Bioassay Method Research Articles

Exposure to lambda-cyhalothrin and abamectin drives sublethal and transgenerational effects on the development and reproduction of Cydia pomonella

The codling moth Cydia pomonella (Lepidoptera: Tortricidae) is a major invasive pest of pome fruits and walnuts worldwide. Lambda-cyhalothrin (LCT) and abamectin (AM) have been frequently used in C. pomonella control, but control of this pest is very difficult because shortly after hatching, larvae of this insect bore tunnels and hide inside host plant fruit. In this study, a simulated field spray bioassay method was developed against neonate larvae of C. pomonella and concentration-response bioassays were conducted to evaluate the susceptibility of the neonate larvae to LCT and AM. Exposure of neonate larvae to sublethal concentration (LC30) of LCT or AM significantly reduced the survival rate of larvae (4th and 5th instars), lowered the mean weight of larvae and pupae, and decreased the daily maximal number of eggs laid and the total number of eggs laid (fecundity) per female. The sublethal effects, including reduced body mass, mean fecundity and net reproductive rate, extended mean generation time, and shortened oviposition period, were also found in transgenerational offspring. Furthermore, the transgenerational maternal effects were more obvious for AM than LCT, in comparison to the control. Additionally, the estimated population size was decreased by exposure to LC30 of LCT and AM, and the observed reduction of fecundity and population size within and across generations was likely the result of the downregulation of the reproduction-related vitellogenin gene (CpVg) after exposure to LC30 of LCT and AM. These results provide a better understanding of the overall effects of LCT and AM on C. pomonella and the transgenerational effects which should be taken into consideration when using insecticides in order to control C. pomonella.

Baseline Susceptibility and Evidence of Resistance to Acetamiprid in Gill's Mealybug, Ferrisia gilli Gullan (Hemiptera: Pseudococcidae).

Gill's mealybug, Ferrisia gilli (Gullan) (Hemiptera: Pseudococcidae), is a major pest of pistachio in California. Insecticide treatment is the primary control method and acetamiprid is widely used to control this pest. However, there have been numerous reports of control failures for F. gilli after field applications of recommended insecticides in recent years. The purpose of this study was to develop a method for routine monitoring of F. gilli susceptibility and quantify current levels of F. gilli susceptibility to acetamiprid. A leaf-dip bioassay method using lima bean leaves was established and baseline susceptibility responses of 5 field populations were determined. Lethal concentrations to kill 50% of population (LC50) for second instar nymphs at 48 h ranged from 0.367 to 2.398 µg(AI)ml-1 of acetamiprid. Similarly, lethal concentrations to kill 90% of population (LC90) for second instar nymphs at 48 h ranged from 2.887 to 10.752 µg(AI)ml-1 of acetamiprid. The F. gilli population collected from Hanford area showed up to 6.5-fold significantly decreased mortality to acetamiprid compared to other populations. The resistance identified in this study, although relatively low, indicates that there has been repeated pressure to select for acetamiprid resistance and resistance levels can further magnify if effective management steps are not taken. The baseline susceptibility established in this study can be used to investigate potential cause of recent acetamiprid failures against F. gilli. In the long-term, results of this study will support the development of resistance management strategies by monitoring shifts in the susceptibility of F. gilli populations.

Acute Toxicity, and Neurobehavioural Responses of Afidopyropen on Exposure to Freshwater Edible Fish, Cyprinus carpio (Linnaeus)

Nowadays water pollution has become a real concerning problem worldwide in the aquatic ecosystem, due to the increasing use of a variety of pesticides in agriculture for the growing food demand in the world. Thereby in this investigation, we examined the LC50 value of afidopyropen, an insecticide, in addition to selected behavioural and ACh, AChE activity of Cyprinus carpio fingerlings. Fingerlings were exposed to different concentrations of afidopyropen ranging from 0.4mg to 1.6 mg/L by the semi-static bioassay method. And it had been found to be 1.0 mg/L. The fish exposed to this insecticide showed remarkable behavioural abnormalities in a dose-dependent manner. ACh accumulation and AChE inhibition in carp (Cyprinus carpio) exposed to a different concentration for the period of 96 hrs caused a significant increase in the elevation of acetylcholine (ACh), and was related to a marked decrease in the activity of acetylcholinesterase (AChE). In comparison with the corresponding controls, AChE activity was significantly decreased, whereas the ACh accumulation was markedly elevated due to the interaction of AChE activity which remarks in excess accumulation of acetylcholine at the neuromuscular junctions and synapses leading to make them more excitable for the behavioural changes due to impaired neurophysiology of the fish brain. The toxicity of afidopyropen during exposure to fish suggests that this compound poses a greater risk to fish.

