Lesion Margins Research Articles

First report of rot disease in Prunus salicina var. taoxingli fruit caused by Fusarium lateritium in China.

Shengzhou nane (Prunus salicina var. taoxingli) as main cultivated plum in Zhejiang province, China, ripened in summer and was susceptible to microbial infection during the maturation stages because of high ambient temperature. In July 2022, Shengzhou nane fruits were found with symptoms of dark skin and grey-white lesions on surface, and an average incidence of approximate 16% (data obtained from investigation of ten trees in each orchard, and fifty fruits in each tree) in four orchards in Shengzhou city, Zhejiang province, China. To isolate the pathogen, four symptomatic partially rotted fruits (about 25%) from four orchards were collected. The plum tissue from the margin of lesions was excised into small blocks (4×4×3 mm). Eight blocks were disinfested with 70% ethanol for 30 seconds and 2% NaClO for 3 minutes, rinsed at least twice with distilled water, and incubated on PDA medium supplemented with 30.0 μg/mL Chloramphenicol at 25°C for 5 days in darkness until sporulation. Using single-spore isolation, four uniform isolates were obtained. The purified mycelium of isolates on PDA were milky white, the reverse on agar was dark pink. Colonies grew with a mean mycelium growth rate of 4.62 ± 0.38 mm per day on PDA. Macroconidia was shaped like a sickle and the size was 27.27 ± 3.43×4.54 ± 0.39 μm (n=50) with 2 to 3 septate. No microconidia and chlamydospores were observed. These morphological characteristics were consistent with previous descriptions of Fusarium lateritium (F. lateritium) species (Yun et al. 2013). Molecular identification was performed by sequencing nuclear ribosomal internal transcribed spacer region (ITS) gene with ITS1/ITS4 (White et al. 1990) and translation elongation factor-1α (TEF) with EF1-728F/EF1-986R (Carbone and Kohn. 1999). The representative sequences were submitted to Genbank (Accession Nos. OP315081 for the ITS and OP394153 for the TEF-1α). Blastn result indicated that ITS and TEF-1a sequences shared 99.28% and 100% similarity with two strains of F. lateritium (GenBank Accession Nos. MK311296.1 and JF740854.1). To fulfill Koch's postulates, the isolated F. lateritium (TXL-IT5) with a conidial suspension (1×106 spores per mL) was inoculated on ten fresh harvested healthy mature Shengzhou nane fruits (20 μL per fruits) after surface sterilization. The control fruits were inoculated with 20 μL distilled water. The experiment was repeated three times.Fruits were kept in a sealed plastic boxes at 25 °C with 90% relative humidity in dark. Four days after inoculation, all inoculated fruits were infected and appeared the same symptoms which were found in naturally infected fruits while those in the control group remained symptomless. The pathogen was re-isolated from symptomatic rotten fruits using above-mentioned method and was identified asF. lateritiumbased on morphological characteristics as well asITS and TEFgene sequences. In addition, this pathogen was reported to infect Dalbergia tonkinensisin north Vietnam (Nhung et al. 2018), causing shoot dieback of Acer negundo in northeast Poland (Patejuk et al. 2022), and rot of Chinese cherry during postharvest storage (Wang et al. 2020). However, to the best of our knowledge, this is the first report of F. lateritium causing rot on Shenshou nane fruits. Our findings serve as a warning for scientists and growers who should pay attention to this disease and take effective control strategies to reduce epidemics of this disease in China and other regions.

First report of Neopestalotiopsis clavispora causing leaf spot on Liquidambar formosana in China.

Liquidambar formosana Hance, a deciduous tree, is widely cultivated in China for its ornamental and afforestation value (Yin et al. 2021). In July 2019, leaf spot symptoms were observed with 20 to 30% disease incidence in Li shan forest farm (27°19'27.2″N, 115°32'51.08″E) in Ji'an city, Jiangxi province, China. Initial disease symptoms were small spots, which enlarged and circular to irregular, gray in the center, and dark brown to black circular on the lesion margin. Leaf pieces (5 × 5 mm) from the lesion borders were surfaced and sterilized in 70% ethanol for 30 s, followed by 2% NaOCl for 1 min, and then rinsed three times with sterile water (Si et al. 2022). Tissues were placed on potato dextrose agar (PDA) and incubated at 25°C. Pure cultures were obtained by monosporic isolation, and the representative isolates, FX-2, FX-5, and FX-9 were used for morphological studies and phylogenetic analyses. The colonies of three isolates on PDA grew fast, covering the entire plate with white cottony mycelia with black acervuli after 8 to 10 days. Conidia were 5-celled, clavate to fusiform, smooth, 19.6-24.2 × 6.2-8.5 μm (n = 100). The 3 median cells were dark brown to olivaceous, central cell was darker than other 2 cells, and the basal and apical cells were hyaline. All conidia developed one basal appendage (3.5-8.2 μm long; n = 100), and 2-3 apical appendages (18-31 μm long; n = 100), filiform. Morphological features were similar to Neopestalotiopsis sp. (Maharachchikumbura et al. 2014). The internal transcribed spacer (ITS) regions, β-tubulin 2 (TUB2) and translation elongation factor 1-alpha (TEF1-α) were amplified from genomic DNA for the three isolates using primers ITS1/ITS4, T1/Bt-2b, EF1-728F/EF-2 (Maharachchikumbura et al. 2014), respectively. All sequences were deposited into GenBank (ITS, ON622512- ON622514; TUB2, ON676532 - ON676534; TEF1-α, ON676529 - ON676531). A maximum likelihood and Bayesian posterior probability analyses using IQtree v. 1.6.8 and Mr. Bayes v. 3.2.6 with the concatenated sequences placed FX-2, FX-5, and FX-9 in the clade of N. clavispora. Based on the multi-locus phylogeny and morphology, three isolates were identified as N. clavispora. To confirm pathogenicity, 10 healthy 2-year-old seedlings, and 5 leaves per seedling were wounded with a sterile needle (Φ=0.5 mm) and inoculated with 200 μL conidial suspension per leaf(106 conidia/mL). Ten control plants were inoculated with ddH2O. All the inoculated leaves were covered with plastic bags and kept in a greenhouse at 26 ± 2 °C and RH 70%. All the inoculated leaves showed similar symptoms to those observed in the field, whereas control leaves were asymptomatic for 8 days. N. clavispora was reisolated from the lesions, whereas no fungus was isolated from control leaves. N. clavispora can cuase leaf diseases in a variety of hosts, including × Taxodiomeria peizhongii (Zhang et al. 2022), Macadamia integrifolia (Qiu et al. 2020), Dendrobium officinale (Cao et al. 2022). N. cocoes, N. chrysea, Pestalotiopsis neglecta and P. neolitseae were also reported to infect L. formosana (Fan et al. 2021). However, this is the first report of N. clavispora infecting L. formosana in China. This work provided crucial information for epidemiologic studies and appropriate control strategies for this newly emerging disease.

