Management Challenges Research Articles

Product management challenges and innovations in baby food: The Nigerian and US Market

This review examines the landscape of baby food product management, highlighting the diverse nutritional needs, innovative practices, and regulatory challenges encountered by companies operating in Nigeria and the United States (US). As essential stakeholders in infant health, baby food manufacturers must navigate a complex terrain shaped by cultural preferences, economic factors, and governmental regulations to meet the nutritional requirements of infants and young children. In both Nigeria and the US, the nutritional needs of infants are paramount, with an increasing emphasis on providing balanced diets that support optimal growth and development. However, the specific dietary requirements may vary between regions due to cultural dietary practices, regional agricultural availability, and socio-economic factors. Understanding and catering to these nuanced nutritional needs is critical for companies to establish trust and credibility among consumers. Moreover, innovations in baby food product management play a crucial role in addressing evolving consumer demands and preferences. From organic and natural ingredients to convenient packaging solutions, companies are continuously striving to enhance the nutritional quality and convenience of baby food products. These innovations not only reflect shifting consumer trends but also serve as a competitive differentiator in a crowded market. Nevertheless, navigating the regulatory landscape presents significant challenges for baby food companies operating in Nigeria and the US. Regulatory frameworks governing product safety, labeling requirements, and advertising standards are subject to frequent updates and modifications, requiring companies to maintain agility and compliance. Additionally, cultural perceptions surrounding infant feeding practices may influence regulatory approaches, further complicating market entry and expansion strategies. This review underscores the importance of understanding and addressing the unique nutritional needs, embracing innovative practices, and navigating regulatory challenges in the management of baby food products in Nigeria and the US. By adopting a comprehensive approach that considers both market-specific factors and global best practices, companies can effectively navigate these diverse markets and contribute to the health and well-being of infants and young children.

Aerial-terrestrial data fusion for fine-grained detection of urban clues

Those who work in the design, development, and management of cities are often limited by the scarcity of data. Particularly in the Global South, urban databases may be insufficient, out of date, or simply not available. However, digital technology is making it possible to fill gaps and build substantial datasets using “urban clues,” or attributes, gathered in high-resolution imagery by sky- and street-based cameras. Aided by machine learning, it is possible to detect specific building characteristics (purpose, condition, size, material, and construction)—yielding an array of geolocated details about the built environment. The resulting composite view can be made available, as we have done, in an open-source portal for use in urban management. The insights gained in this way may help address common urban management challenges, such as locating homes vulnerable to hazards such as flooding or earthquakes, identifying urban sprawl and informal housing, prioritizing infrastructure investments, and guiding public program support. This approach has been applied in Colombia, Guatemala, Indonesia, Mexico, Paraguay, Peru, St Lucia, and St Maarten.

Evaluation and Development of Building Material Sales Information System to Improve Inventory Management and Customer Service

This research investigates the Evaluation and Development of Building Material Sales Information Systems (BMIS) to Enhance Inventory Management and Customer Service within the construction industry. Through a qualitative analysis approach, the study explores the challenges faced by building material suppliers, identifies the requirements for effective BMIS, and evaluates the impacts of BMIS implementation on inventory management practices and customer service. Data were collected through interviews, focus group discussions, and case studies with stakeholders representing diverse perspectives within the construction supply chain. The findings highlight the critical role of BMIS in addressing inventory management challenges, improving order accuracy, and enhancing communication with customers. The study contributes to the development of practical recommendations for building material suppliers seeking to optimize their operations and deliver superior service experiences to their clientele.

AI-driven resource management strategies for cloud computing systems, services, and applications

Cloud computing is a way for businesses and individuals to It has changed and revolutionized the way we access and use resources. However, efficient resource management in cloud computing systems remains a major challenge due to the scalability, heterogeneity, and dynamic nature of these environments. To address these challenges, artificial intelligence (AI) technology has emerged as an effective solution to improve resource management efficiency. This paper provides an overview of AI-based strategies for efficient resource management in cloud computing systems, services, and applications. This paper first reviews resource management challenges in cloud computing, including scalability, heterogeneity, quality of service requirements, and cost optimization. Below is an overview of the various AI techniques used for resource management. B. Algorithms for machine learning, reinforcement learning, predictive analytics, natural language processing, and genetic algorithms. Next, this paper considers specific AI-based strategies for efficient resource management. These strategies include automated resource provisioning and scaling, intelligent workload planning and task allocation, predictive maintenance and fault detection, and energy-efficient resource management. We also present case studies and applications of AI-driven resource management in various cloud computing scenarios, including large-scale cloud providers, edge computing, serverless computing, and container environments. This paper describes evaluation metrics and performance analysis techniques to evaluate the effectiveness of AI-based resource management approaches. It highlights the importance of ethical considerations, transparency, and explainability in AI-powered resource management systems. Additionally, the integration of AI technologies into existing resource management frameworks is discussed, and future directions are identified, including B. real-time resource optimization and coordination.

