Meatball Samples Research Articles

The Effect of Keeping Time in Bain-Marie and Cooling Speeds on The Microbiological Quality of Meatballs Inoculated with Escherichia coli

This study aims to investigate the effect of keeping time in bain-marie and different cooling speeds on the microbiological quality of meatballs served in catering systems after contamination with Escherichia coli. For this purpose, the meatball mixture prepared was divided into two equal portions, Group A and B, and then subjected to frying, with Group B being inoculated with E. coli. After inoculation, the prepared meatballs were held at 70°C for 2 hours and cooled at different rates. The total mesophilic aerobic bacteria (TMAB) and yeast-mold counts in the meatball mixture, initially measured at levels of 5.59 log10 cfu/g and 7.91 log10 cfu/g respectively, decreased to levels of 2.92 log10 cfu/g and 3.58 log10 cfu/g after frying. After 2 hours in the bain-marie, the TMAB and yeast-mold levels in Group A meatballs were observed to be 2.42 log10 cfu/g and 2.30 log10 cfu/g, respectively. After inoculation, the TMAB, TAPB, E. coli, and yeast-mold levels in Group B meatball samples decreased continuously as a function of heating and cooling time. While the initial E. coli level was 8.13 log10 cfu/g, it decreased to 5.49 log10 cfu/g after 2 hours of heating and further decreased to 3.73 log10 cfu/g when the sample temperature reached 4°C. It was found that the microbial quality of Group B meatball samples cooled at +4°C was better than those cooled at room temperature. Meatball groups containing E. coli were found to have a higher pH value compared to those without E. coli and the pH increased further when both groups were left to cool at room temperature. The results suggest that applying rapid chilling after serving meatballs in catering systems positively affects the microbial quality of the product.

Microbiological Quality Assessment of Meatball Samples Collected from Businesses with Different Pricing Strategies

Objective: The purpose of this study was to evaluate the microbiological quality of meatball samples collected from establishments employing different pricing strategies. Materials and Methods: Samples were obtained from low-priced establishments (Business I) and high-priced establishments (Business II) and were analyzed for total aerobic mesophilic bacteria (TAMB), yeasts and molds, coliform bacteria, Staphylococcus aureus, Escherichia coli, Salmonella spp., and Listeria monocytogenes. Results: Both groups of samples complied with Turkish Food Codex standards for TAMB and S. aureus, while yeast and mold count in Business I samples exceeded the permissible limits. Salmonella spp. was detected in 3.3% of the samples from Business I and 6.6% from Business II, whereas L. monocytogenes was not detected in any of the samples. Conclusion: The study findings showed that there was no significant difference in microbiological quality between the two groups, except for yeast and mold counts. It was also concluded that there was no direct relationship between product price and hygienic quality. Keywords: Food pricing strategies, Hygienic quality, Meatball, Microbiological quality

DNA-based detection of Rat in the meatballs product using a real-time polymerase chain reaction method

The meat-based products are highly susceptible to counterfeiting, primarily due to high consumer demand of meat derivative products, such as meatballs. This demand creates opportunities for food fraud by specific industries, including adulterating meat with non-halal species, such as rats. This research aimed to detect rat meat contamination in meatball samples from the Indonesian local market using Real-time Polymerase Chain Reaction (RT-PCR). The RT-PCR amplification involved an initial denaturation step at 95°C for 3 minutes, followed by denaturation at 95°C for 15 seconds, and annealing/extension at 60°C for 1 minute. The rat-specific probe primer included in the kit produced an increasing curve in the External Positive Control (EPC) with a Ct value of 27.22, and no amplification occurred in the Negative Control (NTC). The analysis of 30 samples from meatball vendors yielded negative results, as there was no increase in the FAM (rat) curve, indicating that none of the meatballs were contaminated with rat DNA.

Effects of Carbon Dots/PVA Film Combined with Radio Frequency Treatment on Storage Quality of Fried Meatballs.

