Loop Isomers Research Articles

Computational modeling to understand the interaction of TMPyP4 with a G-quadruplex

The potential of small molecules to bind to G-quadruplex-forming sequences in oncogene promoter regions, thereby regulating their structural equilibrium, has been explored as a promising strategy for cancer chemotherapy. The model drug 5,10,15,20-tetrakis-(N-methyl-4-pyridyl)porphine (TMPyP4) has been shown to have an affinity toward G-quadruplex DNA. However, the precise sites and modes of TMPyP4 binding to G-quadruplex DNA remain a subject of debate. In this study, we focus on identifying potential binding sites on a mutant c-MYC sequence known to fold into a single 1:2:1 loop isomer quadruplex. Our findings provide insights into the 4:1 stoichiometry reported for TMPyP4 binding to this G-quadruplex. Binding enthalpy and free energy calculations show that intercalation of a TMPyP4 molecule between the quadruplexes is thermodynamically favorable. Our calculations suggest that two of the binding sites are located at the top and bottom of the quadruplex, respectively, while the remaining two are likely intercalations.

How sequence alterations enhance the stability and delay expansion of DNA triplet repeat domains

Abstract DNA sequence alterations within DNA repeat domains inexplicably enhance the stability and delay the expansion of interrupted repeat domains. Here we propose mechanisms that rationalise such unanticipated outcomes. Specifically, we describe how interruption of a DNA repeat domain restricts the ensemble space available to dynamic, slip out, repeat bulge loops by introducing energetic barriers to loop migration. We explain how such barriers arise because some possible loop isomers result in energetically costly mismatches in the duplex portion of the repeat domain. We propose that the reduced ensemble space is the causative feature for the observed delay in repeat DNA expansion. We further posit that the observed loss of the interrupting repeat in some expanded DNAs reflects the transient occupation of loop isomer positions that result in a mismatch in the duplex stem due to ‘leakiness’ in the energy barrier. We propose that if the lifetime of such a low probability event allows for recognition by the mismatch repair system, then ‘repair’ of the repeat interruption can occur; thereby rationalising the absence of the interruption in the final expanded DNA ‘product.’ Our proposed mechanistic pathways provide reasoned explanations for what have been described as ‘puzzling’ observations, while also yielding insights into a biomedically important set of coupled genotypic phenomena that map the linkage between DNA origami thermodynamics and phenotypic disease states.

G-Quadruplex Formation in a Putative Coding Region of White Spot Syndrome Virus: Structural and Thermodynamic Aspects.

White spot disease (WSD) is one of the most devastating viral infections of crustaceans caused by the white spot syndrome virus (WSSV). A conserved sequence WSSV131 in the DNA genome of WSSV was found to fold into a polymorphic G‐quadruplex structure. Supported by two mutant sequences with single G→T substitutions in the third G4 tract of WSSV131, circular dichroism and NMR spectroscopic analyses demonstrate folding of the wild‐type sequence into a three‐tetrad parallel topology comprising three propeller loops with a major 1 : 3 : 1 and a minor 1 : 2 : 2 loop length arrangement. A thermodynamic analysis of quadruplex formation by differential scanning calorimetry (DSC) indicates a thermodynamically more stable 1 : 3 : 1 loop isomer. DSC also revealed the formation of additional highly stable multimeric species with populations depending on potassium ion concentration.

Dynamic DNA Energy Landscapes and Substrate Complexity in Triplet Repeat Expansion and DNA Repair.

DNA repeat domains implicated in DNA expansion diseases exhibit complex conformational and energy landscapes that impact biological outcomes. These landscapes include ensembles of entropically driven positional interchanges between isoenergetic, isomeric looped states referred to as rollamers. Here, we present evidence for the position-dependent impact on repeat DNA energy landscapes of an oxidative lesion (8oxodG) and of an abasic site analogue (tetrahydrofuran, F), the universal intermediate in base excision repair (BER). We demonstrate that these lesions modulate repeat bulge loop distributions within the wider dynamic rollamer triplet repeat landscapes. We showed that the presence of a lesion disrupts the energy degeneracy of the rollameric positional isomers. This lesion-induced disruption leads to the redistribution of loop isomers within the repeat loop rollamer ensemble, favoring those rollameric isomers where the lesion is positioned to be energetically least disruptive. These dynamic ensembles create a highly complex energy/conformational landscape of potential BER enzyme substrates to select for processing or to inhibit processing. We discuss the implications of such lesion-induced alterations in repeat DNA energy landscapes in the context of potential BER repair outcomes, thereby providing a biophysical basis for the intriguing in vivo observation of a linkage between pathogenic triplet repeat expansion and DNA repair.