Occurrence of Postharvest Fruit Rot of Mango Caused by Fusarium pernambucanum in China.

Mango (Mangifera indica L.) is one of the most important tropical fruits in the world, thanks to its pleasant taste, aroma and high nutritional value (Ibarra et al. 2015). In June 2021, Surveys were conducted in three agricultural markets (113°36'E, 23°11'N) of the Yuancun district in Guangzhou, China. Postharvest fruit rot was observed on mango (about 25% of the fruits showed disease symptoms). Black rot symptomatic lesions were observed on the fruit surface and eventually penetrated the mesocarp of mango fruits. To isolate and identify the pathogen, fruits (n=35) were surface disinfected with 1% NaOCl (1 min), 70% ethanol (30 s) and then washed twice with sterile distilled water. Thirty small pieces (3-5 mm2) were excised from the lesion margins. The excised tissue pieces were cultured on potato dextrose agar (PDA). Pure cultures were obtained by transferring hyphal tips onto fresh PDA. Fungal isolates XTM-5 and XTM-8 were isolated from diseased fruits. All isolates grown on PDA had abundant, fluffy, whitish to yellowish aerial mycelia, and the colony reverse was pale brown. Macroconidia were falcate, slightly curved with 5-7 septa, 29.5-42.2 × 4.3-6.2 μm. Spindle-shaped mesoconidia were abundantly produced, straight to slightly curved with 3-4 septa, 20.3-24.5 × 4.6-4.8 μm. Microconidia were pyriform to obovate with 0-2 septa, 7.3-11.7 × 2.4-3.2 μm. Chlamydospores were globose or irregular, in chains and, hyaline to light brown. Based on the morphological characteristics, the fungus was tentatively identified as Fusarium pernambucanum (Santos et al. 2019). The molecular identity of the isolates was confirmed by sequencing the internal transcribed spacer (ITS), translation elongation factor 1 alpha (TEF1) and RNA polymerase subunit II gene region (RPB2) genes (White et al. 1990; O'Donnell et al. 2022). Sequences of isolate XTM-8 were deposited in GenBank (ITS: ON413679.1, TEF1:ON420221.2, RPB2: ON420222.2). A maximum-likelihood phylogenetic tree based on the concatenated sequences confirmed the isolates as F. pernambucanum (Xia et al. 2019). A pathogenicity test was conducted on mango. Six healthy fruits were inoculated with F. pernambucanum mycelial discs (5 mm in diameter) after being wounded with a needle or unwounded, six control fruits were inoculated with PDA agar. All inoculated fruits were incubated in the dark at 26°C and 95% relative humidity for 7 days post inoculation. Control fruits remained asymptomatic, whereas inoculated fruit developed symptoms on the fruit surface at the point of inoculation. The pathogenicity test was performed three times. The original isolates were confirmed morphologically and molecularly after they were reisolated from the symptomatic fruit, thus confirming Koch's postulates. F. pernambucanum is a widespread pathogen that causes diseases across a wide range of plant hosts in China, such as muskmelon fruit rot (Zhang et al. 2022); mango leaf spots (Guo et al. 2021) and plum leaf blight (Lu et al. 2022). To our knowledge, this is the first report of F. pernambucanum causing fruit rot of mango in China. As mango contamination with Fusarium mycotoxins poses a health risk for consumers, the occurrence of this disease needs to be carefully monitored to ensure effective disease management strategies are implemented in mango production.

Comparison of preoperative versus postoperative treatment dosimetry plans of single-fraction stereotactic radiosurgery for surgically resected brain metastases.

Stereotactic radiosurgery (SRS) for operative brain metastasis (BrM) is usually administered 1 to 6 weeks after resection. Preoperative versus postoperative timing of SRS delivery related to surgery remains a critical question, as a pattern of failure is the development of leptomeningeal disease (LMD) in as many as 35% of patients who undergo postoperative SRS or the occurrence of radiation necrosis. As they await level I clinical data from ongoing trials, the authors aimed to bridge the gap by comparing postoperative with simulated preoperative single-fraction SRS dosimetry plans for patients with surgically resected BrM. The authors queried their institutional database to retrospectively identify patients who underwent postoperative Gamma Knife SRS (GKSRS) after resection of BrM between January 2014 and January 2021. Exclusion criteria were prior radiation delivered to the lesion, age < 18 years, and prior diagnosis of LMD. Once identified, a simulated preoperative SRS plan was designed to treat the unresected BrM and compared with the standard postoperative treatment delivered to the resection cavity per Radiation Therapy Oncology Group (RTOG) 90-05 guidelines. Numerous comparisons between preoperative and postoperative GKSRS treatment parameters were then made using paired statistical analyses. The authors' cohort included 45 patients with a median age of 59 years who were treated with GKSRS after resection of a BrM. Primary cancer origins included colorectal cancer (27%), non-small cell lung cancer (22%), breast cancer (11%), melanoma (11%), and others (29%). The mean tumor and cavity volumes were 15.06 cm3 and 12.61 cm3, respectively. In a paired comparison, there was no significant difference in the planned treatment volumes between the two groups. When the authors compared the volume of surrounding brain that received 12 Gy or more (V12Gy), an important predictor of radiation necrosis, 64% of patient plans in the postoperative SRS group (29/45, p = 0.008) recorded greater V12 volumes. Preoperative plans were more conformal (p < 0.001) and exhibited sharper dose drop-off at the lesion margins (p = 0.0018) when compared with postoperative plans. Comparison of simulated preoperative and delivered postoperative SRS plans administered to the BrM or resection cavity suggested that preoperative SRS allows for more highly conformal lesional coverage and sharper dose drop-off compared with postoperative plans. Furthermore, V12Gy was lower in the presurgical GKSRS plans, which may account for the decreased incidence of radiation necrosis seen in prior retrospective studies.

First Report of Root Rot caused by Coniella fragariae on Paeoniae radix Rubra in China.