The combination of carbon dots/polyvinyl alcohol (CDs/PVA) active film and radio frequency (RF) was performed to improve the storage quality of fried meatball samples. The microbicidal effect of RF, and the antioxidant and antibacterial activities of CDs/PVA film were investigated. The CDs/PVA film can effectively restrain the growth of B. subtilis, S. aureus, and E. coli, and eliminate DPPH and ABTS free radicals. RF exerts inhibitory effects on C. albicans, B. subtilis, and E. coli. For meatball samples, CDs/PVA+RF20 can extend the refrigerated shelf life from 2 w to 6 w. At the sixth week, the total bacterial count (TBC) in CDs/PVA+RF20 group (3.72 log CFU/g) was remarkably lower than those in polyethylene terephthalate (PET) group (7.78 log CFU/g) and CDs/PVA (6.41 log CFU/g) group. CDs/PVA+RF20 can also inhibit the increase in TBARS and POV values. The results manifest the feasibility of CDs/PVA+RF as a novel mild pasteurization or preservation technology.

Detection of Borax Content with Turmeric (Curcuma Longa Linn.) in Meatball Snacks in the Pekenan Area

Meatball snacks are one of the most popular culinary delights in Indonesia, nutrition in the form of animal protein which is important for the growth and development of our bodies can be obtained from consuming meatballs, but what is worrying is that there are irresponsible sellers who are not responsible for maintaining consumer health, namely adding borax as a food additive so that meatballs last longer and are more chewy, the use of borax in food can cause health problems. The Pekenan Pasar Sore area is an area that is one of the places where meatball sellers sell their wares, therefore the author conducted a study on the detection of borax content with turmeric filtrate in meatball snacks sold in the Pekenan Pasar Sore area, with the aim of finding out whether or not there are meatball sellers in the area who add borax to the ingredients for making their meatballs. This research was conducted from June to August 2024. This type of research is qualitative. The meatball samples in this study were meatballs from meatball traders in the Pekenan Pasar Sore area, Beringin District, totaling 12 traders taken by total sampling. Organoleptic tests and detection of borax content were carried out on meatball samples with turmeric filtrate. The data were analyzed descriptively. From the results of the study, it was found that the physical characteristics of the A-L meatball sample included having a natural meat aroma, gray color, and a texture that was not too chewy. And the results of the borax test on the A-L meatball sample with turmeric filtrate produced a yellow color. So from these results it shows that the A-L meatball sample sold by meatball sellers in the Pekenan Pasar Sore area does not contain borax.

Analysis Pork Contamination in Beef Meatballs through Polymerase Chain Reaction in Palu City

The need for halal products is essential, particularly among various processed beef products like meatballs, which are popular among nearly the entire community. These products are susceptible to issues of meat counterfeiting for greater economic gain. This study aims to determine the smallest DNA concentration that can still be detected and to assess whether there is any pork contamination in meatballs circulating in Palu City using Polymerase Chain Reaction (PCR). This test uses four DNA samples obtained from fresh meat to test the specificity of the primer: wild boar, rat, and goat DNA samples as comparisons, and pig DNA as a positive control. The presence of DNA bands in the agarose gel electrophoresis visualization results indicates that DNA amplification has occurred, meaning that the sample can be detected. The analysis results showed that the primer used (Cyt-b) had good specificity for detecting pork DNA, while the absolute pork DNA concentration of 0.01 ng/µL and the reference meatball DNA with a concentration of 0.01% are the smallest limits that can still be detected using PCR. Of the four meatball samples from Palu City, one sample produced a DNA band, indicating that the sample contains or is contaminated with pig DNA. This method is valid as it meets the specificity test and demonstrates a good detection limit.

Identifikasi Bakteri Salmonella sp pada Bakso Ayam yang Dijual di Pasar Tradisional Kecamatan Denpasar Selatan