Dinuclear ruthenium complexes display loop isomer selectivity to c-MYC DNA G-quadriplex and exhibit anti-tumour activity

G-quadruplex DNA, especially the cellular-myelocytomatosis viral oncogene (c-MYC) is closely associated with cell-cycle regulation, proliferation of tumour cells. In this work, the interaction between the c-MYC and two dinuclear Ru(II) complexes [(bpy)2Ru(bpibp)Ru(bpy)2](ClO4)4 (compound 1) and [(phen)2Ru(bpibp)Ru(phen)2](ClO4)4 (compound 2) have been studied. The data from UV–Visible, PCR-stop and Fluorescence resonance energy transfer (FRET) showed that two complexes can stabilize the structure of G-quadruplex in the c-MYC promoter and targeting the G-quadruplex loop isomers. Interestingly, the complex 2 has a greater effect on the 1:2:1 and 2:1:1 loop isomers while the 1 prefers to the 1:2:1 isomers. The mechanism studies revealed that complexes can induce apoptosis in HepG2 cells by generating ROS metabolites, triggering mitochondrial membrane potential loss and down-regulation of P-Akt (Akt also known as protein kinase B), P-p44/42 MAP kinase protein (P-p44/42), and c-MYC. Taken together, these results suggested that the two dinuclear complexes may both be candidates as anti-tumour agents as they may reduce the c-MYC gene expression. {bpibp: 4, 4′-bis (1, 10-phenanthroline-[5, 6-d] imidazole-2-yl)-biphenyl, bpy: 2,2-bipyridine, phen: 1,10-phenanthroline}

Stabilization for loop isomers of c-myc G-quadruplex DNA and anticancer activity by ruthenium complexes

In this study, two similar ruthenium(II) complexes 1 and 2 were synthesized to explore their selectivity for binding loop isomers of the c-myc G-quadruplex. The results show that both complexes can efficiently bind the c-myc G-quadruplex DNA, although complex 2 exhibited higher binding affinity. Studies of G-quadruplex loop isomers revealed that the c-myc G-quadruplexes on complexes 1 and 2 may contribute to the selectivity of 1:2:1 loop isomers as well as the high affinity of complex 2. This work also found that complex 2 significantly inhibited HeLa cell proliferation and was considerably less toxic to normal cells (Hs-68). Flow cytometric analysis showed that complex 2 induced cell apoptosis by mitochondrial pathways and inhibited the generation of intracellular reactive oxygen species (ROS).

Energy landscapes of dynamic ensembles of rolling triplet repeat bulge loops: implications for DNA expansion associated with disease states.

DNA repeat domains can form ensembles of canonical and noncanonical states, including stable and metastable DNA secondary structures. Such sequence-induced structural diversity creates complex conformational landscapes for DNA processing pathways, including those triplet expansion events that accompany replication, recombination, and/or repair. Here we demonstrate further levels of conformational complexity within repeat domains. Specifically, we show that bulge loop structures within an extended repeat domain can form dynamic ensembles containing a distribution of loop positions, thereby yielding families of positional loop isomers, which we designate as “rollamers”. Our fluorescence, absorbance, and calorimetric data are consistent with loop migration/translocation between sites within the repeat domain (“rollamerization”). We demonstrate that such “rollameric” migration of bulge loops within repeat sequences can invade and disrupt previously formed base-paired domains via an isoenthalpic, entropy-driven process. We further demonstrate that destabilizing abasic lesions alter the loop distributions so as to favor “rollamers” with the lesion positioned at the duplex/loop junction, sites where the flexibility of the abasic “universal hinge” relaxes unfavorable interactions and/or facilitates topological accommodation. Another strategic siting of an abasic site induces directed loop migration toward denaturing domains, a phenomenon that merges destabilizing domains. In the aggregate, our data reveal that dynamic ensembles within repeat domains profoundly impact the overall energetics of such DNA constructs as well as the distribution of states by which they denature/renature. These static and dynamic influences within triplet repeat domains expand the conformational space available for selection and targeting by the DNA processing machinery. We propose that such dynamic ensembles and their associated impact on DNA properties influence pathways that lead to DNA expansion.

