Linker Insertion Mutations Research Articles

The Type III Effector NleD from Enteropathogenic Escherichia coli Differentiates between Host Substrates p38 and JNK.

Enteropathogenic Escherichia coli (EPEC) is a gastrointestinal pathogen that utilizes a type III secretion system (T3SS) to inject an array of virulence effector proteins into host enterocytes to subvert numerous cellular processes for successful colonization and dissemination. The T3SS effector NleD is a 26-kDa zinc metalloprotease that is translocated into host enterocytes, where it directly cleaves and inactivates the mitogen-activated protein kinase signaling proteins JNK and p38. Here a library of 91 random transposon-based, in-frame, linker insertion mutants of NleD were tested for their ability to cleave JNK and p38 during transient transfection of cultured epithelial cells. Immunoblot analysis of p38 and JNK cleavage showed that 7 mutant derivatives of NleD no longer cleaved p38 but maintained the ability to cleave JNK. Site-directed mutation of specific regions surrounding the insertion sites within NleD revealed that a single amino acid, R203, was essential for cleavage of p38 but not JNK in a direct in vitro cleavage assay, in transiently transfected cells, or in EPEC-infected cells. Mass spectrometry analysis narrowed the cleavage region to within residues 187 and 213 of p38. Mutation of residue R203 within NleD to a glutamate residue abolished the cleavage of p38 and impaired the ability of NleD to inhibit AP-1-dependent gene transcription of a luciferase reporter. Furthermore, the R203 mutation abrogated the ability of NleD to dampen interleukin-6 production in EPEC-infected cells. Overall, this work provides greater insight into substrate recognition and specificity by the type III effector NleD.

Mutagenesis and Functional Analysis of the Bacterial Arginine Glycosyltransferase Effector NleB1 from Enteropathogenic Escherichia coli.

Enteropathogenic Escherichia coli (EPEC) interferes with host cell signaling by injecting virulence effector proteins into enterocytes via a type III secretion system (T3SS). NleB1 is a novel T3SS glycosyltransferase effector from EPEC that transfers a single N-acetylglucosamine (GlcNAc) moiety in an N-glycosidic linkage to Arg(117) of the Fas-associated death domain protein (FADD). GlcNAcylation of FADD prevents the assembly of the canonical death-inducing signaling complex and inhibits Fas ligand (FasL)-induced cell death. Apart from the DXD catalytic motif of NleB1, little is known about other functional sites in the enzyme. In the present study, members of a library of 22 random transposon-based, in-frame, linker insertion mutants of NleB1 were tested for their ability to block caspase-8 activation in response to FasL during EPEC infection. Immunoblot analysis of caspase-8 cleavage showed that 17 mutant derivatives of NleB1, including the catalytic DXD mutant, did not inhibit caspase-8 activation. Regions of interest around the insertion sites with multiple or single amino acid substitutions were examined further. Coimmunoprecipitation studies of 34 site-directed mutants showed that the NleB1 derivatives with the E253A, Y219A, and PILN(63-66)AAAA (in which the PILN motif from residues 63 to 66 was changed to AAAA) mutations bound to but did not GlcNAcylate FADD. A further mutant derivative, the PDG(236-238)AAA mutant, did not bind to or GlcNAcylate FADD. Infection of mice with the EPEC-like mouse pathogen Citrobacter rodentium expressing NleBE253A and NleBY219A showed that these strains were attenuated, indicating the importance of residues E253 and Y219 in NleB1 virulence in vivo In summary, we identified new amino acid residues critical for NleB1 activity and confirmed that these are required for the virulence function of NleB1.

Absence of O antigen suppresses Shigella flexneri IcsA autochaperone region mutations

The Shigella flexneri IcsA (VirG) protein is a polarly distributed autotransporter protein. IcsA functions as a virulence factor by interacting with the host actin regulatory protein N-WASP, which in turn activates the Arp2/3 complex, initiating actin polymerization. Formation of F-actin comet tails allows bacterial cell-to-cell spreading. Although various accessory proteins such as periplasmic chaperones and the β-barrel assembly machine (BAM) complex have been shown to be involved in the export of IcsA, the IcsA translocation mechanism remains to be fully elucidated. A putative autochaperone (AC) region (amino acids 634-735) located at the C-terminal end of the IcsA passenger domain, which forms part of the self-associating autotransporter (SAAT) domain, has been suggested to be required for IcsA biogenesis, as well as for N-WASP recruitment, based on mutagenesis studies. IcsA(i) proteins with linker insertion mutations within the AC region have a significant reduction in production and are defective in N-WASP recruitment when expressed in smooth LPS (S-LPS) S. flexneri. In this study, we have found that the LPS O antigen plays a role in IcsA(i) production based on the use of an rmlD (rfbD) mutant having rough LPS (R-LPS) and a novel assay in which O antigen is depleted using tunicamycin treatment and then regenerated. In addition, we have identified a new N-WASP binding/interaction site within the IcsA AC region.

