM1 gene mutations causing aberrant cytoplasmic localization of nucleophosmin have been demonstrated to be the most frequent submicroscopic alterations in cytogenetically normal acute myeloid leukemia and to confer improved prognosis, especially in patients without a concomitant FLT3 gene internal tandem duplication. Overexpressed BAALC, ERG and MN1 genes and expression of breast cancer resistance protein have been shown to confer poor prognosis. A gene-expression signature previously suggested to separate cytogenetically normal acute myeloid leukemia patients into prognostic subgroups has been validated on a different microarray platform, although gene-expression signature-based classifiers predicting outcome for individual patients with greater accuracy are still needed. The discovery of new prognostic markers has increased our understanding of leukemogenesis and may lead to improved prognostication and generation of novel risk-adapted therapies.

The MN1 oncoprotein activates transcription of the IGFBP5 promoter through a CACCC-rich consensus sequence

The IGF-binding protein (IGFBP) family consists of six proteins that are expressed and secreted in different tissues. The proteins are regulators of physiological processes throughout the body by modulating the activity of IGF-I and IGF-II. In this article, we describe the coordinated expression of IGFBP5 and MN1 in meningiomas. MN1 is a transcriptional co-activator and we show that MN1 stimulates the IGFBP5 promoter in Hep3B cells. A CACCC-containing sequence, located 140 bp upstream of the transcription start site of the promoter, is required for MN1 action. This sequence matches with the CACCCAC consensus sequence that was selected in an oligonucleotide selection assay performed for MN1. The CACCC element has also been shown to be important for induction of the IGFBP5 promoter by retinoic acid (RA) and progesterone (Pg). We were unable to confirm the effect of Pg on the promoter in Hep3B and U2-osteosarcoma cells regardless of the presence of MN1. On the other hand, we show that induction of the promoter by RA depends on co-expressed MN1 in Hep3B cells. MN1TEL, a leukemia-related fusion protein containing parts of the MN1 and TEL (ETV6) genes, is capable of stimulating the IGFBP5 promoter but is unable to cooperate with RA in Hep3B cells. This suggests that the effects of RA can be negatively affected in leukemias caused by MN1TEL.

Retroviral Insertion Tagging Identifies Mn1 as a Specific Collaborator of NUP98-HOXD13 in a Murine Model of Leukemogenesis.

The NUP98-HOXD13 (NHD13) fusion gene is formed by the t(2;11)(q31;p15) in patients with myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML). This fusion gene encodes a protein that fuses the N-terminal portion of NUP98, a nucleoporin involved in mediating RNA and protein transport in and out of the nucleus, with the C-terminal portion of HOXD13, a homeodomain protein not expressed during normal haematopoietic development. We have previously demonstrated that expression of the NHD13 fusion gene in a transgenic mouse model results in an invariably fatal MDS. These mice either die of complications of severe pancytopenia or progress to a fatal acute leukemia; greater than 90% of mice die by 14 months of age. The prolonged latency suggests that additional genetic events are required for leukemic transformation. We used a MOL4070LTR retroviral mutagenesis screen to identify candidate genes that might collaborate with the NHD13 transgene. All transgenic mice infected with the MOL4070LTR virus developed an acute leukemia, and the median survival of these mice was only four months, with none surviving beyond seven months of age. These survival figures are significantly decreased compared to either the wild type infected group or the transgenic uninfected group, suggesting a true synergistic effect between the NUP98-HOXD13 transgene and the genes affected by retroviral insertion events. Cloning of the insertion sites allowed identification of candidate collaborating genes. The most frequently identified gene was Meis1, a gene known to collaborate with HOX genes during leukemic transformation. This result supports the contention that the retroviral infection screen identifies specific collaboration between retrovirus and transgene. The second most common insertion site was near Mn1. These insertions clustered in two regions: four occurred within the final intron of Mn1, and four occurred between 80 kb and 160 kb 3′ of the 3′ end of the gene. Of note, MN1 is involved in human leukemia by fusion to the TEL oncogene via the t(12;22)(p13;q11) in myeloid leukemia. This translocation occurs within the intron of the human MN1 gene equivalent to that in which the four retroviral insertions occur in the mouse Mn1 gene. Moreover, this fusion transcript has recently been shown to collaborate with HOXA9 overexpression in leukemogenesis (Kawagoe and Grosveld, Blood 106(13):4269–77). We identified a fusion transcript formed in these four mice by RNA splicing between the 5′ part of Mn1 and the retroviral env gene. In addition, all eight of the mice with Mn1 insertions (both intronic and 3′) showed elevated wild-type Mn1 expression, suggesting that overexpression of wild-type Mn1 as well as a retroviral Mn1-env fusion can collaborate with the NHD13 transgene during leukemic transformation. Further studies are underway to investigate the oncogenic potential of an Mn1-env fusion as well as overexpression of the wild-type Mn1.

Molecular genetics of meningiomas

In this article the authors provide a brief description of the current understanding of meningioma genetics. Chromosome 22 abnormalities, especially in the Neurofibromatosis Type 2 (NF2) gene, have been associated with meningioma development. Loss of heterozygosity of chromosome 22 occurs in approximately 60% of meningiomas; however, loss of NF2 gene function occurs in only one third of these lesions. This discrepancy supports the theory that a second tumor suppressor gene exists on chromosome 22, and the authors introduce several possible gene candidates, including BAM22, LARGE, INI1, and MN1 genes. Deletions of 1p have also been shown to correlate with meningioma progression. The genetic similarities and differences among sporadic, NF2-associated, pediatric, and radiation-induced meningiomas are discussed, with the observation that the nonsporadic meningiomas have a higher incidence of multiple chromosomal abnormalities at presentation. Ultimately, a better understanding of the molecular pathways of meningioma tumorigenesis will lead to new, successful treatments.

Gene expression studies on developing kernels of maize sucrose synthase (SuSy) mutants show evidence for a third SuSy gene.

Previous studies have identified two tissue- and cell-specific, yet functionally redundant, sucrose synthase (SuSy) genes, Sh1 and Sus1, which encode biochemically similar isozymes, SH1 and SUS1 (previously referred to as SS1 and SS2, respectively). Here we report evidence for a third SuSy gene in maize, Sus3, which is more similar to dicot than to monocot SuSys. RNA and/or protein blot analyses on developing kernels and other tissues show evidence of expression of Sus3, although at the lowest steady-state levels of the three SuSy gene products and without a unique pattern of tissue specificity. Immunoblots of sh1sus1-1 embryos that are either lacking or deficient for the embryo-specific SUS1 protein have shown a protein band which we attribute to the Sus3 gene, and may contribute to the residual enzyme activity seen in embryos of the double mutant. We also studied developing seeds of the double mutant sh1sus1-1, which is missing 99.5% of SuSy enzyme activity, for evidence of co-regulation of several genes of sugar metabolism. We found a significant reduction in the steady-state levels of Miniature-1 encoded cell wall invertase2, and Sucrose transporter (Sut) mRNAs in the double mutant, relative to the lineage-related sh1Sus1 and sh1Sus1 kernels. Down-regulation of the Mn1 gene was also reflected in significant reductions in cell wall invertase activity. Co-regulatory changes were not seen in the expression of Sucrose phosphate synthase, UDP-glucose pyrophosphorylase, and ADP-glucose pyrophosphorylase.