Indonesia is a country that is rich in various kinds of food products, one of which is meatballs. Meatballs are food products made from crushed meat, mixed with flour and some complementary spices, formed into rounds, and boiled. Meatballs can be found in almost all cities in Indonesia because this product is much- loved by the community, one of which can be found in traditional markets in the South Denpasar district. The market is very vulnerable and has quite a high risk of pathogenic microbial contamination. Improper processing of meatballs and low sanitation of the environment where they sell and personal hygiene of traders can increase bacterial contamination. This study aims to determine the contamination of Salmonella sp bacteria in chicken meatballs and the application of sanitation and hygiene to chicken meatballs sold in traditional markets in the South Denpasar district. This study used survey methods and sampling techniques with saturated sampling methods. The total samples used in this study were 10 samples which were tested with SSA media, gram staining, and TSIA test. The data obtained were presented in the form of tables and pictures and analyzed descriptively. The results showed that 7 samples of chicken meatballs sold in traditional markets in the South Denpasar District contained Salmonella sp. These results indicate that chicken meatballs sold at traditional markets in South Denpasar District have not met the requirements of the Food and Drug Supervisory Agency Regulation No. 13 of 2019 concerning the maximum limit of microbial contamination in processed food, Salmonella sp. in meatballs is negative/25g and some traders have not implemented good hygiene and sanitation practices.

Identification of Borax in Meatball Skewer Snacks in East Lombok

Meatballs are a processed meat-based food commonly processed by adding chemical preservatives. Many reports find the usage of borax as the chemical preservative in meatballs sold in large markets on Lombok Island. However, the use of borax in the type of meatball consumed as snacks called skewered meatballs has not been identified thoroughly in East Lombok. This study aimed to identify borax in skewered meatballs in East Lombok qualitatively by curcumin paper test and flame test colors using sodium tetraborate as standard. The result showed that 4 samples confirmed positive for borax through the curcumin paper test. Two of those four samples showed the same flame color as standard corresponding to the presence of borax as a preservative in skewered meatballs tested. These results indicate that the curcumin paper test and flame color test were compatible in identifying borax in skewered meatball samples qualitatively.

Bacteria Contaminants in Meatballs Sold in the Market Padang City Raya

Meatballs are a processed meat product that has high nutrition. The maximum shelf life for meatballs made from meat is 1 day (12 hours). Storing meat foods at inappropriate temperatures, such as room temperature, greatly facilitates the growth of microbes. The marketplace for meatballs in traditional markets in the city of Padang is still sold on the streets at open-air temperatures without using sufficient refrigeration. The possibility of contamination with microorganisms is very large. This research aims to determine the suitability and quality of meatballs sold at Pasar Raya Padang City by examining the Total Plate Count (TPC) and identifying the types of bacteria that contaminate meatballs sold at Pasar Raya Padang City. The research results showed that the amount of microbial contamination in meatballs varied, namely 1.9x10 6, 7.5x10 6, 5.6x10 6, 1.8x10 6, 8.6x10 6, and 9.2x10 6. The results of this study showed that the meatball samples had microbial contamination greater than 10 5 CFU/gr or did not meet SNI standards. Based on macroscopic and microscopic morphological identification as well as biochemical reactions, all isolates were classified as bacteria from the genus Bacillus

Are online meatball restaurants in Indonesia committed to their declared Halal label?

Background and Aim: Halal restaurants participating in online food delivery services do not require halal certification. The Halal status of products through the Halal logo provides the consumer with information on the basis of which he decides to buy. Online transactions involve potential risks related to online processes, payment methods, and product quality. The aim of this study was to determine whether a declared Halal label is in accordance with the business processes implemented. Materials and Methods: Halal authentication of Gofood's meatball partner products in Yogyakarta and Solo Raya determined the incompatibility of meatball ingredients. Sixty meatball samples were collected from Yogyakarta and 30 samples from Solo Raya. Halal certification test was carried out using the thermal cycle polymerase chain reaction method at Universitas Gadjah Mada Animal Husbandry Laboratory and the results were used to identify pork contamination in meatballs. The addition of pork or pork meatballs was used as a control. Results: Eight meatball restaurants in the Solo Raya and Yogyakarta areas were found to be contaminated with pig DNA. The results of the tracing materials and processes, i.e., the grinding stage, are critical because all samples were supposed to be made from beef. It is known from interviews that contamination with pig DNA at the milling stage was accidental. Conclusion: Restaurants that sell meatballs are committed to adhering to product labels that are 91.1% safe from pork contamination. The Halal and original beef labels were in accordance with their statements. This study highlights the concept of Halal authentication with traceability to overcome pork contamination in meat products. Keywords: halal authentication, halal supply chain, online food delivery, traceability.