Study of STAT3 G-quadruplex folding patterns by CD spectroscopy and molecular modeling

Abstract The G-quadruplexes formed from G-rich strands in the telomere and oncogene-promoter regions are regarded as new promising targets in the cancer therapy. A G-quadruplex in the downstream flanking region of the signal transducer and activator of transcription 3 (STAT3) gene was explored. Its folding patterns were proposed to be 3:2:2 and 3:3:1 loop isomers by the mutation analysis by CD spectroscopy. The structures were constructed and refined by molecular modeling method.

C-MYC promoter G-quadruplex formed at the 5′-end of NHE III 1 element: insights into biological relevance and parallel-stranded G-quadruplex stability

We studied the structures and stabilities of G-quadruplexes formed in Myc1234, the region containing the four consecutive 5′ runs of guanines of c-MYC promoter NHE III1, which have recently been shown to form in a supercoiled plasmid system in aqueous solution. We determined the NMR solution structure of the 1:2:1 parallel-stranded loop isomer, one of the two major loop isomers formed in Myc1234 in K+ solution. This major loop isomer, although sharing the same folding structure, appears to be markedly less stable than the major loop isomer formed in the single-stranded c-MYC NHE III1 oligonucleotide, the Myc2345 G-quadruplex. Our NMR structures indicated that the different thermostabilities of the two 1:2:1 parallel c-MYC G-quadruplexes are likely caused by the different base conformations of the single nucleotide loops. The observation of the formation of the Myc1234 G-quadruplex in the supercoiled plasmid thus points to the potential role of supercoiling in the G-quadruplex formation in promoter sequences. We also performed a systematic thermodynamic analysis of modified c-MYC NHE III1 sequences, which provided quantitative measure of the contributions of various loop sequences to the thermostabilities of parallel-stranded G-quadruplexes. This information is important for understanding the equilibrium of promoter G-quadruplex loop isomers and for their drug targeting.

Abstract 5134: G-Quadruplex structure formation in the proximal promoter region of the human vascular endothelial growth factor gene

Abstract The human vascular endothelial growth factor gene, VEGF, is a key regulator of angiogenesis. It plays an important role in tumor survival, growth and metastasis. It is over-expressed in many types of human cancers including glioma and renal cell carcinoma, ovarian and pancreatic cell carcinomas. The VEGF proximal promoter region contains a poly G/poly C rich tract that is essential for basal and inducible VEGF expression. The guanine-rich (G-rich) strand on this tract is shown to form a specific secondary structure, the G-quadruplex. Here we have elucidated the solution structure of the major intramolecular G-quadruplex formed on the G-rich strand of this region in K+ solution by proton Nuclear Magnetic Resonance (NMR) spectroscopy followed by the structural calculation of the G-quadruplex using Distance Geometry Simulated Annealing (DGSA) module of XPLOR-NIH software. It is inferred that this strand adopts a well-defined parallel-stranded G-quadruplex structure, which contains three G-tetrads stabilized by Hoogsteen hydrogen bonding, as well as three double-chain reversal loops containing 1:4:1 bases, a feature important for the formation of the most thermodynamically stable conformation. The size of the 4-base loop plays a critical role in determining the most favored folded pattern of a G-quadruplex. These 4-base loop residues interact with the residues of the 3’ flanking region of VEGF sequence; also, the 1-base double-chain reversal loop on two edges of the tetrad are very stable, which overall contribute in stabilizing the 1:4:1 conformer. We have found that the two cytosines in this central 4-base loop are involved in hydrogen bonding with the 3’ terminal end residues of VEGF, which is a salient feature as this interaction is sequence-specific and differs from that in other parallel-stranded structures, e.g. c-myc, significantly. These results are also supported by the DMS footprinting results by Guo et al. (2008) which show that the guanines involved in the tetrad formation in this major G-quadruplex loop isomer 1:4:1 are well-protected against DMS methylation. Therefore, the knowledge about the secondary structure of this non B-DNA conformation of the VEGF promoter region is essential for using the G- quadruplex as a target for anticancer drugs, which could be a novel approach to anti-angiogenesis drug discovery in cancer therapy. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8 Suppl):Abstract nr 5134. doi:10.1158/1538-7445.AM2011-5134