Paeoniae radix Rubra is a traditional Chinese herbal medicine, which has the effect of clearing heat and cooling blood, activating blood and removing stasis. It has become popular in the Chinese market in recent years due to its extremely high medicinal value and showy flower color. In May 2021, typical symptoms of root rot were observed in a field (35°7'12″ N, 103°58'48″ E) in Dingxi, Gansu province, China. Approximately 10% of the plants in the field had typical root rot symptoms, and the root of each affected plant is at least 5% severe. The roots of the naturally infected plants in the field discolored and decayed with black brown spots on the surface of the root bark, the root bark detached from the phloem，and some leaves were chlorosis, shrunken and smaller, and the branches were dead and underdeveloped. In the transverse section, the xylem was black diffusion and abnormal odor. Three diseased plants with typical symptoms were chosen at random and brought back to the lab. Small pieces cut from the margins of lesions were surface disinfested with 75% ethanol for 15 s, and 0.5% NaClO solution for 30 s, rinsed three times in sterile distilled water, dried on sterile filter paper, plaed onto potato dextrose agar (PDA), and incubated at 25 ± 1℃ for 7 days in the dark. The pure cultures were obtained by single-spore isolation. All isolates produced wavy on the surface, radial from the inside out, initially white or milky white to orange colonies with abundant black brown oily conidiomata pycnidia on PDA at 25 ± 1℃ after 15 days in the dark. The conidiomata pycnidia is spherical to irregularly spherical, 231.5 to 512.4 μm, initially transparent with age turning brown, with a dark brown internal conidial mass inside, and with a 13.1 to 45.4 μ m wide ostiole central. Young conidia (n=100) developed from conidiogenous cells, which were simple, tapering, hyaline, smooth, and 12.3 to 18.0 × 2.5 to 4.6 μm, 1.0 to 1.5 µm wide at apex. Mature conidia (n=100) were ellipsoid, apices tapering, subobtusely rounded, brown, and 6.5 to 11.0 × 4.1 to 7.5 µm. The morphological characteristics of the isolates were consistent with previous descriptions of the genus Coniella (Crous et al., 2014). A representation isolate CS-1 was deposited in the Institute of Plant Protection, Gansu Academy of Agricultural Sciences and used for further studies. To confirm the identity of the causal fungus, the internal transcribed spacer (ITS), 28S large subunit of nuclear ribosomal RNA (LSU) and partial translation elongation factor 1-alpha (TEF1-α) gene of the representative isolate CS-1 were amplified and sequenced using primers ITS1/ITS4 (White et al., 1990), LROR/LR7 (Chethan et al., 2017) and EF1-728F/EF1-986R (Carbone and Kohn, 1999), respectively, and deposited on GenBank with accession numbers OP824764 (ITS), OP824767 (LSU)/span>and OP903926 (TEF1-α). Blastn analysis of all sequences resulted in E-value of 0.0 (ITS and LSU) and nearly 0.0 (TEF1-α), with Query cover values of 90% to 99% identity with C. fragariae, confirming the hypothesis based on morphological features examination. To conduct a pathogenicity test, three root segments of healthy plants were wounded using sterilized needles and inoculated by pipetting 10 μL of conidial suspension (1×107 conidia/mL) onto each wound, and controls were inoculated with 10 μL sterile distilled water. These root segments were kept in a moist chamber at 25°C in the dark. The experiment was repeated three times. After 14 days, root rot symptoms were observed on all of the inoculated root segments and identical to those observed in the field, whereas control root segments did not develop symptoms. The pathogen was re-isolated from the lesions of inoculated root segments, fulfilling Koch's postulates. To the best of our knowledge, this is the first report of C. fragariae causing root rot on P. radix Rubra in China. This identification can aid in the selection of appropriate management measures for this disease.

Firstreportflat peach fruit rotcausedbyFusariumfujikuroi in China.

Flat peach (Prunus persica L. Batsch. var. compressa Bean) is a distinctive peach variety with flat shape. It is well known for its high nutritional value and pleasant flavor, and has become the primary cultivar in Shengzhou city, Zhejiang province, China. In July 2021, we discovered that 8%-10% of flat peach (data gained from a survey of fifteen trees in each orchard) fruits in three orchards (about 2.6 ha) had a fungal disease in Jinting Town, Shengzhou. The infected fruit by this pathogen showed soft, brown, and sunken lesions, accompanied by a sour odor and white mycelia. For pathogen isolation, ten infected fruits were surface sterilized (75% ethanol for 30 s and 2.0% NaClO for 3 min), then rinsed with sterile distilled water three times. The tissues from the margin of lesions were cut into 0.6×0.6 cm pieces and transferred to potato dextrose agar (PDA) medium containing 30.0 μg/mL chloramphenicol. The plates were incubated at 25 °C for 5 days in the dark. Mycelia growing from tissues were subcultured onto fresh PDA medium to get a pure isolate, which formed dense white hyphae after 4 days. The average growth rate of mycelium on PDA medium was 3.4 ± 0.2 mm/d, and the colonies were pale purple after 5 days. Macroconidia was slender, slightly curved, almost 2 to 3 septa, with a bend and tapering apical cell and poorly developed foot cell, and the size was 4.5 to 16.9 × 1.8 to 4.0 μm (n= 50) μm. No microconidia and chlamydospores were observed. This isolate's morphological and cultural characteristics were close toFusarium fujikuroi(Leslie and Summerell. 2006). To further get the phylogenetic evidence, the nuclear ribosomal internal transcribed spacer region (ITS) and translation elongation factor-1 (TEF-1α) genes of three representative isolations were amplified by primers ITS1 (F:5'-GGAAGTAAAAGTCGTAACAAGG-3') /ITS4 (R5'-TCCTCCGCTTATTGATATGC-3') (Groenewald et al. 2013), and EF1-728F (5'-TACAARTGYGGTGGTATYGACA-3')/ EF1-986R (5'-ACNGACTTGACYTCAGTRGT-3') (Carbone and Kohn. 1999), respectively. The amplified sequences were submitted to Genbank with accession numbers OP223318 for the IST and OP394152 for the ETF-1α region. Blastn results indicated that the ITS and TEF-1α sequences from the isolated strain shared 96.25% and 98.32% similarity with two strains of F.fujikuroi (GenBank Accession No. MF281286.2, and MK311296.1). The isolates were clustered with F.fujikuroi clade (Supplementary Fig.1 and Supplementary Fig.2), consistent with the morphological identification. To evaluate Koch's postulates, 20μL of spore suspension (1×106 spores/mL) were inoculated into ten healthy flat peach fruits with sterile syringes, while another ten healthy fruits were injected with sterilized water as controls. All fruits were kept in sealed plastic boxes at 25 °C with 90% relative humidity. All inoculated fruits showed symptoms similar to those of naturally infected fruits, while uninoculated fruits remained healthy after 4 days. In addition, F. fujikuroi was an important pathogen causing bakanae disease in rice (Hou et al. 2017). This pathogen was also reported to cause Lilium lacifolium Thunb bulb rot (Fang et al. 2022) and cause root rot in peanuts in China (Sun et al. 2022). However, to the best of our knowledge, this is the first record of F. fujikuroi causing fruit rot in flat peach in China. The discovery will provide helpful information about flat peach rot disease management.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 μm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 μm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and β-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

First report of Neopestalotiopsis clavispora causing leaf spot on Photinia bodinieri in China.

