Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Abstract

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.