A new WHO bottle bioassay method to assess the susceptibility of mosquito vectors to public health insecticides: results from a WHO-coordinated multi-centre study

BackgroundThe continued spread of insecticide resistance in mosquito vectors of malaria and arboviral diseases may lead to operational failure of insecticide-based interventions if resistance is not monitored and managed efficiently. This study aimed to develop and validate a new WHO glass bottle bioassay method as an alternative to the WHO standard insecticide tube test to monitor mosquito susceptibility to new public health insecticides with particular modes of action, physical properties or both.MethodsA multi-centre study involving 21 laboratories worldwide generated data on the susceptibility of seven mosquito species (Aedes aegypti, Aedes albopictus, Anopheles gambiae sensu stricto [An. gambiae s.s.], Anopheles funestus, Anopheles stephensi, Anopheles minimus and Anopheles albimanus) to seven public health insecticides in five classes, including pyrethroids (metofluthrin, prallethrin and transfluthrin), neonicotinoids (clothianidin), pyrroles (chlorfenapyr), juvenile hormone mimics (pyriproxyfen) and butenolides (flupyradifurone), in glass bottle assays. The data were analysed using a Bayesian binomial model to determine the concentration–response curves for each insecticide–species combination and to assess the within-bioassay variability in the susceptibility endpoints, namely the concentration that kills 50% and 99% of the test population (LC50 and LC99, respectively) and the concentration that inhibits oviposition of the test population by 50% and 99% (OI50 and OI99), to measure mortality and the sterilizing effect, respectively.ResultsOverall, about 200,000 mosquitoes were tested with the new bottle bioassay, and LC50/LC99 or OI50/OI99 values were determined for all insecticides. Variation was seen between laboratories in estimates for some mosquito species–insecticide combinations, while other test results were consistent. The variation was generally greater with transfluthrin and flupyradifurone than with the other compounds tested, especially against Anopheles species. Overall, the mean within-bioassay variability in mortality and oviposition inhibition were < 10% for most mosquito species-insecticide combinations.ConclusionOur findings, based on the largest susceptibility dataset ever produced on mosquitoes, showed that the new WHO bottle bioassay is adequate for evaluating mosquito susceptibility to new and promising public health insecticides currently deployed for vector control. The datasets presented in this study have been used recently by the WHO to establish 17 new insecticide discriminating concentrations (DCs) for either Aedes spp. or Anopheles spp. The bottle bioassay and DCs can now be widely used to monitor baseline insecticide susceptibility of wild populations of vectors of malaria and Aedes-borne diseases worldwide.Graphical abstract

Behavioural and Haematological Alterations in the African Catfish (Clarias gariepinus) Exposed to Varying Concentrations of Glyphosate

Extensive use of herbicides poses a serious threat to aquatic life due to runoff from treated fields. A static bioassay method was used to evaluate the toxicity of acute exposure to glyphosate on Clarias gariepinus behaviour and haematological parameters. Glyphosate was tested at varying concentrations (0.72, 1.44, 2.16, and 2.88 mg/l (control), 0.72, 1.44, 2.16, and 2.88 mg/l) for 96 hours in the laboratory. Significant (P &lt; .05) dose-dependent behavioural and morphological changes of respiratory disturbance, erratic swimming, loss of equilibrium, mucous secretion, and mortality were recorded in the surviving fish. Erythrocyte (RBC), haemoglobin (Hb), packed cell volume (PCV) and leukocyte (WBC) values decreased significantly (P &lt; .05) in treated fish as compared with controls. Mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), and mean corpuscular haemoglobin concentration (MCHC) were not significantly different (P &gt;.05) between the treated and control fish. Insignificant dose-dependent changes in the counts of neutrophils, monocytes, basophils, and eosinophils were also induced by glyphosate. The variations seen in this study demonstrated that glyphosate had a detrimental effect on the health of the fish. Educating farmers on recommended modes for the administration of glyphosate-herbicides on farmlands should be implemented and enhanced.