DSC Deconvolution of the Structural Complexity of c-MYC P1 Promoter G-Quadruplexes

We completed a biophysical characterization of the c-MYC proto-oncogene P1 promoter quadruplex and its interaction with a cationic porphyrin, 5,10,15,20-tetra(N-methyl-4-pyridyl)porphyrin (TMPyP4), using differential scanning calorimetry, isothermal titration calorimetry, and circular dichroism spectroscopy. We examined three different 24-mer oligonucleotides, including the wild-type (WT) sequence found in the c-MYC P 1 promoter and two mutant G→T sequences that are known to fold into single 1:2:1 and 1:6:1 loop isomer quadruplexes. Biophysical experiments were performed on all three oligonucleotide sequences at two different ionic strengths (30 mM [K +] and 130 mM [K +]). Differential scanning calorimetry experiments demonstrated that the WT quadruplex consists of a mixture of at least two different folded conformers at both ionic strengths, whereas both mutant sequences exhibit a single two-state melting transition at both ionic strengths. Isothermal titration calorimetry experiments demonstrated that both mutant sequences bind 4 mols of TMPyP4 to 1 mol of DNA, in similarity to the WT sequence. The circular dichroism spectroscopy signatures for all three oligonucleotides at both ionic strengths are consistent with an intramolecular parallel stranded G-quadruplex structure, and no change in quadruplex structure is observed upon addition of saturating amounts of TMPyP4 (i.e., 4:1 TMPyP4/DNA).

Thermodynamic Stability and Folding Kinetics of the Major G-Quadruplex and Its Loop Isomers Formed in the Nuclease Hypersensitive Element in the Human c-Myc Promoter: Effect of Loops and Flanking Segments on the Stability of Parallel-Stranded Intramolecular G-Quadruplexes

Overexpression of the c-Myc proto-oncogene is associated with a broad spectrum of human cancers. Nuclease hypersensitivity element III(1) (NHE III(1)) of the c-Myc promoter can form transcriptionally active and silenced forms, and the formation of DNA G-quadruplex structures has been shown to be critical for c-Myc transcriptional silencing. The major G-quadruplex formed in c-Myc NHE III(1) is a mixture of four loop isomers, which have all been shown to be biologically relevant to c-Myc transcriptional control. In this study, we performed a thorough thermodynamic and kinetic study of the four c-Myc loop isomers in a K(+) solution. The four loop isomers all form parallel-stranded G-quadruplexes with short loop lengths. While the parallel-stranded G-quadruplex has been known to favor short loop lengths, our results show that the difference in thermodynamic and kinetic properties of the four loop isomers, and hence between the parallel G-quadruplexes with similar loop lengths, is more significant than previously recognized. At 20 mM K(+), the average difference in the T(m) values between the most stable loop isomer 14/23 and the least stable loop isomer 11/20 is more than 10 °C. In addition, the capping structures formed by the extended flanking segments are shown to contribute to a stabilization of 2-3 °C in T(m) for the c-Myc promoter G-quadruplex. Understanding the intrinsic thermodynamic stability and kinetic properties of the c-Myc G-quadruplex loop isomers can aid in our understanding of their biological roles and drug targeting.