Identification of Formalin in Meatball Sold at Palopo City Food stalls using Schryver Method Approach

Formalin, a solution containing 30-50% formaldehyde gas (CH2O), finds applications in various sectors such as corpse preservation, disinfection, and the production of plastics and anti-foaming agents. Despite its industrial benefits, formalin is often misused as a preservative in the food industry, particularly in perishable items like meatballs. This research employs a descriptive method to provide an overview of formaldehyde identification in meatballs. Ten meatball samples were collected from permanent stalls in Palopo City for analysis. Laboratory tests conducted qualitatively using the Test Kit method revealed negative results (-) for formalin content in all samples. No color changes were observed in the tested meatballs, indicating the absence of formalin.

Investigation of Biofilm Production and Determination of Antibiotic Resistance Profile of Staphylococcus aureus Isolated from Ground Beef and Meatballs

Staphylococcus aureus (S. aureus) is bacterium that threatens public health because it causes infections and food intoxication. For this reason, within the scope of this study, it was aimed to determine the presence of S. aureus, antibiotic resistance profiles, and biofilm formation in ground beef and meatball samples consumed in Amasya. In the study, 60 meat samples purchased from Amasya were used as material. First, conventional culture technique and PCR testing were used for the isolation of S. aureus. Secondly, antibiotic resistance profiles of the S. aureus were analyzed by disc diffusion. Finally, biofilm production of the S. aureus was analyzed phenotypically by the microtiter plate method and genotypically by PCR. Through the study, we identified 58 S. aureus isolates that were confirmed phenotypically and genotypically. Disc diffusion results showed that all S. aureus were sensitive to imipenem and piperacillin-tazobactam, but resistant to methicillin 43.10% (25/58), erythromycin 41.37 % (24/58), penicillin 58.62% (34/58), gentamicin 10.34% (6/58), chloramphenicol 17.24% (10/58), tobramycin 6.89% (4/58), and levofloxacin 1.72% (1/58). Biofilm production was determined as 58.62% (34/58) in the microtiter plate. In the PCR analysis, the icaA or icaD gene of a total of 4 (6.89%) different isolates was evaluated as positive. As a result, the presence of antibiotic-resistant S. aureus in ground beef and meatballs and the production of biofilm by the bacteria pose a potential risk. Therefore, it is important for human health to take the necessary precautions to reduce the risk of S. aureus contamination during the processing, and transportation.

Comparing application methods of reishi mushroom (Ganoderma lucidum) extract in deep-fried meatballs: impact on heterocyclic aromatic amine formation.

The present research was conducted to investigate the impact of reishi mushroom extract (RME) on the formation of heterocyclic aromatic amines (HAAs) in meatballs. Sample preparations involved applying RME using either the spreading or addition method, with varying concentrations (0%, 0.25%, 0.5%, and 1% of RME), followed by deep-frying at temperatures of 150 and 190 °C for 3 min. The types and levels of HAAs varied based on the frying temperature, method of extract application, and the extract concentration. Notably, total HAA contents increased with rising the frying temperature (P < 0.01) and varied from undetectable levels to 4.91 ng g-1 across all analyzed meatballs. The addition method was more effective than the spreading method (P < 0.01), and among the concentrations tested 0.25% RME exhibited the highest efficacy in reducing total HAAs (P < 0.05). Furthermore, the addition method inhibited lipid oxidation more efficiently compared to the surface spreading method (P < 0.05). This study demonstrated that RME had mitigating effects on HAAs depending on the concentration and frying conditions in deep-fried meatball samples. © 2024 The Author(s). Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

Effect of Olive Oil Hydrogel as a Fat Replacer in Beef Meatballs.