Self-association of the Shigella flexneri IcsA autotransporter protein

The IcsA autotransporter protein is a major virulence factor of the human intracellular pathogen Shigella flexneri. IcsA is distributed at the poles in the outer membrane (OM) of S. flexneri and interacts with components of the host actin-polymerization machinery to facilitate intracellular actin-based motility and subsequent cell-to-cell spreading of the bacterium. We sought to characterize the biochemical properties of IcsA in the bacterial OM. Chemical cross-linking data suggested that IcsA exists in a complex in the OM. Furthermore, reciprocal co-immunoprecipitation of differentially epitope-tagged IcsA proteins indicated that IcsA is able to self-associate. The identification of IcsA linker-insertion mutants that were negatively dominant provided genetic evidence of IcsA-IcsA interactions. From these results, we propose a model whereby IcsA self-association facilitates efficient actin-based motility.

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Enantioselective reduction of prochiral ketones by engineered bifunctional fusion proteins

NADPH-dependent oxidoreductases are useful catalysts for the production of chiral synthons. However, preparative applications of oxidoreductases require efficient methods for in situ regeneration of the expensive nicotinamide cofactors. An advantageous method for cofactor regeneration is the construction of bifunctional fusion proteins composed of two enzymes, one catalysing the reduction reaction and the other one mediating the recycling of cofactors. Herein, we describe the in-frame fusion between an NADP+-accepting mutant of FDH (formate dehydrogenase) from Mycobacterium vaccae N10 and KR [3-ketoacyl-(acyl-carrier-protein) reductase] from Synechococcus sp. strain PCC 7942. The generation of linker insertion mutants led to a fusion protein exhibiting 100 and 80% of the enzymatic activities of native KR and FDH respectively. Escherichia coli cells expressing the fusion protein showed an approx. 2-fold higher initial reaction rate in the production of chiral alcohols than cells expressing the enzymes separately. The application of the engineered fusion protein in whole-cell bioreduction of pentafluoroacetophenone resulted in a substrate conversion of 99.97% with an excellent enantiomeric excess of 99.9% (S)-1-(pentafluorophenyl)ethanol.

Insertion Mutations in Herpes Simplex Virus 1 Glycoprotein H Reduce Cell Surface Expression, Slow the Rate of Cell Fusion, or Abrogate Functions in Cell Fusion and Viral Entry

Of the four required herpes simplex virus (HSV) entry glycoproteins, the precise role of gH-gL in fusion remains the most elusive. The heterodimer gH-gL has been proposed to mediate hemifusion after the interaction of another required glycoprotein, gD, with a receptor. To identify functional domains of HSV-1 gH, we generated 22 randomized linker-insertion mutants. Analyses of 22 gH mutants revealed that gH is relatively tolerant of insertion mutations, as 15 of 22 mutants permitted normal processing and transport of gH-gL to the cell surface. gH mutants that were not expressed well at the cell surface did not function in fusion or viral entry. The screening of gH mutants for function revealed the following: (i) for wild-type gH and some gH mutants, fusion with nectin-1-expressing target cells occurred more rapidly than with herpesvirus entry mediator (HVEM)-expressing target cells; (ii) some gH mutants reduced the rate of cell fusion without abrogating fusion completely, indicating that gH may play a role in governing the kinetics of fusion and may be responsible for a rate-limiting first stage in HSV-1 fusion; and (iii) only one gH mutant, located within the short cytoplasmic tail, completely abrogated function, indicating that the gH cytoplasmic tail is crucial for cell fusion and viral infectivity.

Insertional Mutations in Herpes Simplex Virus Type 1 gL Identify Functional Domains for Association with gH and for Membrane Fusion

Glycoprotein L (gL) is one of four glycoproteins required for the entry of herpes simplex virus (HSV) into cells and for virus-induced cell fusion. This glycoprotein oligomerizes with gH to form a membrane-bound heterodimer but can be secreted when expressed without gH. Twelve unique gL linker-insertion mutants were generated to identify regions critical for gH binding and gH/gL processing and regions essential for cell fusion and viral entry. All gL mutants were detected on the cell surface in the absence of gH, suggesting incomplete cleavage of the signal peptide or the presence of a cell surface receptor for secreted gL. Coexpression with gH enhanced the levels of cell surface gL detected by antibodies for all gL mutants except those that were defective in their interactions with gH. Two insertions into a conserved region of gL abrogated the binding of gL to gH and prevented gH expression on the cell surface. Three other insertions reduced the cell surface expression of gH and/or altered the properties of gH/gL heterodimers. Altered or absent interaction of gL with gH was correlated with reduced or absent cell fusion activity and impaired complementation of virion infectivity. These results identify a conserved domain of gL that is critical for its binding to gH and two noncontiguous regions of gL, one of which contains the conserved domain, that are critical for the gH/gL complex to perform its role in membrane fusion.

Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis

Epstein-Barr Virus (EBV) glycoprotein B (gB) is essential for viral fusion events with epithelial and B cells. This glycoprotein has been studied extensively in other herpesvirus family members, but functional domains outside of the cytoplasmic tail have not been characterized in EBV gB. In this study, a total of 28 linker insertion mutations were generated throughout the length of gB. In general, the linker insertions did not disrupt intracellular expression and variably altered cell surface expression. Oligomerization was disrupted by insertions located between residues 561 and 620, indicating the location of a potential site of oligomer contacts between EBV gB monomers. In addition, a novel N-glycosylated form of wild-type gB was identified under nonreducing Western blot conditions that likely represents a mature form of the protein. Fusion activity was abolished in all but three variants containing mutations in the N-terminal region (gB30), within the ectodomain (gB421), and in the intracellular C-terminal domain (gB832) of the protein. Fusion activity with variants gB421 and gB832 was comparable to that of the wild type with epithelial and B cells, and only these two mutants, but not gB30, were able to complement gB-null virus and subsequently function in virus entry. The mutant gB30 exhibited a low level of fusion activity with B cells and was unable to complement gB-null virus. The mutations generated here indicate important structural domains, as well as regions important for function in fusion, within EBV gB.

Mutagenesis of theShigella flexneriAutotransporter IcsA Reveals Novel Functional Regions Involved in IcsA Biogenesis and Recruitment of Host Neural Wiscott-Aldrich Syndrome Protein

The IcsA (VirG) protein of Shigella flexneri is a polarly localized, outer membrane protein that is essential for virulence. Within host cells, IcsA activates the host actin regulatory protein, neural Wiskott-Aldrich syndrome protein (N-WASP), which in turn recruits the Arp2/3 complex, which nucleates host actin to form F-actin comet tails and initiate bacterial motility. Linker insertion mutagenesis was undertaken to randomly introduce 5-amino-acid in-frame insertions within IcsA. Forty-seven linker insertion mutants were isolated and expressed in S. flexneri Delta icsA strains. Mutants were characterized for IcsA protein production, cell surface expression and localization, intercellular spreading, F-actin comet tail formation, and N-WASP recruitment. Using this approach, we have identified a putative autochaperone region required for IcsA biogenesis, and our data suggest an additional region, not previously identified, is required for N-WASP recruitment.

Linker Insertion Mutations in the Herpes Simplex Virus Type 1 UL28 Gene: Effects on UL28 Interaction with UL15 and UL33 and Identification of a Second-Site Mutation in the UL15 Gene That Suppresses a Lethal UL28 Mutation

The UL28 protein of herpes simplex virus type 1 (HSV-1) is one of seven viral proteins required for the cleavage and packaging of viral DNA. Previous results indicated that UL28 interacts with UL15 and UL33 to form a protein complex (terminase) that is presumed to cleave concatemeric DNA into genome lengths. In order to define the functional domains of UL28 that are important for DNA cleavage/packaging, we constructed a series of HSV-1 mutants with linker insertion and nonsense mutations in UL28. Insertions that blocked DNA cleavage and packaging were found to be located in two regions of UL28: the first between amino acids 200 to 400 and the second between amino acids 600 to 740. Insertions located in the N terminus or in a region located between amino acids 400 and 600 did not affect virus replication. Insertions in the carboxyl terminus of the UL28 protein were found to interfere with the interaction of UL28 with UL33. In contrast, all of the UL28 insertion mutants were found to interact with UL15 but the interaction was reduced with mutants that failed to react with UL33. Together, these observations were consistent with previous conclusions that UL15 and UL33 interact directly with UL28 but interact only indirectly with each other. Revertant viruses that formed plaques on Vero cells were detected for one of the lethal UL28 insertion mutants. DNA sequence analysis, in combination with genetic complementation assays, demonstrated that a second-site mutation in the UL15 gene restored the ability of the revertant to cleave and package viral DNA. The isolation of an intergenic suppressor mutant provides direct genetic evidence of an association between the UL28 and UL15 proteins and demonstrates that this association is essential for DNA cleavage and packaging.