I-Motif Structures Formed in the Human c-MYC Promoter Are Highly Dynamic–Insights into Sequence Redundancy and I-Motif Stability

The GC-rich nuclease hypersensitivity element III1 (NHE III1) of the c-MYC promoter largely controls the transcriptional activity of the c-MYC oncogene. The C-rich strand in this region can form I-motif DNA secondary structures. We determined the folding pattern of the major I-motif formed in the NHE III1, which can be formed at near-neutral pH. While we find that the I-motif formed in the four 3′ consecutive runs of cytosines appears to be the most favored, our results demonstrate that the C-rich strand of the c-MYC NHE III1 exhibits a high degree of dynamic equilibration. Using a trisubstituted oligomer of this region, we determined the formation of two equilibrating loop isomers, one of which contains a flipped-out cytosine. Our results indicate that the intercalative cytosine+–cytosine base pairs are not always necessary for an intramolecular I-motif. The dynamic character of the c-MYC I-motif is intrinsic to the NHE III1 sequence and appears to provide stability to the c-MYC I-motif.

Studies on the Site and Mode of TMPyP4 Interactions with Bcl-2 Promoter Sequence G-Quadruplexes

TMPyP4 (Mesotetra(N-methyl-4-pyridyl)porphine) is known to have a high affinity for G-quadruplex DNA. However, there is still some controversy over the exact site(s) and mode(s) of TMPyP4 binding to G-quadruplex DNA. We examined TMPyP4 interactions with seven G-quadruplex forming oligonucleotides. The parent oligonucleotide is a 27-mer with a wild-type (WT) G-rich sequence of the Bcl-2 P1 promoter mid-region (5′-d(CGG GCG CGG GAG GAA GGG GGC GGG AGC-3′)). This sequence folds into at least three unique loop isomer quadruplexes. The two mutant oligonucleotides used in this study are shorter (23-mer) sequences in which nonquadruplex core bases were eliminated and two different (-G-G-) → (-T-T-) substitutions were made to restrict the folding complexity. The four additional mutant oligonucleotides were labeled by substituting a 2-aminopurine (2-AP) base for an A or G in either the first three-base lateral loop or the second five- or seven-base lateral loop (depending on the G→T mutation positions). Spectroscopic and microcalorimetric studies indicate that four molecules of TMPyP4 can be bound to a single G-quadruplex. Binding of the first two moles of TMPyP4 appears to occur by an end or exterior mode (K ≈ 1 × 107 M−1), whereas binding of the third and fourth moles of TMPyP4 appears to occur by a weaker, intercalative binding mode (K ≈ 1 × 105 M−1). As the mid-loop size decreases from seven to five bases, end binding occurs with significantly increased affinity. 2-AP-labeled Bcl-2 promoter region quadruplexes show increased fluorescence of the 2-AP base on addition of TMPyP4. The change in fluorescence for 2-AP bases in the second half of the TMPyP4 titration lends support to our previous speculation regarding the intercalative nature of the weaker binding mode.

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

Molecular modeling and biophysical analysis of the c-MYC NHE-III1 silencer element

G-Quadruplex and i-Motif-forming sequences in the promoter regions of several oncogenes show promise as targets for the regulation of oncogenes. In this study, molecular models were created for the c-MYC NHE-III(1) (nuclease hypersensitivity element III(1)) from two 39-base complementary sequences. The NHE modeled here consists of single folded conformers of the polypurine intramolecular G-Quadruplex and the polypyrimidine intramolecular i-Motif structures, flanked by short duplex DNA sequences. The G-Quadruplex was based on published NMR structural data for the c-MYC 1:2:1 loop isomer. The i-Motif structure is theoretical (with five cytosine-cytosine pairs), where the central intercalated cytosine core interactions are based on NMR structural data obtained for a tetramolecular [d(A(2)C(4))(4)] model i-Motif. The loop structures are in silico predictions of the c-MYC i-motif loops. The porphyrin meso-tetra(N-methyl-4-pyridyl)porphine (TMPyP4), as well as the ortho and meta analogs TMPyP2 and TMPyP3, were docked to six different locations in the complete c-MYC NHE. Comparisons are made for drug binding to the NHE and the isolated G-Quadruplex and i-Motif structures. NHE models both with and without bound cationic porphyrin were simulated for 100 ps using molecular dynamics techniques, and the non-bonded interaction energies between the DNA and porphyrins calculated for all of the docking interactions.