Meat and meat products are essential sources of dietary saturated fatty acids. However, excessive consumption of meat and meat products may be harmful to human health. The study evaluates the effect of fat replacement with hydrogels (olive oil in water emulsions gelled by gelatine) in meatballs. The effect of replacing fat with different ratios of hydrogel (control, 25 (F25), 50 (F50), 75 (F75) and 100 % (F100)) on the chemical (fatty acids and thiobarbituric acid reactive substances (TBARS)) and physical (cooking loss, diameter reduction, fat retention, water retention, colour and texture analysis) characteristics of the meatballs were analyzed. The fat content of raw meatball samples was reduced from (31.2±2.2) to (10.5±0.4) % in the sample with the highest fat substitution (F100). The energy levels of the F100 samples were almost 56 % lower than of the control group. Monounsaturated fatty acids (MUFAs) represented the dominant group in all substitution rates of the meatballs, followed by saturated fatty acids (SFAs) and finally polyunsaturated fatty acids (PUFAs). Among the raw meatball samples, the highest oxidation occurred in the F50 and F100 groups. However, it was determined that the difference between F25 and F75 and the difference between control and F75 were not statistically significant (p˃0.05). When the cooked samples were compared, the highest thiobarbituric acid (TBA) value was found in the F50 sample, followed by the F100 and F75 samples. The difference between the mean values of springiness and cohesiveness of the samples was not significant (p˃0.05). The hardness value of samples decreased significantly (p˂0.001) with >75 % fat replacement. It can be concluded that the oil replacement rate that may satisfy consumer demand without impairing the product technological and chemical quality should be <75 %. As the fat replacement ratio increases, the SFA content of cooked meatballs decreases, while the MUFA and PUFA contents increase. Considering the positive effects of reducing the intake of SFAs and increasing the intake of unsaturated fatty acids on non-communicable diseases such as cardiovascular diseases, fat replacement in meatballs is important for future developments.

Sensitivity of commercial rapid test kit to pork contamination in processed foods

Guaranteeing halal products has now become a necessity, especially for food products. This is intended to ensure that the food produced is not contaminated with non-halal ingredients, including pork. Pork contamination in processed meat foods such as meatballs is still often found. Various tests can be done to detect the presence of pork in processed foods. One of them is a rapid test using the LFIA method. This test is widely used because it is more efficient, economical, and easy to prepare samples. A rapid pork contamination test kit (XEMA) has been circulating in Indonesia. In the research, the sensitivity of this rapid test kit was tested on processed meat foods with various concentrations of pork and variations in the main ingredients. The color test shows that the simulated samples of beef meatballs without added pork are dark greyish white, as are the simulated samples with concentrations of 1% and 10%. Meanwhile, samples with concentrations of 20% and 40% have a paler color. Meanwhile, there was no significant difference in the variation in pork concentration in meatballs with the main ingredients of chicken and fish. For smell and texture, there were no significant differences in the simulated samples, both the control and samples with varying concentrations. From testing, it is known that the test kit can detect the presence of pork up to a concentration of 10% in samples, with the main ingredients being beef, chicken, or fish. These results indicate that this rapid test kit can well detect pork contamination in processed food samples.

IDENTIFICATION OF LARD ON PROCESSED PRODUCTS IN MEDAN CITY USING UV SPECTROPHOTOMETER WITH LINEAR DISCRIMINANT ANALYSIS AND PRINCIPAL COMPONENT ANALYSIS METHODS

Objective: Processed meat products are highly popular among the community. However, deceptive traders sometimes adulterate these products with pork elements, necessitating thorough inspections. The qualitative detection of lard in processed products can be analyzed using UV spectrophotometry with chemometric techniques such as Linear Discriminant Analysis and Principal Component Analysis. These methods facilitate data analysis derived from spectra and wavelengths, enabling the categorization of objects and providing high accuracy.&#x0D; Methods: This study aimed to determine whether processed products in Medan contain lard using UV spectrophotometry, Linear Discriminant Analysis, and Principal Component Analysis methods.&#x0D; Results: The highest fat yield was obtained from lard at 14.24%, while the lowest was from chicken fat at 7.00%. The maximum wavelength results for control samples were 234 nm for chicken fat, 237 nm for beef fat, and 268 nm for lard. Data processing using Linear Discriminant Analysis and Principal Component Analysis showed that the processed products of three random samples, nugget, meatball, and sausage type A and C, fell within the same quadrant as chicken fat. Meatball and sausage type B were in the same quadrant as beef fat.&#x0D; Conclusion: Based on the identification of lard in processed products in Medan City using UV spectrophotometer by LDA and PCA, all random samples of nuggets, meatballs, and sausages do not contain lard, and this method can classify chicken fat, beef fat, lard well.