Digitalized Voting System using Blockchain Technology

This paper introduces a novel Digitalized Voting System designed to address the shortcomings of current voting methods employed in India. With a focus on enhancing transparency and trust in the electoral process, the system aims to overcome challenges present in both traditional and digital voting systems, including instances of mishaps and injustice. Leveraging blockchain technology, the proposed system seeks to ensure fair elections and minimise occurrences of injustice. While electronic voting has been introduced as a solution to paper-based voting, it has encountered obstacles primarily related to security and privacy concerns. To address these issues, our framework emphasises the effectiveness of various components such as the polling process, hashing algorithms, contract and block creation, data accumulation, and result declaration.Utilising an adjustable blockchain method, the system aims to provide a robust solution to the security and data management challenges inherent in blockchain technology. By incorporating elements such as blockchain, hashing algorithms, block creation, OTP verification, and Ethereum, our approach endeavours to digitalize the voting process comprehensively. This paper contributes to the advancement of electoral integrity by presenting an improved manifestation of electronic voting, paving the way for more transparent and secure elections

CHALLENGES IN THE ADOPTION OF A TRACEABILITY SYSTEM IN THE HALAL FOOD SUPPLY CHAIN IN MALAYSIA

Halal and food safety are important issues nowadays. The issue regarding product recalls is not new and still happens, which involves halal and food safety matters. Other than that, the industries also lack awareness, knowledge, and the cost of implementing the traceability system on food premises. Thus, this study aimed to conduct an in-depth analysis of the challenges faced by industry player in adopting the traceability system in the halal food supply chain. The study adopts the qualitative method, where the data was collected through a semi-structured interview with representatives of the supply chain company. The gathered data were analysed using thematic analysis to understand the challenges faced in adopting the traceability system throughout the supply chain. The finding indicated that a traceability system is adopted to assure that information related to halal food and products is available and can be traced along the supply chain. It includes the information pre-production process, such as the sources and origins of the raw materials. As regards halal supply chain management challenges that food establishments faced in implementing halal traceability, its covered aspects of a technical system, logistics, segregation at shop shelves, distribution and retail records, and product recall. It is recommended that the food establishment develop and get acquainted with traceability technology tools as it is more effective and efficient in tracking and tracing the product.

A prospective observational study of gastrointestinal perforations following blunt trauma abdomen

Background: Blunt trauma abdomen often presents late leading to increased morbidity and mortality, therefore the challenges in management of such patients warrant a study in this area for early diagnosis and better outcomes. Methods: A prospective observational study was carried out at a government institute in Central India. All patients having blunt trauma abdomen with GI perforations were observed over 2 years wherein clinical presentation, time of presentation, diagnostic methods and the outcomes were the parameters studied. Results: Young men (21-30 yrs) were found to be the commonly injured group. Road traffic accidents were the most common cause of blunt trauma abdomen. We found that mechanism of injury is related to the outcome and high energy transfer injuries (76%) led to high morbidity and mortality. Abdominal pain with abdominal tenderness and guarding was the most common presentation. Chest X-ray showed free gas under diaphragm in 58%patients who underwent xray. Other modalities used were FAST (focussed abdominal scan for trauma) scan which showed hemoperitoneum. CT scan had 97% sensitivity in diagnosis. Jejunum was the most common site of perforation. Simple closure of perforation with peritoneal lavage was the most commonly performed operative procedure. Overall, 35 patients developed complications in the postoperative period, wound infection being the most common. Mortality in this study was 26%. Conclusions: Young men are the most commonly injured in road traffic accidents with jejunum being the commonest organ injured. High velocity trauma, late presentation, multi- organ injury worsens the prognosis hence early diagnosis becomes imperative for better outcome.