Photinia bodinieri Lévl. is an evergreen broadleaf species widely cultivated in subtropical China as an ornamental value (Zhang et al. 2018). In July 2021, leaf spot symptoms were observed on the campus of Jiangxi Agricultural University (28°45'56″N, 115°50'21″E), Jiangxi province, China. The spots were circular to irregular, gray in the center, and dark brown on the lesion margin. The disease incidence was estimated 15%. Leaf pieces (5 × 5 mm) from the lesion borders were surface-sterilized in 70% ethanol for 30 s, followed by 2% NaOCl for 1 min, and then rinsed three times with sterile water. Tissues were placed on potato dextrose agar (PDA) and incubated at 25°C in the dark. Pure cultures were obtained by monosporic isolation, and the representative isolates, SN-3, SN-7, and SN-11 were used for morphological studies and phylogenetic analyses. The colonies of three isolates grown on PDA were white, cottony, and exhibited flocculent, contained undulate edges with dense aerial mycelium on the surface. Conidia were 5-celled, clavate to fusiform, smooth, 18.2-24.3 × 5.5-8.4 μm (n = 100). The 3 median cells were dark brown to olivaceous, central cell was darker than other 2 cells, and the basal and apical cells were hyaline. Conidia developed filiform appendages; one basal appendage (3.3-8.2 μm long; n = 100), and 2-3 apical appendages (16-29 μm long; n = 100). Morphological features were similar to Neopestalotiopsis sp. (Maharachchikumbura et al. 2014). Portions of internal transcribed spacer (ITS) regions, β-tubulin 2 (TUB2) and translation elongation factor 1-alpha (TEF1-α) genes were amplified from genomic DNA for the three isolates using primers ITS1/ITS4, T1/Bt-2b, EF1-728F/EF-2 (Maharachchikumbura et al. 2014), respectively. All sequences were deposited into GenBank (ITS, OQ572345 - OQ572347; TUB2, OQ597847 - OQ597849; TEF1-α, OQ597844 - OQ597846). A maximum likelihood and Bayesian posterior probability analyses using IQtree v. 1.6.8 and Mr. Bayes v. 3.2.6 with the concatenated sequences placed SN-3, SN-7, and SN-11 in the clade of N. clavispora. Based on the multi-locus phylogeny and morphology, three isolates were identified as N. clavispora. Pathogenicity of the three isolates was verified on nine disease-free 7-year-old Photinia bodinieri plants, which were grown in the field. Two healthy leaves per plant were wounded with two pricks using a sterile needle (Φ=0.5 mm) and inoculated with 20 μL conidial suspension per leaf (106 conidia/mL). Another nine control plants were inoculated with sterile water. 36 leaves were used for the pathogenicity test of three isolates. All leaves were covered with plastic bags to maintain a humid environment for 2 days. The inoculated leaves showed similar symptoms to those observed in the field, whereas control leaves were asymptomatic after 10 days. The fungi were consistently reisolated only from the inoculated and symptomatic leaves, fulfilling Koch's postulates. N. clavispora can cause leaf diseases in a variety of hosts, including Kadsura coccinea (Xie et al. 2018), Photinia serratifolia (Yang et al. 2018), Camellia chrysantha (Zhao et al. 2020). Photinia spp. is an excellent landscape gardening plant, threatened with grey blight (Pestalotiopsis microspore) (Ye et al. 2022), anthracnose (Colletotrichum sp.) (Guan et al. 2013). However, this is the first report of N. clavispora infecting Photinia bodinieri in China. This work provided crucial information for epidemiologic studies and appropriate control strategies for this newly emerging disease.

First Report of Colletotrichum gloeosporioides Causing Anthracnose on Wisteria sinensis in China.

Wisteria (Wisteria sinensis) is a well-known ornamental plant for environmental protection in the garden, which also has a high value for medicinal use. In December 2021, leaf spots were observed on W. sinensis plants growing on the campus of Jiangxi Agricultural University in Nanchang, Jiangxi Province (28.45° N, 115.49° E), with a incidence rate of 40% plants were infested (n = 100 investigated plants). Initially leaf spots were small and pale brown (Approx. 2 mm in diameter), which gradually expanded into round or irregular dark brown spots as disease progressed, and lesions developed greyish-white necrotic tissues in the center at later stages, eventually causing the leaves to rot. To isolate the pathogen, tissues (5 × 5 mm) at the margin of lesions were cut from ten symptomatic leaves, surface disinfected with 75% ethanol for 30 s followed by 2% sodium chloride (NaClO) for 1 min, rinsed three times with sterile distilled water, and the dried tissues were cultured on potato dextrose agar (PDA) at 28 ± 1℃ in darkness for 3 days. After culture purification, five isolates were obtained and the representative single spore isolate (ZTTJ1) was used for subsequent identification tests. After 10 days of incubation on PDA medium, colonies had dense aerial mycelium with a gray center and dark gray-green mycelium outward, with orange-red conidial masses distributed in a ring on the surface. The underside of the colonies was light gray to dark gray. Conidia were cylindrical, with ends obtuse-rounded, 11.83 to 20.74 × 3.34 to 5.33 μm (av=16.11 μm × 4.26 μm, n = 50) in size. These morphological characteristics were consistent with Colletotrichum gloeosporioides (Shi et al, 2019). Six conserved regions of isolate (ZTTJ1), internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), calmodulin (CAL), β-tublin (TUB), actin (ACT), and chitin synthase 1 (CHS1) gene regions were amplified using ITS1/ITS4 (Gardes et al, 1993), GDF/GDR (Templeton et al, 1992), CL1C/CL2C (Li et al, 2018), Bt2a/Bt2b (Prihastuti et al, 2009), ACT-512F/ACT-783R and CHS-79F/CHS-345R (Carbone et al, 1999) primers, respectively. Using BLAST, ITS, GAPDH, CAL, TUB, ACT, and CHS1 gene sequences (GenBank Accession No. OP703312, OP713773, OP713775, OP713776, OP713772, OP713774, respectively) were over 99% identical to C. gloeosporioides (GenBank Accession No. MK967281, MH594288, MT449307, MN624110, MN107239 and MN908602, respectively). A maximum likelihood (ML) phylogenetic analysis based on ITS-ACT-GAPDH-CHS1-CAL-TUB2 sequences using MEGA7.0, placed isolate (ZTTJ1) within C. gloeosporioides. To complete Koch's postulates, 10 μL spore suspension (1.0 × 106 conidia/mL) of ZTTJ1 (7-day-old culture on PDA medium) was dropped onto 10 leaves wounded with a sterilized needle and 10 non-wounded leaves, respectively. Ten wounded leaves were inoculated with sterile water as controls. All leaves were incubated at 28 ± 1 °C and 90 % relative humidity (12 h/12 h light/dark). After 7 days, all wounded leaves inoculated with C. gloeosporioides developed symptoms as previously observed, while the control and non-wounded leaves remained healthy. The fungus re-isolated from the inoculated leaves were identified as C. gloeosporioides by morphological and molecular identification; the pathogen causing disease in W. sinensis was determined to be C. gloeosporioides. To our knowledge, this is the first report of C. gloeosporioides causing anthracnose on W. sinensis in China. This work has identified the pathogenic species of the disease, which helps to take targeted measures to control its spread, providing a basis for the prevention and treatment of the disease.

