Measles Antibody Levels Research Articles

The effect of live, attenuated measles vaccine and measles infection on measles antibody levels in serum and CSF of patients with multiple sclerosis or clinically isolated syndrome

High occurrence of measles, rubella and varicella zoster antibodies has been used as a biomarker for MS (the MRZ test). We analyzed measles antibody titres with respect to measles infection/measles vaccination status in 166 patients with MS or clinically isolated syndrome. Fifty blood donors served as controls. Measles vaccination yielded CSF measles antibodies in fewer patients (62%) than measles infection did (87%, p = 0.001) and yielded lower measles titres in both serum and CSF (p < 0.001). Controls had lower CSF measles titres than patients with measles vaccination alone (p < 0.001). Childhood vaccinations probably reduce the sensitivity of the MRZ diagnostic test for MS.

Vaccine antibodies and T- and B-cell interaction in juvenile systemic lupus erythematosus

Both systemic lupus erythematosus (SLE) and its treatment can cause immunosuppression and a decreased response to vaccination. We evaluated 30 children and adolescents with SLE, and 14 age-matched healthy subjects (control group) regarding immunophenotyping and lymphocyte apoptosis by flow cytometry, while measles and tetanus antibodies were measured by enzyme-linked immunosorbent assay (ELISA). The SLE group was divided according to disease activity into inactive SLE and active SLE. Individuals with active SLE had lower CD4+ T and natural killer (NK) cells/mm(3) than the control group. Active and inactive SLE individuals had more CD38 molecules/CD8+ T cells and more CD4+ T, CD8+ T and B cells in apoptosis (as assessed by caspase-3 expression) than the control group. Patients with active SLE had a diminished CD28 expression on both CD4+ T and on CD8+ T cells and a higher CD86 expression on B cells than the control group. Measles antibody levels in the SLE groups were similar to the control group. In contrast, tetanus antibody levels were lower in the SLE groups than in the control group. The latter also directly correlated with the CD4+ T-cell and NK-cell counts from SLE patients (regression coefficient, 2.686 and 1.782; p = 0.010 and p = 0.039, respectively). We concluded that despite being up-to-date for tetanus vaccine, SLE patients presented with a poor immune response to tetanus vaccine.

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity.

Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.

Measles Outbreak in Africa—Is There a Link to the HIV-1 Epidemic?

Measles Outbreak in Africa—Is There a Link to the HIV-1 Epidemic?

The Association of CD46, SLAM and CD209 Cellular Receptor Gene SNPs with Variations in Measles Vaccine-Induced Immune Responses: A Replication Study and Examination of Novel Polymorphisms

Background: The measles virus (MV) interacts with two known cellular receptors: CD46 and SLAM. The transmembrane receptor CD209 interacts with MV and augments dendritic cell infection. Methods: 764 subjects previously immunized with measles-mumps-rubella vaccine were genotyped for 66 candidate SNPs in the CD46, SLAM and CD209 genes as part of a larger study. Results: A previously detected association of the CD46 SNP rs2724384 with measles-specific antibodies was successfully replicated in this study. Increased representation of the minor allele G for an intronic CD46 SNP was associated with an allele dose-related decrease (978 vs. 522 mIU/ml, p = 0.0007) in antibody levels. This polymorphism rs2724384 also demonstrated associations with IL-6 (p = 0.02), IFN-α (p = 0.007) and TNF-α (p = 0.0007) responses. Two polymorphisms (coding rs164288 and intronic rs11265452) in the SLAM gene that were associated with measles antibody levels in our previous study were associated with IFN-γ Elispot (p = 0.04) and IL-10 responses (p = 0.0008), respectively, in this study. We found associations between haplotypes, AACGGAATGGAAAG (p = 0.009) and GGCCGAGAGGAGAG (p < 0.001), in the CD46 gene and TNF-α secretion. Conclusion: Understanding the functional and mechanistic consequences of these genetic polymorphisms on immune response variations could assist in directing new measles and potentially other viral vaccine design, and in better understanding measles immunogenetics.

Maternal screening and postpartum vaccination for measles infection in Japan: a cohort study

We investigated the prevalence of measles-sensitive pregnant women and the clinical usefulness of measles vaccination in postpartum women. Measles antibody levels were measured in 751 pregnant women. Forty-four women were vaccinated postpartum, and screened for antibody levels and adverse effects 1 month after vaccination. The prevalence of measles-sensitive pregnant women was 10-20%, with the highest prevalence in those under 24 years of age. Almost all (97.7%) vaccinated women acquired immunity, and did not show any adverse effects. Serum measles antibody levels should be determined in all pregnant women as a screening tool,and sensitive women should be vaccinated immediately after delivery.

