Meatball Samples Research Articles

Analysis Pork Contamination in Beef Meatballs through Polymerase Chain Reaction in Palu City

The need for halal products is essential, particularly among various processed beef products like meatballs, which are popular among nearly the entire community. These products are susceptible to issues of meat counterfeiting for greater economic gain. This study aims to determine the smallest DNA concentration that can still be detected and to assess whether there is any pork contamination in meatballs circulating in Palu City using Polymerase Chain Reaction (PCR). This test uses four DNA samples obtained from fresh meat to test the specificity of the primer: wild boar, rat, and goat DNA samples as comparisons, and pig DNA as a positive control. The presence of DNA bands in the agarose gel electrophoresis visualization results indicates that DNA amplification has occurred, meaning that the sample can be detected. The analysis results showed that the primer used (Cyt-b) had good specificity for detecting pork DNA, while the absolute pork DNA concentration of 0.01 ng/µL and the reference meatball DNA with a concentration of 0.01% are the smallest limits that can still be detected using PCR. Of the four meatball samples from Palu City, one sample produced a DNA band, indicating that the sample contains or is contaminated with pig DNA. This method is valid as it meets the specificity test and demonstrates a good detection limit.

Identification of Borax in Meatball Skewer Snacks in East Lombok

Meatballs are a processed meat-based food commonly processed by adding chemical preservatives. Many reports find the usage of borax as the chemical preservative in meatballs sold in large markets on Lombok Island. However, the use of borax in the type of meatball consumed as snacks called skewered meatballs has not been identified thoroughly in East Lombok. This study aimed to identify borax in skewered meatballs in East Lombok qualitatively by curcumin paper test and flame test colors using sodium tetraborate as standard. The result showed that 4 samples confirmed positive for borax through the curcumin paper test. Two of those four samples showed the same flame color as standard corresponding to the presence of borax as a preservative in skewered meatballs tested. These results indicate that the curcumin paper test and flame color test were compatible in identifying borax in skewered meatball samples qualitatively.

Bacteria Contaminants in Meatballs Sold in the Market Padang City Raya

Meatballs are a processed meat product that has high nutrition. The maximum shelf life for meatballs made from meat is 1 day (12 hours). Storing meat foods at inappropriate temperatures, such as room temperature, greatly facilitates the growth of microbes. The marketplace for meatballs in traditional markets in the city of Padang is still sold on the streets at open-air temperatures without using sufficient refrigeration. The possibility of contamination with microorganisms is very large. This research aims to determine the suitability and quality of meatballs sold at Pasar Raya Padang City by examining the Total Plate Count (TPC) and identifying the types of bacteria that contaminate meatballs sold at Pasar Raya Padang City. The research results showed that the amount of microbial contamination in meatballs varied, namely 1.9x10 6, 7.5x10 6, 5.6x10 6, 1.8x10 6, 8.6x10 6, and 9.2x10 6. The results of this study showed that the meatball samples had microbial contamination greater than 10 5 CFU/gr or did not meet SNI standards. Based on macroscopic and microscopic morphological identification as well as biochemical reactions, all isolates were classified as bacteria from the genus Bacillus

Are online meatball restaurants in Indonesia committed to their declared Halal label?

Background and Aim: Halal restaurants participating in online food delivery services do not require halal certification. The Halal status of products through the Halal logo provides the consumer with information on the basis of which he decides to buy. Online transactions involve potential risks related to online processes, payment methods, and product quality. The aim of this study was to determine whether a declared Halal label is in accordance with the business processes implemented. Materials and Methods: Halal authentication of Gofood's meatball partner products in Yogyakarta and Solo Raya determined the incompatibility of meatball ingredients. Sixty meatball samples were collected from Yogyakarta and 30 samples from Solo Raya. Halal certification test was carried out using the thermal cycle polymerase chain reaction method at Universitas Gadjah Mada Animal Husbandry Laboratory and the results were used to identify pork contamination in meatballs. The addition of pork or pork meatballs was used as a control. Results: Eight meatball restaurants in the Solo Raya and Yogyakarta areas were found to be contaminated with pig DNA. The results of the tracing materials and processes, i.e., the grinding stage, are critical because all samples were supposed to be made from beef. It is known from interviews that contamination with pig DNA at the milling stage was accidental. Conclusion: Restaurants that sell meatballs are committed to adhering to product labels that are 91.1% safe from pork contamination. The Halal and original beef labels were in accordance with their statements. This study highlights the concept of Halal authentication with traceability to overcome pork contamination in meat products. Keywords: halal authentication, halal supply chain, online food delivery, traceability.