A Novel Lepidoptera bioassay analysed using a reduced GUTS model

Lepidopteran species can be both pests and also beneficial pollinators for agricultural crops. However, despite these important roles, the effects of pesticides on this diverse taxa are relatively understudied. To facilitate the assessment of pesticides and other chemical hazards on this taxa, we present a novel bioassay capable of testing chemical sensitivity to lepidopteran larvae through dietary exposure. We used Mamestra brassicae caterpillars as a model lepidopteran and tested their sensitivity for the organophosphate insecticide chlorpyrifos. We exposed larvae to an artificial diet spiked with chlorpyrifos and monitored survival over time, as well as weight change over a 96-hour exposure period. To test the repeatability and reliability of the developed bioassay, the experiment was repeated three times. The survival in time data collected enabled analysis with the General Unified Threshold of Survival (GUTS) model, recently recognized by EFSA as a ready-to-use tool for regulatory purposes. The GUTS modelling was used to derive a set of relevant toxicokinetic and toxicodynamic parameters relating to the larval response to exposure over time. We found that across the three repeats studies there was no more than a threefold difference in LC₅₀ values (13.1, 18.7 and 8.1 mg/Kg) at 48 h and fourfold difference at 96 h, highlighting the repeatability of the bioassay. We also highlighted the potential of the method to observe sub-lethal effects such as changes in weight. Finally, we discuss the applications of this new bioassay method to chemical risk assessments and its potential for use in other scenarios, such as mixture or pulsed exposure testing.

First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae

A fungus isolated from mango wasp was found to be pathogenic to houseflies. The isolated fungus was identified as Aspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106, 1x107, 1x108, 2x106, 2x107, 2x108, 3x106, 3x107, and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods. The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface. Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

Assessment of Water Environment Toxicity Conditioned by the Release of Various Sanitizers

The significance of preventing an adverse effect of various detergents and sanitizers used for the treatment (sanitation) of dairy farm equipment while maintaining its proper sanitary conditions on water bodies is underlined in the paper. Probable release into the environment of the tested sanitizing agents, including alkaline (Desmol, San alkaline, and Basix) and acidic (CircoSuper SFM, Tigma-K, and Biolight ST-2) products, from the farm per 1000 cows is predicted. Water environment toxicity at different concentrations of these sanitizers was assessed by the method of bioassay in terms of the survival rate of various hydrobionts, including &lt;i&gt;Tetrahymena pyriformis, Daphnia magna, Lymnaea stagnalis, Dendrocoelum lacteum&lt;/i&gt;, and &lt;i&gt;Poecilia reticulata&lt;/i&gt;. The zone of toxic effect of the studied agents, which forms the basis of the ecological passport of substances based on their influence on hydrobionts (LC&lt;sub&gt;0&lt;/sub&gt;, LC&lt;sub&gt;50&lt;/sub&gt;, and LC&lt;sub&gt;100&lt;/sub&gt;) was determined.

Evaluation of the knockdown resistance locus (kdr) in Anopheles stephensi (Diptera: Culicidae) in southeastern Iran.

The resistance to insecticide among Anopheles stephensi population due to insecticide selection pressure has been previously reported from Iran. The current study was performed to evaluate the susceptibility of different insecticide reagents against An. stephensi by bioassay and molecular methods in Saravan County, a malaria-endemic area in southeastern Iran. An. stephensi mosquitoes were collected from different larval habitats in Saravan City, southeastern Iran in 2022. At first, the susceptibility of collected samples for DDT, permethrin, and deltamethrin were evaluated by bioassay test. The collected mosquitoes were then evaluated for the presence of different kdr mutations. Insecticide susceptibility tests were conducted on the field population of An. stephensi from Saravan, revealing its potential resistance to pyrethroids and DDT. Of the 150 An. stephensi samples, 4 % carried the kdr L1014F mutation as heterozygous and the rest of them were homozygous L1014 wild type. The current study revealed the presence of L1014F mutation for the first time in Iran. So, further monitoring of kdr mutations in the VGSC gene and resistance phenotypes should be performed.