Early Waning of Maternal Measles Antibody in Infants

Source: Leuridan E, Hens N, Hutse V, et al. Early waning of maternal measles antibodies in era of measles elimination; longitudinal study. BMJ. 2010; 340: C1626; doi: 10.1136/bmj.c1626Investigators from Belgium recruited healthy mother-infant pairs to examine the presence of measles IgG antibody, from week 36 of pregnancy until 12 months of age. Antibody levels from infants and their mothers who were immunized for measles but had no history of measles disease were compared with levels in infants and their mothers who had a past history of measles infection but no measles vaccination. Decay of maternal antibody in the infants over time was followed and modeled. A “threshold” level of antibody (≥300mIU/ml) was considered “protective.”Data from 207 women (ages 18–40 years) and their 210 infants were analyzed. Of these women, 120 were disease-immune and 87 had been vaccinated. At 36 weeks gestation, 8% of disease-immune women versus 26% of vaccinated women had antibody levels that did not reach the “protective” threshold level. The geometric mean titers (GMT) in disease-immune and vaccinated women differed significantly, with mean values of 2,687 mIU/ml and 779 mIU/ml, respectively. At 3 months of age, only 29% (21/73) of infants of vaccinated mothers had a “protective” level for measles antibody versus 60% (51/850) of infants from disease-immune women. By age 6 months, only 1 of 31 infants from vaccinated mothers had a “protective” level of measles antibody compared with 10 of 41 infants of disease-immune mothers. By 9 months of age, no infant in either group had a measles antibody titer ≥300mIU/ml.With the use of a linear mixed model, and accounting for a variety of interactions, time, and antibody concentrations in the mother, the median time to loss of protective levels of passive measles antibody was calculated to be 3.78 months in infants of disease-immune mothers versus 0.97 months for infants of vaccinated mothers.Because routine immunization of children against measles takes place on or after 12 months of age, the results of this study demonstrate an increasing gap of susceptibility between loss of maternal antibodies and timing of routine infant vaccination. The authors conclude that their findings reinforce the need for timely measles immunization.This study is consistent with many others1–5 that demonstrated that measles antibody passively transferred to infants from mothers immunized against measles is lower in titer and doesn’t persist as long as antibody from women who had measles disease. While this study showed the median time to loss of measles immunity was 0.97 months for infants of vaccinated women and 3.78 months for infants of mothers who were disease-immune, previous studies using plaque neutralization titers (PNT) have shown immunity to measles (PNT ≥1:8) may last seven to nine months, and rarely as long as 12 months in those infants born to disease-immune mothers. While immunity from measles disease and, probably, vaccine immunity are presumed to be life-long, passive immunity in an infant is dependent upon amount of antibody transferred and the decay of that antibody over time. In a population that has no ongoing exposure to measles disease, levels of detectable measles antibody may decline over time in both disease-immune and immunized individuals. As measles elimination progresses worldwide, mothers may transmit to their infants antibody protection that lasts only a few months.The current study reminds us that as more and more mothers become measles-immune through immunization and not through measles disease, their infants are likely to be susceptible to measles at an earlier age. Current immunization schedules, which recommend routinely immunizing children ≥12 months of age, are based on data from infants of disease-immune mothers and may need to be re-examined. Avoiding any delay in measles immunization is important to prevent resurgence of measles disease, especially among infants.Although at some point in the future the recommended age for the first dose of measles vaccine may need to be reconsidered, today the majority of recent US measles cases occur in non-vaccinated, vaccine-eligible individuals. In 2008, of the 127 reported cases, 67% were among those exempted from vaccination due to their personal beliefs. Only 17 cases occurred in children too young to be routinely vaccinated.6

Determining infants’ age for measles vaccination based on persistence of protective level of maternal measles antibody

The present study was conducted over a period of one year to find the right time for measles vaccination when maternal antibody titer in infants was decayed rendering them susceptible to wild virus infection. Blood samples were collected from the cord of new born (147), 2-5 months (47) and 5 to 7.5 months (24) of age. The mean measles IgG antibody titer detected in cord blood at birth (0 months) was 348.8 mlU/mL which steeply decreased to 155.6 mlU/mL by the age of 2-3 months. After that the fall in antibody becomes relatively slower and decreased to 101.6 mIU/mL by the age of 3-5 months and 38.8 mlU/mL by the age of 5-6 months and to 19.2 mIU/mL between the age of 6 to 7.5 months. The fall in antibody level with the advance of age was statistically significant (p < 0.001 ). Majority of the subjects (97.6%) exhibited protective level of antibody at birth. But only a little above one-quarter (25.5%) of them persisted the protective level between the age of 2-5 months and none had protective level from 5 months onwards.