Pediatric Congenital Anterior Skull Base Encephaloceles and Surgical Management: A Comparative Review of 22 Patients Treated With Transnasally, Transcranially, or Combined Approach With a Review of the Literature.

Anterior basal encephaloceles are considered a rare entity and are often associated with midline cerebral abnormalities. Those with a large skull base defect and herniation of brain parenchyma in the neonate or young infant present unique challenges for surgical management. We analyzed the neurosurgical administrative and operative databases between 1986 and 2022 to determine clinical presentation, operative approach, and outcome of basal encephaloceles. Over the 36-year period, 27 pediatric anterior basal encephaloceles were managed, of which 22 had full documentation and images allowing comprehensive review. Mean age at presentation was 5 years (SD 4.94). The majority were transethmoidal encephaloceles (59%), followed by the transsphenoidal-sphenoethmoidal type (32%). Overall, 91% were managed surgically by a transcranial, endoscopic, or combined approach. Four children required subsequent procedures, predominantly for persistent cerebrospinal fluid leak. No significant differences in proportion of patients requiring interval/revision surgery after initial conservative, endoscopic endonasal, or transcranial surgery was identified. Neither age at surgery nor size of the defect on computed tomography scan was associated with the need for revision surgery. Size of cranial defect was significantly smaller in the endoscopic group (P = .01). There was a historic tendency for younger children with larger defects to have a transcranial approach. With the addition of endoscopic skull base expertise, smaller defects in older children were more recently treated endoscopically. Basal encephaloceles are rare and complex lesions and are optimally managed within a skull base multidisciplinary team able to provide multiple approaches. Large skull base defects with brain parenchymal involvement often require a transcranial or combined transcranial-endoscopic approach.

Mangiferin, A Naturally Occurring Glucosylxanthone, Induces Apoptosis in Caco-2 Cells In Vitro and Exerts Protective Effects on Acetic Acid-Induced Ulcerative Colitis in Mice through the Regulation of NLRP3.

Inflammatory bowel diseases (IBD), an inflammatory disease, include Crohn's disease and ulcerative colitis. Dysregulated autoimmune response to gut dysbiosis is mainly involved in the pathogenesis of IBD and is triggered by various inciting environmental factors. With its rising prevalence in every continent, IBD has evolved into a global disease, which is on the rise, affecting people of all ages. There is a growing incidence of IBD in the elderly population, as evidenced by epidemiological data. IBD is characterized by an inflammatory process that requires a lifelong treatment. The main challenge in IBD management is the adverse side effects associated with almost all of the currently available drugs. Hence, there is a search for drugs with more efficacy and fewer side effects. Natural products with great structural diversity and ease of modification chemically are being explored, as they were shown to control IBD by safely suppressing pro-inflammatory pathways. The present study aims at understanding the role of mangiferin, a COX-2 inhibitor isolated from tubers of Pueraria tuberosa in the treatment of IBD and colon cancer, in vitro on the Caco-2 human colon cancer cell line and in vivo in the acetic acid-induced IBD mouse model. In the acetic acid-induced colitis model, it prevented the decrease in length of the colon, mucosal erosion, and cellular infiltration in a dose-dependent manner. The expression levels of various pro-inflammatory markers like COX-2, IL1β, TNF-α, INF-γ, IL-6, NLRP3, and caspase-1 were downregulated in an acetic acid-induced mouse model on treatment with mangiferin in a dose dependent manner. Mangiferin also showed anticancer effects on Caco-2 cells by increasing the expression of Fas ligand, Fas receptor, FADD, caspase-8, and caspase-3 proteins, whereas Bid and Bcl-2 proteins showed decreased expression. These data suggest that mangiferin, an inhibitor of COX, induces apoptosis in colon cancer cells in vitro and protects mice from acetic acid-induced colitis in vivo.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

A Review and Thermal Conductivity Experimental Program of Mattress Waste Material as Insulation in Building and Construction Systems