Identification of Formalin in Meatball Sold at Palopo City Food stalls using Schryver Method Approach

Formalin, a solution containing 30-50% formaldehyde gas (CH2O), finds applications in various sectors such as corpse preservation, disinfection, and the production of plastics and anti-foaming agents. Despite its industrial benefits, formalin is often misused as a preservative in the food industry, particularly in perishable items like meatballs. This research employs a descriptive method to provide an overview of formaldehyde identification in meatballs. Ten meatball samples were collected from permanent stalls in Palopo City for analysis. Laboratory tests conducted qualitatively using the Test Kit method revealed negative results (-) for formalin content in all samples. No color changes were observed in the tested meatballs, indicating the absence of formalin.

Investigation of Biofilm Production and Determination of Antibiotic Resistance Profile of Staphylococcus aureus Isolated from Ground Beef and Meatballs

Staphylococcus aureus (S. aureus) is bacterium that threatens public health because it causes infections and food intoxication. For this reason, within the scope of this study, it was aimed to determine the presence of S. aureus, antibiotic resistance profiles, and biofilm formation in ground beef and meatball samples consumed in Amasya. In the study, 60 meat samples purchased from Amasya were used as material. First, conventional culture technique and PCR testing were used for the isolation of S. aureus. Secondly, antibiotic resistance profiles of the S. aureus were analyzed by disc diffusion. Finally, biofilm production of the S. aureus was analyzed phenotypically by the microtiter plate method and genotypically by PCR. Through the study, we identified 58 S. aureus isolates that were confirmed phenotypically and genotypically. Disc diffusion results showed that all S. aureus were sensitive to imipenem and piperacillin-tazobactam, but resistant to methicillin 43.10% (25/58), erythromycin 41.37 % (24/58), penicillin 58.62% (34/58), gentamicin 10.34% (6/58), chloramphenicol 17.24% (10/58), tobramycin 6.89% (4/58), and levofloxacin 1.72% (1/58). Biofilm production was determined as 58.62% (34/58) in the microtiter plate. In the PCR analysis, the icaA or icaD gene of a total of 4 (6.89%) different isolates was evaluated as positive. As a result, the presence of antibiotic-resistant S. aureus in ground beef and meatballs and the production of biofilm by the bacteria pose a potential risk. Therefore, it is important for human health to take the necessary precautions to reduce the risk of S. aureus contamination during the processing, and transportation.

Comparing application methods of reishi mushroom (Ganoderma lucidum) extract in deep-fried meatballs: impact on heterocyclic aromatic amine formation.

The present research was conducted to investigate the impact of reishi mushroom extract (RME) on the formation of heterocyclic aromatic amines (HAAs) in meatballs. Sample preparations involved applying RME using either the spreading or addition method, with varying concentrations (0%, 0.25%, 0.5%, and 1% of RME), followed by deep-frying at temperatures of 150 and 190 °C for 3 min. The types and levels of HAAs varied based on the frying temperature, method of extract application, and the extract concentration. Notably, total HAA contents increased with rising the frying temperature (P < 0.01) and varied from undetectable levels to 4.91 ng g-1 across all analyzed meatballs. The addition method was more effective than the spreading method (P < 0.01), and among the concentrations tested 0.25% RME exhibited the highest efficacy in reducing total HAAs (P < 0.05). Furthermore, the addition method inhibited lipid oxidation more efficiently compared to the surface spreading method (P < 0.05). This study demonstrated that RME had mitigating effects on HAAs depending on the concentration and frying conditions in deep-fried meatball samples. © 2024 The Author(s). Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

Effect of Olive Oil Hydrogel as a Fat Replacer in Beef Meatballs.