Added value of zoomed-echo-planar imaging diffusion-weighted imaging for evaluation of periampullary carcinomas.

To assess the image quality feasibility and diagnostic value of zoomed diffusion-weighted imaging (z-EPI DWI) using echo-planar imaging (EPI) compared with conventional DWI (c-EPI DWI) in patients with periampullary disease. Thirty-six patients with periampullary carcinomas and fifteen with benign periampullary disease were included in this study. All the subjects underwent MR cholangiopancreatography (MRCP), c-EPI DWI, and z-EPI DWI. Two radiologists independently assessed image quality of the two image sets, including overall image quality and lesion conspicuity. In addition, signal intensity and ADC measurements of DWIs in the periampullary lesions were conducted. Diagnostic accuracies of the combined image sets of MRCP and z-EPI DWI were compared with those of a combined set of MRCP and c-EPI DWI. z-EPI DWI showed significantly better image quality scores (anatomic structure visualization, 2.94 ± 0.24; overall image quality, 2.96 ± 0.17) compared to that with c-EPI DWI (anatomic structure visualization, 2.02 ± 0.22; overall image quality, 2.04 ± 0.24) (both P < 0.01). For all the periampullary malignant lesions and small lesions (≤20 mm), there was better delineation of lesion conspicuity and the lesion margin, as well as diagnostic confidence with z-EPI DWI (all P<0.05). The rate of periampullary malignancy's hyperintense signal on z-EPI DWI was increased to 91.7% (33/36) compared to c-EPI DWI (69.4% (25/36)) (P = 0.023). For all malignant lesions and small lesions, the diagnostic accuracy scores were increased using the MRCP and z-EPI DWI combined set, compared to the MRCP and c-EPI DWI combined set (P<0.05). Diagnostic accuracy for detection and differentiation of malignant lesions from benign lesions significantly improved for the MRCP and z-EPI DWI combined set compared with MRCP and c-EPI DWI combined set (P<0.05). There were no significant differences between c-EPI DWI and z-EPI DWI in the ADC values of periampullary malignant and benign lesions (P>0.05). z-EPI DWI has an advantage that could lead to remarkable image quality improvements and enhanced lesion visualization of periampullary carcinomas. z-EPI DWI was superior to c-EPI DWI for detecting, delineating, and diagnosing the lesions, particularly for small challenging lesions.

First report of Fusarium proliferatum causing leaf spot on tea plants in Jiangxi Province, China.

Tea (Camellia sinensis (L.) O. Kuntze), a perennial evergreen shrub, is one of the most important cash crops in China. In September 2021, leaf spot symptoms were observed on approximately 30% of tea plants in a 2 ha commercial field of Lushan (29°33'0" N, 115°58'48" E), Jiangxi Province, China. The symptoms initially appeared as small, gray lesions, and later became larger (10-15 mm in diameter) circular to irregular spots with light brown centers and gray borders. To isolate the pathogen, small pieces (3×3 mm) cut from the margins of lesions were sterilized with 75% ethanol for 10 s, 0.1% HgCl2 for 20 s, and then rinsed three times with sterile water. The pieces were placed onto acidified potato dextrose agar (APDA) plates, and incubated in darkness at 28℃. Pure cultures were prepared by subculturing hyphal tips. A total of 16 fungal isolates were obtained, and the colonies of 15 isolates (isolation rate 93.8%) looked identical, resembling those of the genus Fusarium. The colonies were white to pink with purple woolly mycelium. After 10 to 15 days incubation, slightly curved macroconidia with three to four septa measuring 14.0 to 34.5 × 2.0 to 3.5 µm (n = 50), and oval, unicellar microconidia measuring 4.0 to 9.0 × 1.5 to 3.5 µm (n = 50) were observed. These morphological characteristics were similar to that described for Fusarium proliferatum (Leslie and Summerell 2006). Genomic DNA of representative isolates (LSZWY, LSZWY2, LSZWY3) was extracted with the Ezup Column Fungi Genomic DNA Purification Kit (Sangon Biotech Co., Ltd, Shanghai). The translation elongation factor 1 alpha gene (EF-1ɑ) was amplified using primers EF-1H / EF-2T (O'Donnell, et al. 2015). PCR product was sequenced and the sequence was 709 bp (Accession No. OL614004, ON357634, ON595710). BLAST search results showed that it had 99.9% identity with the EF-1ɑ gene sequence of F. proliferatum (MH341215, MT371378). To test pathogenicity, nine leaves from 5-year-old healthy tea plants (Ca. Luyun 3) were wounded using a sterilized needle and inoculated with a 20µl conidial suspension (2 × 107 conidia·mL-1) on one side of the plants and the other side with sterilized distilled water as a control. All leaves were incubated in a growth chamber at 28℃ and 80% relative humidity with a 12 h light/dark photoperiod. Seven days later, all inoculated treatments showed symptoms identical to those observed in the field, while the control remained asymptomatic. The experiment was repeated three times with similar results. Koch's postulates were fulfilled by successful re-isolation and morphological and molecular identification of F. proliferatum from the inoculated leaves. This pathogen can cause diseases of many crops, e.g. tobacco, Polygonatum cyrtonema and others (Li, et al 2017; Zhou, et al. 2021). However, this is the first report of F. proliferatum causing leaf spot on tea plants in China. This new disease poses a threat to the yield and quality of tea and methods need to be developed for its control and to prevent further spread.

First report ofNigrospora musaecausing white leaf spot ofBasella alba L in China.