Stabilization of G-Quadruplex DNA and Down-Regulation of Oncogene c-myc by Quindoline Derivatives

Stabilization of G-quadruplex structures in the promoter region of certain oncogenes is an emerging field in anticancer drug design. Human c-myc gene is one of these oncogenes, and G-quadruplexes have been proven to be the transcriptional controller of this gene. In the present study, the interaction of quindoline derivatives with G-quadruplexes in c-myc was investigated. The experimental results indicated that these derivatives have the ability to induce/stabilize the G-quadruplexes in c-myc, which lead to down-regulation of the c-myc in the Hep G2 cell line. It was found that derivatives with terminal amino groups in their side chains would selectively bind to the isomers with the double nucleotide loops in the absence of K+. Molecular modeling studies revealed the binding mode between the derivatives and the G-quadruplexes is end-stacking at the 3'-position, and the positively charged side chain on the quindoline derivatives may contribute to the selectivity to certain loop isomers of topological quadruplexes as well as the improved stabilization action.

Structure of the Biologically Relevant G-Quadruplex in The c-MYC Promoter

The nuclease hypersensitivity element III1 (NHE III1) in the c-MYC promoter controls up to 80–90% of the transcriptional activity of this gene. We have demonstrated that the guanine-rich strand of the NHE III1 forms a G-quadruplex consisting of a mixture of four biologically relevant loop isomers that function as a silencer element. NMR studies have shown that these G-quadruplexes are propeller-type parallel structures consisting of three stacked G-tetrads and three double-chain reversal loops. An NMR-derived solution structure for this quadruplex provides insight into the unusual stability of the structure. This structure is a target for small molecule inhibitors of c-MYC gene expression.

Drug Targeting of the c-MYC Promoter to Repress Gene Expression via a G-Quadruplex Silencer Element

In this review, we describe the evidence for a parallel-stranded G-quadruplex in the purine-rich strand of the nuclease hypersensitivity element III(1) (NHE III(1)) of the promoter of c-MYC upstream of the P1 and P2 promoters. This biologically relevant G-quadruplex is a mixture of four loop isomers. The folding pattern of a nuclear magnetic resonance (NMR)-derived structure for the predominant loop isomer of this G-quadruplex has been obtained. This G-quadruplex has been demonstrated to be a silencer element, and the cationic porphyrin TMPyP4 has been shown to stabilize this G-quadruplex. Furthermore, TMPyP4 has been shown to repress c-MYC expression, and this effect is mediated through the silencer element. Last, the in vivo activity of TMPyP4 in xenograph models is presented.

Deconvoluting the structural and drug-recognition complexity of the G-quadruplex-forming region upstream of the bcl-2 P1 promoter.

The human bcl-2 gene contains a GC-rich region upstream of the P1 promoter that has been shown to be critically involved in the regulation of bcl-2 gene expression. We have demonstrated that the guanine-rich strand of the DNA in this region can form any one of three distinct intramolecular G-quadruplex structures. Mutation and deletion analysis permitted isolation and identification of three overlapping DNA sequences within this element that formed the three individual G-quadruplexes. Each of these was characterized using nondenaturing gel analysis, DMS footprinting, and circular dichroism. The central G-quadruplex, which is the most stable, forms a mixed parallel/antiparallel structure consisting of three tetrads connected by loops of one, seven, and three bases. Three different G-quadruplex-interactive agents were found to further stabilize these structures, with individual selectivity toward one or more of these G-quadruplexes. Collectively, these results suggest that the multiple G-quadruplexes identified in the promoter region of the bcl-2 gene are likely to play a similar role to the G-quadruplexes in the c-myc promoter in that their formation could serve to modulate gene transcription. Last, we demonstrate that the complexity of the G-quadruplexes in the bcl-2 promoter extends beyond the ability to form any one of three separate G-quadruplexes to each having the capacity to form either three or six different loop isomers. These results are discussed in relation to the biological significance of this G-quadruplex-forming element in modulation of bcl-2 gene expression and the inherent complexity of the system where different G-quadruplexes and loop isomers are possible.