The Effect Of Burning Time On The Amount Of Bacteria Staphylococcus Aureus Contamination Of Grilled Meatballs Sold In Darusssalam, Banda Aceh

This study aims to determine the effect of heating time in the combustion process on Staphylococcus aureus contamination in grilled meatballs. A total of 9 samples of meatballs obtained from 3 sellers of grilled meatballs were divided into 3 treatments, namely burning at temperatures ranging from 56˚C-59˚C for 1 minute, 3 minutes, and 5 minutes, with 3 repetitions. Determination of the number of microbes was carried out using the Total Plate Count (TPC) method. The research data were analyzed using a two-way ANOVA analysis of variance followed by Duncan's test. The results showed that the duration of burning affected the amount of Staphylococcus aureus contamination in grilled meatballs. The best combustion was shown at 5 minutes, with a microbial count of 3.6 × 101 CUF/g. The results of the analysis of variance (ANOVA) showed that there was a significant difference (P0.05) in the average value of Staphylococcus aureus microbial contamination in grilled meatballs given treatment. Based on the calculation results, it can be concluded that 5 minutes of burning time is the most effective for decontaminating the amount of Staphylococcus aureus microbial contamination in grilled meatballs.

Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication.

Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM). This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples. The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

Analisis Kandungan Borak pada Makanan di Sekitar UIN Sumatra Utara Kec. Medan Tuntungan

Students are an investment in the nation and the nation's next generation. Their growth and development will be optimal depending on providing nutrition with good and correct quality, quantity. By consuming good food and snacks, it is hoped that you can contribute adequate nutrition. Students are used to eating and snacks whose main menu is meatballs, junkfoot and modern food currently on campus and around campus. However, currently many foods and drinks contain additional ingredients such as preservatives, borax and others. Thus, it is necessary to study and research the borax content as well as qualitative analysis of the meatballs sold by traders around the UINSU Tuntungan campus. This type of research uses total sampling carried out by the UPT HEALTH LABORATORY of the North Sumatra Provincial Health Service. located on Jl. Willem Iskandar Pasar V (Jl. Balai Pom) using qualitative methods. The research results showed that from 6 samples of meatballs located around the UIN campus, it was proven that they did not contain borax. Based on the results of the analysis, it can be concluded that all meatball sellers located around the UIN Medan Tuntungan Campus have good knowledge and attitudes which are important factors in avoiding contamination by toxic substances and how to manage meatballs properly without the use of preservatives, especially borax. The meatball processing method at UIN and around UIN meets the requirements of the Minister of Health of the Republic of Indonesia 2015, Number: 722/Menkes/Per/IX/2015 regarding food, so students don't need to worry.

Borax Content of Meatballs in Market X Area Surabaya Indonesia

Borax was still utilized in the process of making food, one of which was making meatballs. Meatball traders added borax to extend the short shelf life of meat and increase the chewy texture, as well as to give the meatballs a more white color. The research objective was to analyze the borax content of meatball samples in market X Surabaya, Indonesia in 2023. Analytical observational research method, the variables studied were the physical quality of meatballs and the borax content in meatballs. The object of this research was 12 meatballs sold by all vendors in Market X Surabaya, Indonesia. The results of the organoleptic test researched obtained 4 meatball samples (34%) with good assessment criteria, most of the 7 meatball samples (58%) with sufficient assessment criteria, and 1 meatball sample (8%) with poor assessment criteria. Laboratory test results 1 meatball sample (8%) contained borax, with physical characteristics of chewy texture, pale gray color, tart taste, and fishy smell. The conclusion of this studied was that 1 out of 12 samples had physical characteristics of meatballs containing borax and borax content was related to the organoleptic test with a significant valued of p-value = 0. 032. Suggestions for traders to used alternative ingredients to replaced borax, namely carrageenan (seaweed) to improved the physical quality of meatballs in terms of texture, color, and smell.