The building and construction industry consumes a significant amount of natural resources alongside contributing to the generation of waste materials. Addressing the dual challenge of waste management and recycling in this sector is imperative. This study begins with a bibliometric assessment to identify waste materials used as insulation in building and construction systems. The assessment of 2627 publications revealed mattress waste materials were seldom considered. The aim of this research focuses on exploring alternative methods for repurposing mattress materials in construction, aiming to mitigate waste generation. While various materials are being recycled for building applications, this research emphasises the potential of incorporating recycled polyurethane foam (PUF) from mattresses as insulation products. A transient plane source (TPS) was employed to determine the thermal conductivity of waste mattress PUF obtained from a recycling plant in Victoria, Australia. The results exhibited promising thermal resistance, with a mean value of 0.053 Wm/K. However, optimal thermal performance was observed with increased thickness, suggesting that a thickness of 215mm aligns with industry standards for building fabric systems. Further research is required to comprehensively analyse moisture resistance and fire retardation of waste mattress materials. This paper presents key findings of current trends, limitations, and future research directions to the use of waste mattress PUF as an insulation material.

Leveraging Emerging Technologies for Enhanced Airport Ground Movement Management Efficiency and Reliability

The Executive summary serves to give the highlights of the research paper and an overview of the objectives, methods used, key findings and implications. It is a brief rundown of the whole research document and provides time-pressed readers with some insights onto the study without having to go into deeper details. Introduction: This research paper examines how blockchain, edge computing and autonomous systems can be integrated inside airports in order to enhance performance and reliability of airport ground movement management. There is need for innovative approaches towards optimizing ground movement in highly complex airports to ensure that they operate seamlessly in a growing air traffic scenario. Objectives: The main aim of this study is to explore how blockchain, edge computing and autonomous systems could change airport ground movement management entirely. These technologies will be exploited for improving data sharing, enhancing real-time processing capabilities as well as enabling automatic decision support services on the ground operations. Methodology: In this case a mixed method approach has been used which involves qualitative and quantitative analysis. Qualitative methods like surveys and questionnaires are done so as researchers get insights from different stakeholders, Integrating various stakeholders, including airlines, airports, and regulators, regarding their perspectives on integrating new technologies into ground movement management!!! Quantitative methods involve data analysis to assess the effectiveness and efficiency of proposed technological solutions. Additionally, simulations and case studies are conducted to evaluate the impact of these technologies on ground movement optimization. Key Findings: The research yields promising results, indicating significant improvements in routing efficiency, reduced taxiing times, and increased operational reliability. The integration of blockchain facilitates secure data sharing, while edge computing enables real-time processing, leading to faster decision-making in ground movement management! Autonomous systems contribute to optimizing resource routing and allocation decisions, further enhancing operational efficiency. Implications and Recommendations: The findings of the research carry both theoretical and practical implications. Theoretical implications include advancing knowledge in the field of airport ground movement management by exploring the potential of emerging technologies. On a practical level, the research provides valuable insights for airport stakeholders seeking to modernize their ground movement control systems?? Recommendations include addressing the complexity of integrating multiple emerging technologies and overcoming challenges related to data security and system interoperability. Conclusion: In conclusion, the research underscores the significance of integrating blockchain, edge computing, and autonomous systems into airport traffic management to enhance efficiency and reliability!!! By addressing key challenges in ground movement management, the study paves the way for more streamlined and resilient airport operations, ultimately benefiting the aviation industry as a whole.

The soft underbelly of complexity science adoption in policymaking: towards addressing frequently overlooked non-technical challenges

AbstractThe deepening integration of social-technical systems creates immensely complex environments, creating increasingly uncertain and unpredictable circumstances. Given this context, policymakers have been encouraged to draw on complexity science-informed approaches in policymaking to help grapple with and manage the mounting complexity of the world. For nearly eighty years, complexity-informed approaches have been promising to change how our complex systems are understood and managed, ultimately assisting in better policymaking. Despite the potential of complexity science, in practice, its use often remains limited to a few specialised domains and has not become part and parcel of the mainstream policy debate. To understand why this might be the case, we question why complexity science remains nascent and not integrated into the core of policymaking. Specifically, we ask what the non-technical challenges and barriers are preventing the adoption of complexity science into policymaking. To address this question, we conducted an extensive literature review. We collected the scattered fragments of text that discussed the non-technical challenges related to the use of complexity science in policymaking and stitched these fragments into a structured framework by synthesising our findings. Our framework consists of three thematic groupings of the non-technical challenges: (a) management, cost, and adoption challenges; (b) limited trust, communication, and acceptance; and (c) ethical barriers. For each broad challenge identified, we propose a mitigation strategy to facilitate the adoption of complexity science into policymaking. We conclude with a call for action to integrate complexity science into policymaking further.