Antibodies to measles in individuals with recent onset psychosis

Background Measles virus is a highly prevalent neurotropic virus capable of causing persistent infections within the central nervous system. Methods We measured IgG class antibodies to measles in 820 individuals including 138 with recent onset psychosis, 378 with persistent schizophrenia, and 304 non-psychiatric controls. Levels of antibodies among the groups were compared by bivariate and by multivariate analyses and correlated with clinical and demographic variables. Results The level of measles antibodies in individuals with a recent onset of psychosis was greater than the level of antibodies in individuals with persistent schizophrenia or individuals without a history of a psychiatric disorder ( p < .00001). The level of measles antibodies in the individuals with persistent schizophrenia was greater than the level of measles antibodies in the controls ( p < .001). Recent onset of psychosis was associated with having elevated levels of measles antibodies, defined as the 90th percentile of the levels of the controls, with an odds ratio of 8.0 (95% CI 4.6, 14.0); persistent schizophrenia was associated with having this level with an odds ratio of 2.3 (95% CI 1.4, 3.7). Within the psychiatric groups, measles antibody levels were associated with age, race, and current treatment with the antipsychotic medication, olanzapine. Conclusions The reasons for elevated levels of measles antibodies in the psychiatric groups are not known with certainty and should be studied in prospective investigations.

A 16-year old male with cortical blindness and focal motor seizures

A 16-year old male with cortical blindness and focal motor seizures

Girls may have lower levels of maternal measles antibodies and higher risk of subclinical measles infection before the age of measles vaccination

BackgroundPrevious studies have suggested that girls may have lower maternal measles antibody levels than boys. Girls might therefore be more likely to contract measles infection before the normal age of measles vaccination at 9 months of age. MethodsIn connection with a clinical trial of different measles vaccination strategies, we collected pre-measles vaccination blood samples at 4.5 months of age from two subgroups of children. Samples from these children were used to assess possible differences in maternal antibody levels for boys and girls. At 9 months of age another subgroup of children was sampled before the normal measles vaccination; these samples were used to assess the frequency of subclinical measles infection among boys and girls. ResultsWe determined measles-specific antibody levels for 812 children at 4.5 months of age and for 896 children at 9 months of age. At 4.5 months of age girls were less likely to have protective maternal antibody levels, the male–female ratio for protective antibody level being 1.23 (1.00–1.51). Among children sampled at 9 months of age, girls were more likely to have protective levels, the female–male ratio for having protective antibody levels being 1.65 (0.98–2.78) (p=0.054) and the geometric mean titre was significantly higher for girls (p=0.007). Children who lived in houses with known measles cases were more likely to have protective levels at 9 months of age even though they had not reported measles infection. Since we had excluded children with known measles infection, girls may have been more likely to have had subclinical measles infection. Combining clinical and possible subclinical measles infection, girls tended to be more likely than boys to contract measles infection before 9 months of age, the RR being 1.36 (0.97–1.90). ConclusionsGirls lost maternal measles antibodies more rapidly than boys and well before 9 months of age. They may be more likely to contract subclinical measles infection before the current age of measles vaccination.

Protecting infants against measles in England and Wales: a review

Objective:To establish the most appropriate age ranges for the use of human normal immunoglobulin and MMR vaccine as postexposure prophylaxis.Design:Review of literature and of laboratory confirmed measles cases.Setting:England and Wales...