Meat and meat products are essential sources of dietary saturated fatty acids. However, excessive consumption of meat and meat products may be harmful to human health. The study evaluates the effect of fat replacement with hydrogels (olive oil in water emulsions gelled by gelatine) in meatballs. The effect of replacing fat with different ratios of hydrogel (control, 25 (F25), 50 (F50), 75 (F75) and 100 % (F100)) on the chemical (fatty acids and thiobarbituric acid reactive substances (TBARS)) and physical (cooking loss, diameter reduction, fat retention, water retention, colour and texture analysis) characteristics of the meatballs were analyzed. The fat content of raw meatball samples was reduced from (31.2±2.2) to (10.5±0.4) % in the sample with the highest fat substitution (F100). The energy levels of the F100 samples were almost 56 % lower than of the control group. Monounsaturated fatty acids (MUFAs) represented the dominant group in all substitution rates of the meatballs, followed by saturated fatty acids (SFAs) and finally polyunsaturated fatty acids (PUFAs). Among the raw meatball samples, the highest oxidation occurred in the F50 and F100 groups. However, it was determined that the difference between F25 and F75 and the difference between control and F75 were not statistically significant (p˃0.05). When the cooked samples were compared, the highest thiobarbituric acid (TBA) value was found in the F50 sample, followed by the F100 and F75 samples. The difference between the mean values of springiness and cohesiveness of the samples was not significant (p˃0.05). The hardness value of samples decreased significantly (p˂0.001) with >75 % fat replacement. It can be concluded that the oil replacement rate that may satisfy consumer demand without impairing the product technological and chemical quality should be <75 %. As the fat replacement ratio increases, the SFA content of cooked meatballs decreases, while the MUFA and PUFA contents increase. Considering the positive effects of reducing the intake of SFAs and increasing the intake of unsaturated fatty acids on non-communicable diseases such as cardiovascular diseases, fat replacement in meatballs is important for future developments.

Sensitivity of commercial rapid test kit to pork contamination in processed foods

Guaranteeing halal products has now become a necessity, especially for food products. This is intended to ensure that the food produced is not contaminated with non-halal ingredients, including pork. Pork contamination in processed meat foods such as meatballs is still often found. Various tests can be done to detect the presence of pork in processed foods. One of them is a rapid test using the LFIA method. This test is widely used because it is more efficient, economical, and easy to prepare samples. A rapid pork contamination test kit (XEMA) has been circulating in Indonesia. In the research, the sensitivity of this rapid test kit was tested on processed meat foods with various concentrations of pork and variations in the main ingredients. The color test shows that the simulated samples of beef meatballs without added pork are dark greyish white, as are the simulated samples with concentrations of 1% and 10%. Meanwhile, samples with concentrations of 20% and 40% have a paler color. Meanwhile, there was no significant difference in the variation in pork concentration in meatballs with the main ingredients of chicken and fish. For smell and texture, there were no significant differences in the simulated samples, both the control and samples with varying concentrations. From testing, it is known that the test kit can detect the presence of pork up to a concentration of 10% in samples, with the main ingredients being beef, chicken, or fish. These results indicate that this rapid test kit can well detect pork contamination in processed food samples.

IDENTIFICATION OF LARD ON PROCESSED PRODUCTS IN MEDAN CITY USING UV SPECTROPHOTOMETER WITH LINEAR DISCRIMINANT ANALYSIS AND PRINCIPAL COMPONENT ANALYSIS METHODS

Objective: Processed meat products are highly popular among the community. However, deceptive traders sometimes adulterate these products with pork elements, necessitating thorough inspections. The qualitative detection of lard in processed products can be analyzed using UV spectrophotometry with chemometric techniques such as Linear Discriminant Analysis and Principal Component Analysis. These methods facilitate data analysis derived from spectra and wavelengths, enabling the categorization of objects and providing high accuracy.&#x0D; Methods: This study aimed to determine whether processed products in Medan contain lard using UV spectrophotometry, Linear Discriminant Analysis, and Principal Component Analysis methods.&#x0D; Results: The highest fat yield was obtained from lard at 14.24%, while the lowest was from chicken fat at 7.00%. The maximum wavelength results for control samples were 234 nm for chicken fat, 237 nm for beef fat, and 268 nm for lard. Data processing using Linear Discriminant Analysis and Principal Component Analysis showed that the processed products of three random samples, nugget, meatball, and sausage type A and C, fell within the same quadrant as chicken fat. Meatball and sausage type B were in the same quadrant as beef fat.&#x0D; Conclusion: Based on the identification of lard in processed products in Medan City using UV spectrophotometer by LDA and PCA, all random samples of nuggets, meatballs, and sausages do not contain lard, and this method can classify chicken fat, beef fat, lard well.