Basella alba L, an edible annual twining herb of the genus Basella and the family Basella, has been widely introduced and cultivated in China. Basella alba L. as a leaf vegetable, is rich in vitamins A and C, iron, and calcium (FAO 1988). In May 2022, severe white leaf spots were observed in plantation located in Shuangfeng County (27°41'36" N, 111°56'60" E), Hunan Province, China. More than 50 Basella alba L plants were surveyed with over 80% disease incidence in an area of 300 square meters of greenhouse. The symptoms on leaves were initially small purplish-brown lesions from leaf margins or tips, with lesions expanded, the middle of the lesions was yellowish-white to yellowish-brown, slightly dented. The edge of lesions was purplish-brown, with obvious boundary between the diseased parts and the non-diseased ones. A total of 20 symptomatic samples were randomly collected. Lesion margins were surface sterilized in 2% sodium hypochlorite for 1 min, rinsed with sterile distilled water for three times, dried, placed on potato dextrose agar (PDA), and incubated at 25°C and 60% relative humidity in the dark for 3 days. Hyphal sections from colony edges were transferred to new PDA plates. Six isolates were obtained. Colonies were fast-growing, massive sparse aerial hyphae, initially white, turning gray and black after 7 days. Hyphae were branched, septa, and transparent. To induce sporulation, colonies were transferred to sodium carboxymethyl cellulose (CMC) plates (Z. M. Wen., & X. Y. Luo 1991). Conidia were single-celled, dark black, oblate, or nearly spherical, and measured 10.2 to 15.1 μm × 9.7 to 16.0 μm in diameter (n=50). For molecular identification, the rDNA internal transcribed spacer (ITS), the β-tubulin gene (TUB), and the translation elongation factor 1-alpha gene (TEF1) were amplified from genomic DNA by primers ITS1/ITS4 (White et al. 1990), Bt2a/Bt2b (Glass & Donaldson. 1995), and EF1-728F/EF1-986R (Carbone & Kohn, 1999). The sequences of six isolates (L1, L2, L7, L10, L11, L12) were deposited in GenBank with accession numbers OP703335, OP703336, OP703337, OP703338, OP703339, OP703340 (ITS), OP784252, OP784157, OP784253, OP784254, OP784255, OP784256 (TEF-1α), and OP724156, OP724158, OP779771, OP779772, OP779773, OP779774 (TUB2). A blast search of sequences showed the ITS, TEF-1α, and TUB2 sequences had >98% identity with homologue sequences from Nigrospora musae isolates BRJ2 (OP451019.1), CBS 319.34 (KY019419.1) and LC6385 (KY019567.1), respectively. These morphological features and molecular identification indicated that the pathogen possessed identical characteristics as Nigrospora musae (Wang, 2017). Pathogenicity test was carried out in plants. Strains were cultured on CMC plates for 14 days, then the mycelium was scraped to make conidial suspension (1×106 conidia/mL). After 5-6 leaves of the Basella alba L were sprouted, conidial suspension was sprayed directly on the leaves, with leaves sprayed by sterile distilled water as the control. All plants were kept in the greenhouse with temperature at 25/30°C (night/day) and 75% relative humidity. After 7 days, symptoms were observed on inoculated leaves of plants, which were the same as previously described samples, while the control plants showed no symptoms. The test was repeated three times with similar results. The strains reisolated from the inoculated leaves were morphologically identical to Nigrospora musae, conforming to Koch's postulates. symptoms of Nigrospora musae is similar to that of the other leaf diseases of Basella alba L reported in China. (H. P. Jiang.2000; S. Tan.1996). To our knowledge, this is the first report of Nigrospora musae causing white leaf spot of Basella alba L in China. The pathogen may severely threat the production of Basella alba L. The information on identification of this fungus may be helpful to the control and prevention of the disease.

First report of leaf spot on pecan caused by Choanephora cucurbitarum in China.

Pecan (Carya illinoinensis K. Koch) is an important and widely planted nut tree species in Jiangsu Province, China (Mo et al. 2018). In July 2020, leaf spot symptoms were frequently observed on pecan in Jurong, Jiangsu Province (119°15'36"E, 32°1'6"N). Disease incidences ranged from 40 to 65% among 150 mature pecan trees from three nurseries. The disease severity index (DSI, Jiang et al. 2019) reached 58.4. Symptoms began as small brown spots scattered on leaves that gradually expanded to large, circular to irregular black and brown necrotic lesions. In severe cases, lesions developed on large portions of a single leaf, and eventually the dead leaves fell from the trees. Three monoconidial isolates (Chen2346, Chen2347, Chen2348) were isolated from lesion margins and cultured on potato dextrose agar (PDA) medium. Colonies on PDA were white and cottony, later becoming light gray with abundant reproductive structures. Sporangiophores were aseptate, hyaline, unbranched, and apically dilated to form a clavate vesicle, which produced sporangia. Sporangia were globular to ellipsoid, brown to dark brown, 103 to 128 µm in length, and 88 to 114 µm in width (n = 30). Sporangiola were brown, ellipsoid to ovoid, with longitudinal striae, and measured 13.9 to 18.8 × 7.9 to 10.8 μm (n = 60). The morphological characteristics of these isolates agreed with descriptions of Choanephora cucurbitarum (Kirk 1984). Genomic DNA of these three monoconidial isolates was extracted, and the partial sequences of the internal transcribed spacer (ITS) and large subunit (LSU) of rDNA were amplified using primer pairs ITS1/ITS4 (White et al. 1990) and LR0R/LR7 (Vilgalys and Hester 1990), respectively. The consensus sequences (GenBank accession nos.: OP315248 to OP315250 for ITS and OP315251 to OP315253 for LSU) were aligned using BLASTn and showed100% identity with the sequences from C. cucurbitarum found in GenBank (accession nos.: MF942131 for ITS and ON025788 for LSU). To further confirm the identity, a phylogenetic analysis was performed with MEGA (v.7.0) and MrBayes (v.3.1.2) software, using the maximum likelihood and Bayesian inference methods, respectively. The multigene phylogeny revealed that the three isolates in this study, as well as, C. cucurbitarum specimen, clustered as a strongly supported monophyletic group (99 bootstrap value; 0.95 posterior probabilities). Based on the morphological and molecular data, the isolates were identified as C. cucurbitarum. To confirm pathogenicity, healthy pecan seedlings (2 years old) were each inoculated with a mycelial block (3 × 3 mm) excised from the margin of a colony on the vein of each leaf. Seedlings treated with non-colonized PDA blocks were used as controls. The inoculated seedlings were maintained in sterile plastic boxes with moistened sheets of filter paper at 25 ± 1°C and a 12-h photoperiod. Fifteen leaves per isolate were tested for each treatment. The experiment was repeated twice. Three days after inoculation, symptoms similar to those in the field appeared, whereas the control leaves remained symptomless. Subsequently, C. cucurbitarum was reisolated from the lesions and morphologically identified, confirming Koch's postulates. To the best of our knowledge, this is the first report of C. cucurbitarum causing leaf spot on C. illinoinensis in China. This study provides the foundation to further investigate the biology, epidemiology, and management of this disease.

Lesion area progression in eyes with neovascular age-related macular degeneration treated using a proactive or a reactive regimen.