Acute Toxicity Effect of Mulsate (Glyphosate) Herbicide on Behaviour and Haematological Indices of African Catfish (Clarias gariepinus Burchell 1822) Juvenile

A semi-static bioassay method was used to study the toxicity effect of acute exposure of a commercial formulation of glyphosate herbicide (Mulsate) on the behaviour and haematological profile of Clarias gariepinus juvenile. Sample fish were exposed to lethal concentrations of mulsate at 0.00mg/l, 55.00mg/l, 65.00mg/l, and 75.00mg/l for 96 hours. Behavioural characteristics observed in exposed fish include respiratory distress, erratic swimming, loss of equilibrium, lethargies and sudden fish death. These varied greatly with differences in concentration of the toxicant. Mortality increased with an increase in concentration of the toxicant. The differences observed in the mortalities of C. gariepinus at varying concentrations were significant (P&lt;0.05), an indication that mortality could be a factor of concentration and time of exposure. After 96 hr of exposure, the LC50 for mulsate glyphosate herbicide was found to be 44.67mg/l. Furthermore, the toxicant led to significant reduction (P&lt;0.05) in haematological parameters as the toxicant concentration increased. Mean Red Blood Cells (RBC), Haemoglobin content (Hb), Packed Cell Volume (PCV), reduced as the concentration of toxicant increased. Mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), and mean corpuscular haemoglobin concentration (MCHC) were significantly different (P &lt;0.05) between the treated and control fish. Our results indicate that the commercial formulation of glyphosate herbicide (Mulsate) is toxic to C. gariepinus. The herbicide must hence be applied with care in our environment particularly close to water bodies to avoid ecotoxicological consequences.

Bioassay for total serum bioactivity of Atractylodes lancea.

The study aimed to establish a bioassay for total bioactivity of Atractylodes lancea (AL) in human serum samples. Inhibition of bacterial growth (Staphylococcus aureus ATCC 25923) was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. The calibration curve (0, 0.39, 0.78, 1.56, 3.13, 2.56, and 50 ng/μl) was linear with correlation coefficients >0.990. The limit of quantification (LOQ) was 1.66 mg/ml using 20-ml serum sample. The developed bioassay method meets the standard of the bioanalytical method for determination of serum bioactivity of AL.

The effect of chlorantraniliprole on the transcriptomic profile of Spodoptera frugiperda: a typical case analysis for the response of a newly invaded pest to an old insecticide.

Chlorantraniliprole is a diamide insecticide widely used in China over the last 15 years. The fall armyworm (FAW), Spodoptera frugiperda, newly invaded China in 2019. The response of FAW to chlorantraniliprole deserves more attention, in the context of many destructive lepidopteran species are resistant to diamide insecticides and the patent on core chemical of chlorantraniliprole in China expired in August 2022. This study investigated the response profile in larvae under chlorantraniliprole-induced (LC50) stress using methods of bioassay, RNA-Seq and qPCR. We observed growth inhibition and lethal effects in FAW larvae, but at a relatively high LC50 value compared to other several pests. Additionally, under chlorantraniliprole-induced stress, 3309 unigenes were found to be differentially expressed genes. The impacted genes included 137 encoding for detoxification enzymes, 29 encoding for cuticle proteins, and 20 key enzymes involved in the chitin metabolism, which all associated with metabolic resistance. Finally, we obtained the single nucleotide polymorphisms (SNPs) of two RyR genes, which are the target proteins for chlorantraniliprole. We also investigated the causes of the high LC50 value in our FAW, which possibly related to the stabilized 4743M on SNP frequency of RyR. These findings documented the genetic background of RyR of FAW and indicated that application of chlorantraniliprole has a high risk of controlling FAW in China. In brief, our results provide a better understanding of the mechanisms of chlorantraniliprole toxicity and detoxification in FAW, and will aid in monitoring the development of resistant strains for a newly pest to an old insecticide.

Antifeedant activity of aerial and root extracts of Sphagneticola trilobata (L) Pruski on Spodoptera litura (F.) (Lepidoptera, Noctuidae)

Antifeedant activity of methanol and hexane extracts of aerial and root extract of Sphagneticola trilobata (L) pruski was tested against seven day old larvae of Spodoptera litura (Fab.) (Lepidoptera, Noctuidae) by no choice method of bioassay. A maximum antifeedant activity of 52.96 per cent was recorded at 0.1 per cent of methanol extract of aerial parts after 24 h of feeding. Root extracts exhibited low level of antifeedant activity against S. litura. At lower concentrations of 0.005, 0.01 and 0.03 per cent, there was no significant antifeedant activity. Antifeedant activity recorded after 48 h of feeding was similar to 24 h experiment but a slight reduction was noticed for 0.1 per cent of the methanol extract.