The Effect Of Burning Time On The Amount Of Bacteria Staphylococcus Aureus Contamination Of Grilled Meatballs Sold In Darusssalam, Banda Aceh

This study aims to determine the effect of heating time in the combustion process on Staphylococcus aureus contamination in grilled meatballs. A total of 9 samples of meatballs obtained from 3 sellers of grilled meatballs were divided into 3 treatments, namely burning at temperatures ranging from 56˚C-59˚C for 1 minute, 3 minutes, and 5 minutes, with 3 repetitions. Determination of the number of microbes was carried out using the Total Plate Count (TPC) method. The research data were analyzed using a two-way ANOVA analysis of variance followed by Duncan's test. The results showed that the duration of burning affected the amount of Staphylococcus aureus contamination in grilled meatballs. The best combustion was shown at 5 minutes, with a microbial count of 3.6 × 101 CUF/g. The results of the analysis of variance (ANOVA) showed that there was a significant difference (P0.05) in the average value of Staphylococcus aureus microbial contamination in grilled meatballs given treatment. Based on the calculation results, it can be concluded that 5 minutes of burning time is the most effective for decontaminating the amount of Staphylococcus aureus microbial contamination in grilled meatballs.

Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like Rat Meat (RM). Aim: This study aims to develop a Real-Time Polymerase Chain Reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other 8 species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in 8 marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

Analisis Kandungan Borak pada Makanan di Sekitar UIN Sumatra Utara Kec. Medan Tuntungan

Students are an investment in the nation and the nation's next generation. Their growth and development will be optimal depending on providing nutrition with good and correct quality, quantity. By consuming good food and snacks, it is hoped that you can contribute adequate nutrition. Students are used to eating and snacks whose main menu is meatballs, junkfoot and modern food currently on campus and around campus. However, currently many foods and drinks contain additional ingredients such as preservatives, borax and others. Thus, it is necessary to study and research the borax content as well as qualitative analysis of the meatballs sold by traders around the UINSU Tuntungan campus. This type of research uses total sampling carried out by the UPT HEALTH LABORATORY of the North Sumatra Provincial Health Service. located on Jl. Willem Iskandar Pasar V (Jl. Balai Pom) using qualitative methods. The research results showed that from 6 samples of meatballs located around the UIN campus, it was proven that they did not contain borax. Based on the results of the analysis, it can be concluded that all meatball sellers located around the UIN Medan Tuntungan Campus have good knowledge and attitudes which are important factors in avoiding contamination by toxic substances and how to manage meatballs properly without the use of preservatives, especially borax. The meatball processing method at UIN and around UIN meets the requirements of the Minister of Health of the Republic of Indonesia 2015, Number: 722/Menkes/Per/IX/2015 regarding food, so students don't need to worry.

Borax Content of Meatballs in Market X Area Surabaya Indonesia

Borax was still utilized in the process of making food, one of which was making meatballs. Meatball traders added borax to extend the short shelf life of meat and increase the chewy texture, as well as to give the meatballs a more white color. The research objective was to analyze the borax content of meatball samples in market X Surabaya, Indonesia in 2023. Analytical observational research method, the variables studied were the physical quality of meatballs and the borax content in meatballs. The object of this research was 12 meatballs sold by all vendors in Market X Surabaya, Indonesia. The results of the organoleptic test researched obtained 4 meatball samples (34%) with good assessment criteria, most of the 7 meatball samples (58%) with sufficient assessment criteria, and 1 meatball sample (8%) with poor assessment criteria. Laboratory test results 1 meatball sample (8%) contained borax, with physical characteristics of chewy texture, pale gray color, tart taste, and fishy smell. The conclusion of this studied was that 1 out of 12 samples had physical characteristics of meatballs containing borax and borax content was related to the organoleptic test with a significant valued of p-value = 0. 032. Suggestions for traders to used alternative ingredients to replaced borax, namely carrageenan (seaweed) to improved the physical quality of meatballs in terms of texture, color, and smell.