To compare the change in lesion area over 4 years of follow-up in eyes with neovascular age-related macular degeneration (nAMD) treated with anti-vascular endothelial growth factor (VEGF) agents using either a proactive or a reactive regimen in routine clinical practice. This was a multicentre, retrospective comparative study. Totally, 202 treatment-naïve nAMD eyes (183 patients) received anti-VEGF therapy according to a proactive (n = 105) or reactive (n = 97) regimen. Eyes were included if they had received anti-VEGF injections for a period of at least 4 years and had baseline fluorescein angiography and annual optical coherence tomography (OCT) imaging. Two masked graders independently delineated the lesion's margins from serial OCT images and growth rates were calculated. At baseline, the mean [SD] lesion area was 7.24 [5.6] mm2 in the proactive group and 6.33 [4.8] mm2 in the reactive group respectively (p = 0.22). After four years of treatment, the mean [SD] lesion area in the proactive group was 5.16 [4.5] mm2 showing a significant reduction compared to the baseline (p < 0.001). By contrast, the mean [SD] lesion area kept expanding in the reactive group during the follow-up and was 9.24 [6.0] mm2 at four years (p < 0.001). The lesion area at 4 years was significantly influenced by treatment regimen, baseline lesion area, and proportion of visits with active lesions. Eyes treated using a reactive strategy had an increased lesion area and worse visual outcomes at 4 years. By contrast, the proactive regimen was associated with fewer recurrences of active disease, shrinkage of the lesion area, and better vision at four years.

First Report of Stagonosporopsis caricae Causing Chayote Leaf Spot in Guizhou Province, China.

At present, chayote (Sechium edule (Jacq.) Swartz) have been widely planted in Guizhou Province, southwestern China, and the cultivation area in Huishui county ranks first among all the counties or cities in Guizhou Province. Chayote leaf spot was firstly observed in Huishui County (25.99°N, 106.64°E) from April to June in 2019. The disease incidence ranged from 52% to 58%, and the severity of leaf symptoms ranged from 34 to 41% across nine chayote plantations. Such levels disease development lead to considerable enocomic losses. Leaf lesions initially occurred at the leaf margins, and the lesions expanded gradually, becoming dark brown and irregularly shaped. To identify the leaf spot-associated pathogen, the samples were cut from lesion margins, sterilized with 75% ethanol followed by 0.5% sodium hypochlorite for 30 s, rinsed with sterile water three times, and transferred onto potato dextrose agar (PDA). They were then incubated at 25°C in darkness for 5 days. The hyphal tips from the margins of growing colonies were successively transferred to fresh PDA plates for obtaining isolates. All strains grew with a similar morphology on PDA, malt extract agar (MEA), and oatmeal agar (OA) plates, and the colonies presented smooth margins and abundant mycelia on all three media. The colonies were gray to light green on PDA and gray on MEA and OA at 5 days post-inoculation. At 11 days post-inoculation on 10% V8 medium at 25oC with a cycle of 14 h/ultraviolet light and 10 h/night, sexual morph was observed, ascomata pseudothecioid, subglobose, 121 × 142 μm, ostiolate, walls of brown textura angularis, and smooth. Asci were bitunicate, cylindrical to clavate, 7 × 90 μm, 8-spored, ascospores elliptical, straight to slightly curved, 5 × 17 μm, 1-septate, constricted at the septum, sub-hyaline, and smooth. Conidiomata were pycnidial, subglobose, 166 × 258 μm, ostiolate, wall of dark brown to black textura angularis, smooth. Conidia were short, cylindrical or slightly reniform, 6.18 ± 0.67 × 3.51 ± 0.33 μm (n = 50), 0-1 septate, hyaline, smooth. Chlamydospores were subhyaline to dark brown, verruculose or incidentally tuberculate, and solitary or in chains, and 14.16 ± 1.23 × 5.92 ± 0.49 μm (n = 50). The morphological characteristics of the strains were identical to those of Stagonosporopsis caricae (Aveskamp et al. 2010; Sivanesan 1990). The genes or DNA sequences of the partial 28S large subunit rDNA, the internal transcribed spacer, RNA polymerase II second largest subunit, and beta-tubulin were amplified (Liu et al. 1999; Rehner and Samuels 1994; Sung et al. 2007; Vilgalys and Hester, 1990; White et al. 1990; Woudenberg et al. 2009). The sequences were further deposited in GenBank (ITS: MZ619042-MZ619044, LSU: MZ620651-MZ620653, RPB2: MZ673652-MZ673654, and TUB: MZ673649-MZ673651). A phylogenetic analysis confirmed these strains to be identical to S. caricae reference strains CBS 248.90, CBS 282.76, and PD 06/03082531. Pathogenicity tests were performed on potted chayote and five-year-old chayote in the field. Mycelial plugs (6 mm diameter) were applied on wounded chayote leaves. Brown spots appeared on the wounded sites of chayote leaves after inoculation with mycelial plugs. No symptoms were observed on the leaves inoculated with PDA plugs lacking mycelia. The re-isolated pathogen from diseased plants was identical to the representative strains used for inoculation. To our knowledge, this is the first report of S. caricae causing leaf spot on chayote in China, and our findings will be useful for its management and further research.

Utility of Ultrasonography for Diagnosing and Differentiating Periapical Granuloma from Radicular Cyst

This study aimed to investigate the reliability and accuracy of high-resolution ultrasonography (US) for diagnosing periapical lesions and differentiating radicular cysts from granulomas. This study included 109 teeth with periapical lesions of endodontic origin from 109 patients scheduled for apical microsurgery. Ultrasonic outcomes were analyzed and categorized after thorough clinical and radiographic examinations using US. B-mode US images reflected the echotexture, echogenicity, and lesion margin, while color Doppler US assessed the presence and features of blood flow of interested areas. Pathological tissue samples were obtained during apical microsurgery and subjected to histopathological examination. Fleiss' κ was used to measure interobserver reliability. Statistical analyses were performed to assess the diagnostic validity and the overall agreement between US and histological findings. The reliability of US compared to histopathological examinations was assessed based on Cohen's κ. The percent accuracy of US for diagnosing cysts, granulomas, and cysts with infection based on histopathological findings was 89.9%, 89.0%, and 97.2%, respectively. The sensitivity of US diagnoses was 95.1% for cysts, 84.1% for granulomas, and 80.0% for cysts with infection. The specificity of US diagnoses was 86.8% for cysts, 95.7% for granulomas, and 98.1% for cysts with infection. The reliability for US compared to histopathological examinations was good (κ=0.779). The echotexture characteristics of lesions in US images correlated with their histopathological features. US can provide accurate information on the nature of periapical lesions based on the echotexture of their contents and the presence of vascularity. It can help improve clinical diagnosis and avoid overtreatment of patients with apical periodontitis.

Identification of Fusarium sacchari Causing Foliar Blight on Begonia semperflorens in China.