천연 진드기기피제 개발을 위한 블렌딩 에센셜오일의 진드기 기피효능에 관한 연구

In this study, an experiment was conducted to measure the tick repellent efficacy through the synergy effect according to the type and ratio of blending essential oil. The subjects were adults and nymphs of the Haemaphysalis longicornis, and the repellent efficacy was measured using the filter paper bioassay method. Based on the past research, citronella oil, geranium oil, vetiver oil, and neem oil were selected as a single treatment experiment since their repellent efficacy was confirmed. The first experiment revealed that the repellent efficacy of citronella oil and geranium oil were high. Afterwards, in order to investigate the synergy effect on tick repellent efficacy, experimental group was consisted of neem seed oil (carrier oil) that was blended with citronella and geranium oil, at a ratio of 1:1, 2:1, and 17:3 (15%). Also, negative control group was composed of ethanol that was blended with citronella and geranium oil at the same ratio of experimental group. As a result, the blending of citronella and neem seeds showed higher repellent efficacy in all blending ratios than the blending of geranium and neem seeds. In adult ticks, blending ratio of citronella and neem seeds was 1:1 and 17:3, showed the most significant difference of repellent efficacy. In nymph ticks, when the blending ratio of citronella and neem seed was 1:1 and 17:3, the repellent efficacy was the same as that of the positive control commercial repellent. In conclusion, it was confirmed that both nymph and adults ticks showed higher repellent efficacy when blended than single treatment. In this study, the synergy effect of the blending of citronella and neem seeds on the tick repellent effect has a high potential to replace synthetic repellents.

Screening of actinomycetes from Ninh Thuan and Binh Thuan sea for antimicrobial producers

The sea is a unique ecosystem for finding secondary metabolites from marine microorganisms. Many compounds produced by marine microorganisms with antibacterial activity have been applied in life. Furthermore, microorganisms are renewable raw materials and media for drug production, thus crucial for sustainable development in our life. In this study, we screened for antibacterial activity of microbial strains isolated from tern samples from Ninh Thuan and Binh Thuan seas. The antibacterial activity of the marine microbial crude extracts was performed by the Bioassay method in a 96-well tray. The minimum inhibitory concentration (MIC) test results showed that from 86 strains of microorganisms isolated from the waters of Ninh Thuan and Binh Thuan, 68 strains were able to inhibit the growth of 1 to 6 strains of the tested microorganisms, and 27 over 86 strains had antibacterial activity against at least three strains of microorganisms tested. In which strains G631, G756, G769, and G778 inhibited 4 to 6 tested microorganisms with MIC values equal to or lower than positive controls. Morphological characteristics and molecular biological analysis identified the four most active strains. The results showed that all four strains were actinomycetes.

Assessment of the allelopathic potential of some naturalized tree and shrubby introducents under conditions of the northern steppe Dnieper region

Nowadays, introduced alien tree and shrubby species have become integral components of the green infrastructure in cities and suburban artificial forest plantations around the world, and their participation in regional dendroflora is steadily increasing. Along with autochthonous species, tree and shrubby introducents perform a wide range of ecological functions and ecosystem services, but, with successful naturalization and increased invasive activity, they can cause negative biological, environmental, social, and economic consequences. The potential for the evolution of adventive species in secondary habitats in the direction of increasing allelopathic activity and competitiveness compared with native species determines the need for assessment of allelopathic potential as a possible predictor of their successful invasive activity. The allelopathic activity of the species was determined by the bioassay method based on the effect of water extracts of different concentrations obtained from dry biomass of leaves on the germination of testing culture seeds of Raphanus raphanistrum subsp. sativus (L.) Domin and biometric indicators of seedlings of Lepidium sativum L. It was determined that in the conditions of the northern steppe Dnieper region, naturalized tree and shrubby introducents Celtis occidentalis L., Morus alba L., Lonicera tatarica L., Mahonia aquifolium (Pursh) Nutt., Prunus virginiana L., Prunus serotina Ehrh., Rhus typhina L. have significant allelopathic potential, which can be a predictor of increasing their competitiveness compared with native species and increasing invasive activity within the region. Water extracts from dry leaves of the studied tree and shrubby species had an inhibitory effect on seed germination and biometric indicators of testing cultures seedlings; the intensity of this effect varied depending on the plant species and extract concentration. Assessment of the allelopathic potential of the alien tree and shrubby species used in urban and suburban green planting is a necessary measure for preliminary identification of potentially invasive species, which will contribute to the increase of efficiency of green infrastructure management.