COMPARISON OF MICROBIOLOGICAL PROPERTIES OF TURKISH TRADITIONAL RAW MEATBALLS IN WINTER AND SUMMER

Raw meatball (çiğ köfte) is a popular food consumed fondly in Türkiye. The lack of being cooked and the constant hand contact during production and sale increase the risk of product contamination. This can cause food poisoning and pose a danger to public health. This study aims to determine the microbiological quality of raw meatballs sold in Çorum, Turkey. For this purpose, a total of 40 samples were studied in winter (n = 20) and summer (n = 20) months. Samples were analyzed for pH, total aerobic mesophilic bacteria, yeast-mold, E. coli, coliform, Enterobacteriaceae, Enterococcus, and Staphylococcus/Micrococcus. The pH value of raw meatball samples was 4.64-5.35 in the winter, and in summer, it was determined as 4.65–5.09. The total aerobic mesophilic bacteria, yeast-mold, coliform, Enterobacteriaceae, Enterococcus, Staphylococcus/Micrococcus count results of samples in summer and winter periods were determined respectively as

Quality Evaluation of Buffalo Meatballs Produced at Different Comminution Process Temperatures

Buffalo meatballs were formulated and the effects of different comminution temperatures on the quality (cooking yield, water holding capacity (WHC), protein, texture, colour, and sensory) were evaluated. During the mixing of ingredients, the comminution temperature was adjusted using different types of water which were ice (0°C), ice water (4°C), cold water (10°C), room temperature water (22°C), and warm water (32°C). Following comminution for 3 minutes, the temperatures of the batters were recorded at 14, 25, 25, 29, and 27°C, respectively. The comminution took a total of 15 minutes had produced batters with similar final temperatures (ranging from 36 to 38°C), except ice temperature mixing (28°C). Cold water meatballs produced the highest cooking yield but significantly the lowest (P&lt;0.05) water-holding capacity. The colour of the cold water meatball shows significantly (P&lt;0.05) the highest L* (lightness), significantly (P&gt;0.05) the lowest a* (redness), and the lowest b* (yellowness) values. While the textures (hardness, cohesiveness, gumminess, chewiness, and springiness) of all meatballs were similar (P&gt;0.05). All meatball samples had nearly similar soluble protein concentrations (0.97 to 1.06 ug/ml) but ice water meatballs had the highest (P&lt;0.05). The panellists gave all the meatballs a score ranging from 6.32 to 6.98, with ice meatballs receiving the highest mean score (6.98) acceptability score (P&gt;0.05). In conclusion, comminuted buffalo meatballs can be produced using either ice, ice water, cold water, room temperature water, or warm water without affecting their quality. However, ice is suggested for safety purposes against microbial growth during processing.

Investigation of Borax in Meatball Products Sold in Bengkalis, Riau

Highlights:1. Borax is still used as a food additive even though it has been banned.2. There was no relationship between age, income, and knowledge of the meatball sellers and the use of borax in Bengkalis.3. The risk factors for the widespread use of borax are still unknown. AbstractIntroduction: Borax is a food additive that can no longer be used. However, there were still many street food vendors who violated this rule. This study aimed to determine the presence or absence of borax in meatballs and the relationship between meatball sellers' characteristics and knowledge of the use of borax in Bengkalis, Riau. Methods: This was an observational analytic study with cross-sectional collection. This study collected 40 samples of meatballs and meatball sellers in Bengkalis. The sampling technique used purposive sampling by interviewing meatball sellers and filling out the questionnaire on the spot. Data were analyzed by Chi-Square test.Results: This study found that all meatballs contained borax with 36 samples found to have borax content above the standard. This study also found no relationship between characteristics (age, level of knowledge, income) and knowledge of meatball sellers with the use of borax (p &gt; 0.05).Conclusion: There was no significant relationship between borax use and meatball sellers' knowledge and characteristics.