VIRUS ANTIBODY LEVELS IN SERUM SPECIMENS FROM PATIENTS WITH OPTIC NEURITIS AND FROM MATCHED CONTROLS

Virus antibody levels in serum specimens taken in acute and convalescent phases from 77 patients with optic neuritits were tested by measles hamagglutination inhibition (HI), measles hemolysis inhibition (HLI), rubella HI, parainfluenza-1 HI, Epstein-Barr immunofluorescence (IF), and against 11 other viruses and mycoplasma pneumoniae with the complement fixation (CF) technique. The virus antibody levels were indicated to be usually very stable, and a fourfold change in virus antibody levels was demonstrated in only eight patients. The virus antibody levels were compared with specimens from two carefully selected control groups. The first control group consisted of 71 healthy persons matched in age, sex and place of residence with the patients with optic neuritis. The other control group consisted of 58 patients with various neurological diseases other than multiple sclerosis (MS) or infectious diseases of the central nervous system. The patients with optic neuritis had significantly higher measles antibody titres than the two control groups in both measles HI and measles HLI tests. Also in 33 patients with optic neuritis of unknown cause, the measles antibody levels were higher than in the control groups. On the other hand, various other antibody tests showed no statistically significant differences between patients with optic neuritis and the control group.

Plaque reduction neutralization test for measles antibodies: Description of a standardised laboratory method for use in immunogenicity studies of aerosol vaccination

Background Clinical trials of measles vaccination administered as aerosol are planned with the aim of obtaining licensure. Measles antibody levels will be measured using the plaque reduction neutralization test (PRNT) to assess antibody responses as a surrogate marker of efficacy. Methods A working group examined laboratory protocols for measles PRNT in use at three reference centres and agreed to a standardised procedure, which was subsequently validated. Results Assay validation showed quantitative results varied approximately threefold both within and between assays. The lower limit of detection was approximately 20 milliInternational Units/mL. Conclusions A standardised laboratory protocol for measles PRNT was established and validated for use in clinical trials of aerosolized measles vaccines.

Seroprevalence of Measles Antibody in the US Population, 1999–2004

Endemic measles transmission was declared eliminated in the United States in 2000. To ensure that elimination can be maintained, high population immunity must be sustained and monitored. Testing for measles antibody was included in the National Health and Nutrition Examination Survey (NHANES), a nationally representative survey, conducted during 1999-2004. A measles-specific immunoassay was used to measure the seroprevalence of measles antibody in NHANES participants 6-49 years of age. For analysis, participants were grouped by birth cohort. During 1999-2004, the rate of measles seropositivity in the population overall was 95.9% (95% confidence interval [CI], 95.1%-96.5%). The highest seroprevalence of measles antibody was in non-Hispanic blacks (98.6% [95% CI, 98.0%-99.1%]). Those born during 1967-1976 had significantly lower levels of measles antibody (92.4% [95% CI, 90.8%-93.9%]) than did the other birth cohorts. Independent predictors of measles seropositivity in the 1967-1976 birth cohort were non-Hispanic/black race/ethnicity, more than a high school education, having health insurance, and birth outside the United States. Measles seropositivity was uniformly high in the US population during 1999-2004. Nearly all population subgroups had evidence of measles seropositivity levels greater than the estimated threshold necessary to sustain measles elimination. Non-Hispanic whites and Mexican Americans born during 1967-1976 had the lowest measles seropositivity levels and represent populations that might be at increased risk for measles disease if the virus were reintroduced into the United States.

Immunogenicity of Standard‐Titer Measles Vaccine in HIV‐1–Infected and Uninfected Zambian Children: An Observational Study

Achieving the level of population immunity required for measles elimination may be difficult in regions of high human immunodeficiency virus type 1 (HIV-1) prevalence, because HIV-1-infected children may be less likely to respond to or maintain protective antibody levels after vaccination. We conducted a prospective study of the immunogenicity of standard-titer measles vaccine administered at 9 months of age to HIV-1-infected and uninfected children in Lusaka, Zambia. From May 2000 to November 2002, 696 children aged 2-8 months were enrolled. Within 6 months of vaccination, 88% of 50 HIV-1-infected children developed antibody levels of >or=120 mIU/mL, compared with 94% of 98 HIV-seronegative children and 94% of 211 HIV-seropositive but uninfected children (P=.3). By 27 months after vaccination, however, only half of the 18 HIV-1-infected children who survived and returned for follow-up maintained measles antibody levels >or=120 mIU/mL, compared with 89% of 71 uninfected children (P=.001) and in contrast with 92% of 12 HIV-1-infected children revaccinated during a supplemental measles immunization activity. Although HIV-1-infected children showed good primary antibody responses to measles vaccine, their rapid waning of antibody suggests that measles vaccination campaigns may need to be repeated more frequently in areas of high HIV-1 prevalence.