Evaluation of Supply Chain Management Challenges of multinational companies in West Africa under the ECOWAS Trade Liberalization Scheme (ETLS)

This paper examined the Supply Chain Management challenges of multinational companies in West Africa under the ECOWAS trade liberalization scheme. The objective of the study includes to identify the various ECOWAS's regional integration protocols, Assess the level of implementation of ETLS among members state and evaluation of the various negative factors affecting full implementation of ETL, among others. The methodologies adopted includes Qualitative and quantitative method of data collection including literature review, expert interview, survey and case studies over a sample of 150 multinational companies (MNC). The results reveal that Complex and Non-Transparent Regulations exists among the MNC in the West African region, existence of Inadequate Infrastructure and Logistics, Non-Harmonized Trade Facilitation Measures as well as weak institutional co-ordination and enforcements. The study concludes that ETLS presents both opportunities and challenges for MNCs operating in West Africa and recommends among others the Simplification and Harmonization of Trade Regulations, investment in infrastructures and logistics as well as strengthening of institutional co-ordinations and enforcements.

Hydrological response to land use/land cover changes in Ethiopian basins: a review

Hydrological response to land use/land cover changes in Ethiopian basins: a review

Need for structured conservation inputs: a geospatial approach for habitat prioritization to restrict disturbance regime in the protected areas of the Western Himalayan region

AbstractThe population boom increases land-use requirements, and shrinking regions are available to preserve natural biodiversity. Unfortunately, scientific knowledge does not seem to have and might never get a correct solution to how much territory will be sufficient for satisfying the various biodiversity conservation goals. Prioritization of habitat, primarily for threatened species, is a critical management challenge. Habitat management efforts are gradually being performed over broader geographic regions, emphasizing the necessity of spatial and strategic prioritization. Habitat prioritization is a technique popular for identifying critical areas needing conservation initiatives. To develop a strategic conservation framework, key issues must be identified based on the ground knowledge and present land use status, which are difficult to gather for highly rough terrain areas. Incorporating spatial data sets thus helps to get the desired knowledge of the site on a large scale. This study used a grid-based multicriteria approach to create a spatial conservation management framework for the Rajaji-Corbett landscape (RCL) in Northern India. A grid-based prioritization assessment was conducted to identify priority areas for the RCL, keeping invasive species and fire as significant threats. The indicators or criteria were selected by looking at present vital concerns in the landscape. We took 20 indicators for our multicriteria assessment for landscape prioritization of RCL using 2 × 2 km grids for the evaluation and classified them according to low, medium, and high priority areas using Arc GIS Pro. The results identified 931 sq. km area of this landscape needs immediate management interventions where frequent fire incidents and presence of invasive species are high. RCL is well known for its biodiversity wealth and assemblage of various wildlife populations.

Factors Influencing Treatment Success in Cholesteatoma Management: A Cross-Sectional Study.

Background/Objectives: Cholesteatoma presents significant management challenges in otolaryngology. This study aimed to delineate the influence of demographic and clinical characteristics, preoperative imaging, and surgical approaches on treatment success in cholesteatoma management. Methods: A cross-sectional analytical study was conducted at the Otolaryngology Department of the University Hospital from January 2021 to December 2022. It included 68 patients diagnosed with cholesteatoma, focusing on three objectives: assessing the impact of demographic and clinical characteristics on treatment outcomes, evaluating the predictive value of preoperative imaging findings, and analyzing the influence of surgical factors. Results: The study population predominantly consisted of male (56%) and Saudi (81%) patients, with an average age of 45 years. Logistic regression revealed that older age (OR: 1.05), male gender (OR: 0.63), and non-Saudi Arab ethnicity (OR: 2.14) significantly impacted treatment outcomes. Clinical characteristics such as severe disease severity (OR: 3.00) and longer symptom duration (OR: 0.96) also influenced treatment success. In preoperative imaging, labyrinthine fistula (Regression Coefficient: 0.63) and epidural extension (Coefficient: 0.55) emerged as key predictors. The surgical factors that significantly affected the outcomes included the extent of surgery (Complete Removal OR: 3.32) and the use of endoscopic approaches (OR: 1.42). Conclusions: This study highlights that patient demographics, clinical profiles, specific preoperative imaging features, and surgical strategies multifactorially determine cholesteatoma treatment success. These findings suggest the necessity for a tailored approach in cholesteatoma management, reinforcing the importance of individualized treatment plans based on comprehensive preoperative assessments.