Begonia semperflorens Link et Otto (Begoniaceae) is a flowering, ornamental plant widely cultivated in China. In April of 2020, a foliar blight disease on B. semperflorens was observed in plant nurseries (∼0.2 ha), with ~ 20% disease incidence (n = 150) in Nanning, Guangxi Province, China. Initial symptoms included irregular to circular, grayish white spots surrounded by a dark brown halo, mainly scattered on the edges the leaves. In severe infections, the spots frequently coalesced to form large, blighted areas, followed by defoliation. To isolate the pathogen, three representative plants exhibiting symptoms were collected from the nurseries. Leaf tissues (5 × 5 mm) were cut from the margin of necrotic lesions (n = 18), surface disinfected in 1% NaOCl for 2 min, then rinsed three times in sterile H2O. Then the tissues were plated on potato dextrose agar (PDA), and incubated at 28°C (12 h photoperiod) for 3 days. Hyphal tips from recently germinated spores were transferred to PDA to purify fungal isolates. A total of 11 isolates (85% isolation frequency) with similar morphological characteristics were obtained. Colonies on PDA plates were villose, had a dense growth of white aerial mycelia and appeared pale but becoming violet with age. On Spezieller Nährstoffarmer Agar (SNA), the macroconidia were slender, slight falcate, two to three septate, and 23.5 to 48.8 × 2.8 to 4.8 μm (n = 60), and the microconidia were abundant and formed in false heads on monophialides or polyphialides, slim, oval, zero to one septate, and 7.8 to 22.4 × 2.4 to 4.0 μm (n = 60). For molecular identification, the internal transcribed spacer (ITS) region of rDNA, and partial translation elongation factor-1 alpha (TEF-1α), and RNA polymerase second largest subunit (RPB2) genes of the representative isolate HT-2B were amplified and sequenced using primer pairs ITS1/ITS4 (White et al. 1990), EF-1/EF-2 (O'Donnell et al. 1998), and 5f2/11ar (Liu et al. 1999, Reeb et al. 2004), respectively. The obtained sequences were deposited in NCBI GenBank under the accession numbers OQ048268 (TIS), OP994260 (TEF-1α), OP994262 (RPB2) and showed 99.4%, 99.8%, and 99.4% similarity with the corresponding sequences (X94168，AF160278，and JX171580, respectively) of Fusarium sacchari from type material. In addition, a phylogenetic analysis showed that HT-2B was grouped with F. sacchari. Therefore, based on morphological (Leslie et al. 2005) and molecular characteristics, the isolates were identified as F. sacchari. To test pathogenicity, three healthy leaves on each of three B. semperflorens plants were stab-wounded with a sterile syringe and inoculated with a 10-μl droplet of a conidial suspension (106 spores/ml) of the isolate HT-2B. As a control, another three leaves were wound inoculated with sterilized dH2O. All plants were enclosed in transparent plastic bags and incubated in a greenhouse at 28°C (12 h photoperiod, ~ 80% relative humidity). Six days post-inoculation, symptoms appeared on the inoculated leaves. No symptoms were detected on control plants. Experiments were replicated three times with similar results. To fulfill Koch's postulates, the F. sacchari isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of F. sacchari causing foliar blight on B. semperflorens in China. This result will help develop management strategies for this disease.

Assessment of encoder-decoder-based segmentation models for thyroid ultrasound images.

Encoder-decoder-based semantic segmentation models classify image pixels into the corresponding class, such as the ROI (region of interest) or background. In the present study, simple / dilated convolution / series / directed acyclic graph (DAG)-based encoder-decoder semantic segmentation models have been implemented, i.e., SegNet (VGG16), SegNet (VGG19), U-Net, mobileNetv2, ResNet18, ResNet50, Xception and Inception networks for the segment TTUS(Thyroid Tumor Ultrasound) images. Transfer learning has been used to train these segmentation networks using original and despeckled TTUS images. The performance of the networks has been calculated using mIoU and mDC metrics. Based on the exhaustive experiments, it has been observed that ResNet50-based segmentation model obtained the best results objectively with values 0.87 for mIoU, 0.94 for mDC, and also according to radiologist opinion on shape, margin, and echogenicity characteristics of segmented lesions. It is noted that the segmentation model, namely ResNet50, provides better segmentation based on objective and subjective assessment. It may be used in the healthcare system to identify thyroid nodules accurately in real time.

A Case of Full-thickness Macular Hole Formation Secondary to Laser Retinopexy

Purpose: To report a case of full-thickness macular hole (FTMH) formation secondary to demarcation laser retinopexy in a retinal break with localized retinal detachment patient.Case summary: A 59-year-old male visited our clinic with ocular discomfort in both eyes. Uncorrected visual acuity (UCVA) was 0.63 in right eye. Large retinal break in 1:30 o/c, localized retinal detachment and laser marking scars all around the right eye were found in fundoscopic exam. Posterior-vitreous detachment or vitreomacular traction was not observed in optical coherence tomography (OCT). Demarcation laser retinopexy was performed around the margin of retinal detachment and peripheral degenerative lesions. Three months after demarcation laser retinopexy, UCVA in right eye of the patient was decreased to 0.16 and full thickness macular hole was observed on OCT examination. Pars planar vitrectomy, internal limiting membrane peeling, and SF6 gas tamponade were performed in the right eye. One month after the surgery, closure of FTMH was observed. Three months after surgery, there were no recurrence of FTMH in the right eye.Conclusions: Demarcation laser photocoagulation of localized retinal detachments may predispose to FTMH formation. Even though it can be occurred rarely, follow-up check-up is necessary in consideration of the possibility of FTMH, which can cause serious visual loss.

GUIDED PUNCTURE AS ANCILLARY TOOL FOR THE DIAGNOSSIS OF MAXILLOFACIAL LYMPHATIC MALFORMATION

Ultrasound-guided puncture is an exam that allows delineation of the lesion margins and extent for better diagnosis and treatment proposal. A 15-year-old boy presented with a painless swelling with 12 months of evolution and progressive enlargement. He reported no history of trauma or recent upper respiratory tract infections, but reported a history of pimple in the region stricken by lesion. On physical examination, a nodular lesion was observed in the right submandibular region, soft in consistency, lobular with ill-defined margins, painless, and freely mobile. An ultrasound-guided aspiration puncture was performed. The punctured material was submitted to the Liquid-based cytology and a diagnosis of lymphatic malformation was made. Ultrasound-guided puncture is an exam that allows delineation of the lesion margins and extent for better diagnosis and treatment proposal. A 15-year-old boy presented with a painless swelling with 12 months of evolution and progressive enlargement. He reported no history of trauma or recent upper respiratory tract infections, but reported a history of pimple in the region stricken by lesion. On physical examination, a nodular lesion was observed in the right submandibular region, soft in consistency, lobular with ill-defined margins, painless, and freely mobile. An ultrasound-guided aspiration puncture was performed. The punctured material was submitted to the Liquid-based cytology and a diagnosis of lymphatic malformation was made.