Aerosol and subcutaneous measles vaccine: Measles antibody responses 6 years after re-vaccination

There are no large-scale data on the long-term persistence of measles antibody after vaccination by the aerosol route. We therefore followed-up South African schoolchildren 6 years after their re-vaccination with Edmonston–Zagreb (EZ) and Schwarz (SW) measles vaccine given by aerosol and subcutaneous routes. Measles antibody levels and the proportion of children who were seropositive at year 6 remained significantly higher in the Edmonston–Zagreb aerosol group compared to the groups that received Schwarz or Edmonston–Zagreb vaccine subcutaneously.Measles re-vaccination by aerosol evokes a stronger and much longer lasting antibody response than injected vaccine and should thus provide more durable protection against measles.

妊婦における麻疹中和抗体価, HI抗体価, PA抗体価の相関と各測定法の発症予防レベル

When measles antibody levels among pregnant women were measured with measles hemagglutinin inhibition (HI), 31% of subjects had negative HI antibody titers. When the same blood samples were tested with measles gelatin particle agglutination (PA) and neutralizing (NT), the percentages of those with negative antibody levels were 1% and 3%. We conducted the correlation between antibody titers measured by the three types of titration. Correlation between NT and HI antibody titers higher than 1:8 and that between NT and PA antibody titers were good, but 81% of subjects whose HI antibody titer was below 1:8 and all women with HI antibody of 1:8 were found to have NT antibody titer higher than 1:4. NT antibody titer higher than 1:4 was found in 95% of women having PA antibody titer of 1:256 and in 99% of those with PA antibody titer of 1:512. Based on the relationships to measles NT antibody level, the majority of subjects with HI antibody titer higher than 1:8 or PA antibody level higher than 1:512 was reasonably assumed to be protected against clinical measles. PA seemed superior to HI in finding subjects with insufficient immunity against measles, because the former detects weak immunity more efficiently than the latter.

Has the Measles-Mumps-Rubella Vaccine Been Fully Exonerated?

Initiated by a report in 1998 by Wakefield et al1 that the onset of a syndrome of ileal-lymphoid-nodular hyperplasia and nonspecific colitis accompanied by pervasive developmental disorder had appeared shortly after receipt of measles-mumps-rubella (MMR) vaccine by 8 children, the vaccine was soon indicted as the etiology of autism spectrum disorders (ASDs). Subsequent reports elaborated on this theory, and several laboratories claimed to have detected measles virus or its genome in intestinal biopsies as well as peripheral blood mononuclear cells from such autistic children.2–4 Other reports described elevated levels of measles antibodies in children with autism.5 In this issue of Pediatrics , D’Souza et al6 present their detailed, careful laboratory studies that refute these claims and explain the errors that led to them. Within a short time after the initial report by Wakefield et al, many parents in the United Kingdom and the United States opted to refuse the MMR vaccine for their infants and children. One explanation offered by the original reporters was that simultaneous MMR vaccination might lead to an aberrant immune response resulting in persistent infection and increased permeability of an inflamed gastrointestinal tract. Such conditions permitted the transport of opiate-like peptides to the central nervous system resulting in the autism syndromes.7 These claims occurred at a time of recognition that reports … Address correspondence to Samuel L. Katz, MD, Duke University Medical Center, Division of Pediatric Infectious Disease, Box 2925, Durham NC 27710. E-mail: katz0004{at}mc.duke.edu

Prevalence of protective antibody against measles in HIV‐infected children with immune recovery after highly active antiretroviral therapy

This study was conducted to determine the prevalence of measles-protective antibody in HIV-infected children with immune recovery after highly active antiretroviral therapy (HAART). Ninety-six HIV-infected children were enrolled in the study. Their mean age was 9.7+/-2.6 years, 47% were boys, and 47% were in Centers for Disease Control and Prevention (CDC) clinical category C. All participants had been treated with HAART until they achieved a CD4 cell percentage > or =15%. Three children with a history of clinical measles infection were not included in the data analysis. Only 39 out of 93 children (42%) had a measles-protective antibody level, defined as an anti-measles immunoglobulin G (IgG) level > or =320 mIU/mL. There was no significant difference between the groups with and without protective levels of measles antibody in gender, clinical category, age at which HAART was started, duration of severe immune suppression, CD4 cell count and percentage, or plasma HIV RNA level before and after HAART. We conclude that, despite a history of measles immunization and evidence of immune reconstitution after HAART, many healthy HIV-infected children are still susceptible to measles.