Analisis Kandungan Formalin dan Boraks Pada Bakso dan Tahu di Wilayah Kota Malang

The main danger posed by formalin and boric acid or often called borcas if exposed continuously is that it can irritate the respiratory tract if inhaled, cause skin blisters if in contact with skin, nausea, vomiting, diarrhea, possible bleeding, abdominal pain, headache, hypotension, fainting. to coma. In addition, formalin can cause degenerative changes in the liver, heart, brain, other organs and can trigger genetic mutations resulting in cell damage or cell death which can result in the growth of cancer cells. This study aims to identify the content of formalin and boric acid or borkas in food samples of meatballs and tofu. The method used in this research is to test for boric acid or borcass by using AgNO3 and Paper Test Kit and for testing Formalin using KMnO4 and Reagent Test Kit. This method is used as a qualitative test for the presence of formalin and borax or boric acid in the sample. A positive result for the presence of borax or boric acid with AgNO3 with the occurrence of a white precipitate and using a paper test kit will turn brown. To identify formalin, a positive result with KMnO4 is indicated by a change in color to brown and using a test kit reagent is indicated by a change in the color of the positive sample to purple. The samples tested were 3 meatball samples and 3 tofu samples. The results of the identification of formalin and borax or boric acid in all meatball and tofu samples were obtained using qualitative tests, no meatball and tofu samples containing formalin and borax or boric acid were found.

Investigation the Effects of Jerusalem Thorn (Paliurus spina-christi Mill.), Oriental Hackberry (Celtis tournefortii L.) Fruits and Black Cumin (Nigella sativa L.) Seed on Microbial Quality and Physicochemical Properties of Meatballs

This study was conducted to examine the effect of Jerusalem thorn (Paliurus spina-christi Mill./PSC) and oriental hackberry (Celtis tournefortii L./CT) fruits and black cumin (Nigella sativa L./NS) seed on the microbial quality and physicochemical properties during the storage of meatballs +4 oC. For this purpose, PSC, CT fruits, and NS seeds were added to the meatballs at 2% to form four groups, including the control. Prepared meatball samples were covered with stretch film in polyethylene plates and stored at 4±1 °C for 16 days. Analyzes were made on the 0, 4, 8, 12, and 16th days of storage in the meatball samples. The pH values of the meatball samples were determined between 5.89-6.02 on day 0 and between 6.10-6.49 on day 16, aw values between 0.956-0.964 on day 0 and 0.971-0.980 on day 16. Total mesophilic aerobic bacteria (TMAB), total psychrotrophic bacteria (TPAB), lactic acid bacteria (LAB), and yeast-mold counts of meatball samples were 5.14-5.53, 4.62-4.83, 5.04-5.32 and 3.40-3.87 log10 cfu/g, respectively on day 0, and 7.01-7.9, 7.64-8.24, 7.59-8.05 and 5.69-6.27 log10 cfu/g, respectively on day 16. It was determined that PSC and CT fruits and NS seed slowed down the microbial growth rate in the meatballs from the eighth day. The best antimicrobial effect was found in psychrotrophic bacteria for CT fruit, LAB and yeast-mold for NS seed. As a result, it can be recommended to add PSC, CT fruits, and NS seeds to their composition to extend the shelf life of meatballs up to one week. The results of this study can provide helpful information for anyone dealing with food and further studies investigating the shelf life of meat and meat products.

Analysis of Borax Content in Meatballs that are Sold in The Karang Jangu Environment

Meatballs are one of the foods that are popular with various groups in Indonesia. Borax is a prohibited substance used as a food additive. Borax is commonly used in soldering, glassmaking, porcelain and wood preservatives. The use of borax in crackers aims to increase the elasticity of the meatballs. The purpose of this study was to detect the presence of borax in meatball samples.This type of research is descriptive, the method used is a qualitative method. Meatball samples were taken from meatball traders who sold them in the Karang Jangu area, Meatball samples were taken from meatball traders who sold them in the Karang Jangu area and examined using tumeric paper, tumeric paper (curcumin paper) is filter paper that is dipped in turmeric solution and dried, after that the sample that has been diluted and homogenized is dripped onto the tumeric paper. Based on the results of the study of the five meatball samples that were examined qualitatively using tumeric paper, negative results were obtained or did not contain borax, this was made clear by the absence of a color change on the tumeric paper. It is hoped that future researchers can use other methods. which can detect the presence and levels of borax in meatballs.