Effect of Peat Water Mix with Borehole Water on Mortality of African Catfish

Generally, cultured fish are suitable in media with a pH of around 7, like mountainous river and borehole water. However, peat water is known with low pH. It is not suitable for fish culture, especially for fingerlings. This study was conducted to examine the survival of African catfish fingerling (Clarias gariepinus) in the mixture of peat and borehole water with different pHs. Survival test of African catfish as subject applied bioassay method, LC50-96 hours. Peat water as the agent was arranged for 11 concentration levels of 0% - 100% with no replication and placed in plastic basins with 20 liters each. Catfish fingerlings were used for subject fish (size 10-15 cm) and 10 individuals in each basin. Water quality, mortality, and behavior of fish were observed. Results showed that the survival ability of African catfish on peat water, the LC50-96 hours was 63.8%, with 95% CI between 53.3% and 76.4% in concentration. Behavioral response of fish fingerling exposed to peat water ≥ 40% in the beginning 2 hours was frequently swimming up to surface. Lethal responses fingerlings were frequently taking up oxygen to the water surface, horizontally swimming, and moving vertically before death. After death, the fish ran out of mucus, and the skin looked peeling and bruising.

Circulating angiotensin II type I receptor – autoantibodies in diabetic pregnancies

Pregnant women with either pre-existing or gestational diabetes mellitus are at increased risk of preeclampsia as well as future cardiovascular disease. The renin-angiotensin system is dysregulated in both diabetes mellitus and preeclampsia. In preeclampsia, maternal levels of circulating agonistic autoantibodies against the angiotensin II Type I receptor (AT1-AAs) are increased. Circulating AT1-AAs are thought to contribute to both the pathophysiology of preeclampsia and the increased risk of future cardiovascular disease. Studies exploring AT1-AA in diabetes outside pregnancy suggest their potential for both metabolic and cardiovascular pathogenicity. No studies have investigated AT1-AAs in diabetic pregnancies. We hypothesized elevated maternal circulating AT1-AA levels in pregnancies complicated by any type of diabetes mellitus. Third-trimester maternal serum from 39 women (controls: n = 10; type 1 diabetes: n = 9; type 2 diabetes: n = 10; gestational diabetes=10) were analyzed for AT1-AA using an established bioassay method. Circulating AT1-AAs were present in 70% (7/10) of the controls and 83% (24/29) of the diabetes group (P = 0.399). Presence of AT1-AA was correlated to hsCRP levels (P = 0.036), but neither with maternal circulating angiogenic factors (soluble fms-like tyrosine kinase-1 and placental growth factor), nor with maternal or fetal characteristics indicative of metabolic disease or placental dysfunction. Our study is the first to demonstrate presence of circulating AT1-AAs in pregnant women with any type of diabetes. Our findings suggest AT1-AAs presence in pregnancy independently of placental dysfunction, nuancing the current view on their pathogenicity. Whether AT1-AAs per se contribute to increased risk of adverse pregnancy outcomes and future cardiovascular disease remains currently unanswered.

Rapid response in vitro bioassay method for the determination of Pu isotopes in urine samples

Rapid response in vitro bioassay method for the determination of Pu isotopes in urine samples

Dry Matter Yield Stability Analysis of Maize Genotypes Grown in Al Toxic and Optimum Controlled Environments

Breeding for Al tolerance is the most sustainable strategy to reduce yield losses caused by Al toxicity in plants. The use of rapid, cheap and reliable testing methods and environments enables breeders to make quick selection decisions. The objectives of this study were to (i) identify high dry matter yielding and stable quality protein maize (QPM) lines grown under Al toxic and optimum conditions and (ii) compare the discriminating power of laboratory- and greenhouse-based testing environments. A total of 75 tropical QPM inbred lines were tested at seedling stage for dry matter yield and stability under optimum and Al toxic growing conditions across six laboratory- and greenhouse-based environments. The nutrient solution method was used for the laboratory trials, while the soil bioassay method was used for the greenhouse trials. A yield loss of 55% due to Al toxicity was observed, confirming the adverse effects of Al toxicity on maize productivity. The ANOVA revealed the presence of genetic variation among the set of genotypes used in this study, which can be exploited through plant breeding. Seventeen stable and high-yielding lines were identified and recommended. Greenhouse-based environments were more discriminating than laboratory environments. Therefore, we concluded that greenhouse environments are more informative than laboratory environments when testing genotypes for Al tolerance.