The Impact of Russia-Ukraine War on Bangladesh’s Economy: A Supply Chain Perspective and Way Forward

Bangladesh’s economy is facing significant challenges restricting from the Russia-Ukraine conflict, intensified by its status as an oil-importing nation vulnerable to global oil price fluctuations. This study addresses the current perspectives and challenges which include inflationary pressures, trade imbalances, and disruptions in the supply chain, leading to increased expenditures for essential commodities. This research was developed through a systematic literature review based on secondary data, including online databases, journals, and review papers, etc. This exploratory study reveals that policymakers need to diversify energy sources, forge new trade partnerships, and implement measures to bolster economic resilience. The economic fallout from the conflict, surpassing the actual war in cost, has depleted the central bank's reserves, prompting austerity measures. The forex market experiences volatility, contributing to high trade deficits and the highest inflation rate in recent years. Bangladesh must address forex management challenges and formulate prudent policies for economic recovery. The conflict has disrupted global commodity markets, leading to inflationary pressures and increased costs for businesses in Bangladesh, especially larger organizations handling rising raw material costs and weak consumer demand. The rationale of this paper is to evaluate the literature on this aspect and apprehend the global demand, and supply of food and commodities, economic impacts in Bangladesh, challenges in global trade, trade relations, currency fluctuations, inflation, emergency price, and its consequences, recognize gaps and advocate future research itineraries. The paper offers a synopsis and appraisal of the overall economy of Bangladesh and finally navigates a way forward to the policymakers which would unlock further research to develop this sector.

Possible Challenges and Recommendations for Risk Managers in Financial Institutions

The article analyses the importance and potential challenges of risk management in financial institutions, highlights the difficulties financial institutions face in identifying, assessing and mitigating the various risks within their organisations, and makes a number of recommendations to The article analyses the importance and potential challenges of risk management in financial institutions, highlights the difficulties financial institutions face in identifying, assessing and mitigating the various risks within their organisations, and makes a number of recommendations to address these issues.This paper explores these challenges, which include spillover effects, cybersecurity issues, efficiency trade-offs between costs and processes, regulatory compliance, and the impact of globalisation. Recommendations are made to address these challenges, such as adopting standardised procedures, embracing technological innovation, identifying emerging risks, and increasing automation of risk management processes. Effective risk management practices are essential to address the complexity of the financial industry and ensure organisational resilience.

An explainable integrated machine learning model for mapping soil erosion by wind and water in a catchment with three desiccated lakes

Soil erosion by water and wind is a critical challenge for sustainable management of catchments in drylands and accurate spatial information can help in mitigation of its destructive consequences. Here, seven machine learning (ML) models were applied to map simultaneously the water and wind erosions in the Bakhtegan catchment, south Iran, with three dried lakes in its southern part and three dams established in upstream parts of the lakes. The analysis identified 10 and 11 effective variables controlling water and wind erosions, among 20 and 17 potential variables, respectively, via the MARS feature selection algorithm. According to the most accurate ML models (artificial neural network for water erosion, and Cubist for wind erosion), an integrated model was developed to map soil erosion by water and wind simultaneously. Permutation feature importance (PFI) and Shapley additive exPlanation (SHAP) interpretation techniques were employed to explain the model outputs, revealing that 19.7 % of the total area belonged to high and very high susceptibility classes to soil erosion by water and wind. The PFI plot revealed that the slope and wind speed were the most influencing factors for water and wind erosion, respectively. According to SHAP decision plot, slope had the highest contribution on the predictive water erosion model’s output, whereas vegetation cover exhibited the highest contribution on the predictive wind erosion model’s output. Due to climate change and intensified drought during the recent years, as well as due to construction of dams upstream of the lakes, the southern part of the study area was converted to a source of sand and dust storms. The hotspots with severe water erosion are distributed all over the study area, rendering it quite vulnerable to adverse climate change projections.