Initial Characterization of 17 Viruses Harboring Mutant Forms of the Immediate-Early Gene of Equine Herpesvirus 1

The sole immediate-early (IE) gene of equine herpesvirus 1 (EHV-1) encodes a major regulatory protein of 1487 amino acids (aa) capable of modulating gene expression from both early and late promoters and also of trans-repressing its own promoter. Using a specially designed recombination system and a library of IE linker-insertion, deletion, point, and nonsense mutant constructs that encode forms of the IE protein (IEP) harboring mutations within all five regions, 17 mutant viruses were generated and characterized. Ribonuclease protection analyses revealed that all 17 mutants synthesize the IE mRNA in RK-13 cells, whereas those that failed to replicate on non-complementing RK-13 cells displayed a defect in the transcription of either an important early gene (EICP0) and/or an essential late gene (glycoprotein D). Western blot analyses showed that the IEP was synthesized and detectable in cells infected with each mutant virus, including those mutants that failed to replicate on non-complementing RK-13 cells. Eleven of the 17 mutants were capable of growth on non-complementing RK-13 cells, whereas mutant viruses with deletions within the serine-rich tract (SRT), nucleus localization signal (NLS), or DNA-binding domain (DBD) were capable of growth only on the IEP-producing cell line (IE13.1). Lastly, temperature shift experiments revealed that mutant viruses containing deletions within the C-terminus (KyAn1029 and KyAn1411) or within the SRT (KyADeltaSRT2) of the IEP exhibited a temperature-sensitive phenotype in that these viruses, in contrast to the parent KyA, failed to replicate at 39 degrees C. Overall, these results indicate that the C-terminus of the IEP is not essential for IEP function in cell culture, but this region contains elements that enhance the function(s) of the IEP. The initial characterization of these 17 EHV-1 mutants has shown that sequences totaling at least 43% of the IEP are not essential for virus replication in cell culture.

Construction of a pTOC-T vector using GST-ParE toxin for direct cloning and selection of PCR products

Using linker insertion mutations, we determined the most stable region of the parE gene which encodes a toxic protein (ParE) that inhibits growth of Escherichia coli. The toxicity of ParE was sustained until a 144 bp linker was inserted into this region. We have developed a 3' T-overhang vector based on these characteristics of the GST-ParE toxin, and named pTOC-T. Because pTOC-T uses a post-segregational killing system, all transformants grown up on the plates can be considered as recombinants containing foreign DNA. pTOC-T not require X-Gal, IPTG or other substrates for selection. This T-vector using a positive selection system can be applied to various E. coli strains such as XL1-Blue, BL21, DH5alpha, JM109, and JM110.

Mutational Analysis of Different Regions in the Coxsackievirus 2B Protein: REQUIREMENTS FOR HOMO-MULTIMERIZATION, MEMBRANE PERMEABILIZATION, SUBCELLULAR LOCALIZATION, AND VIRUS REPLICATION

The coxsackievirus 2B protein is a small hydrophobic protein (99 amino acids) that increases host cell membrane permeability, possibly by forming homo-multimers that build membrane-integral pores. Previously, we defined the functional role of the two hydrophobic regions HR1 and HR2. Here, we investigated the importance of regions outside HR1 and HR2 for multimerization, increasing membrane permeability, subcellular localization, and virus replication through analysis of linker insertion and substitution mutants. From these studies, the following conclusions could be drawn. (i) The hydrophilic region ((58)RNHDD(62)) between HR1 and HR2 is critical for multimerization and increasing membrane permeability. Substitution analysis of Asn(61) and Asn(62) demonstrated the preference for short polar side chains (Asp, Asn), residues that are often present in turns, over long polar side chains (Glu, Gln). This finding supports the idea that the hydrophilic region is involved in pore formation by facilitating a turn between HR1 and HR2 to reverse chain direction. (ii) Studies undertaken to define the downstream boundary of HR2 demonstrated that the aromatic residues Trp(80) and Trp(82), but not the positively charged residues Arg(81), Lys(84), and Lys(86) are important for increasing membrane permeability. (iii) The N terminus is not required for multimerization but does contribute to the membrane-active character of 2B. (iv) The subcellular localization of 2B does not rely on regions outside HR1 and HR2 and does not require multimerization. (v) Virus replication requires both the membrane-active character and an additional function of 2B that is not connected to this activity.

Effects of linker-insertion mutations in herpes simplex virus 1 gD on glycoprotein-induced fusion with cells expressing HVEM or nectin-1

Several cell surface molecules, including HVEM and nectin-1, can serve as entry receptors for herpes simplex virus (HSV) and as receptors for virus-induced or viral glycoprotein-induced cell fusion. The viral ligand for these receptors is the HSV envelope glycoprotein gD. A set of linker-insertion and deletion mutants of HSV type 1 (HSV-1) gD was analyzed for effects of the mutations on binding of gD to HVEM and nectin-1, on viral glycoprotein-induced cell fusion with target cells expressing HVEM or nectin-1 and on complementation of infectivity of a gD-null HSV-1 viral mutant. Insertions after amino acid 151 or 225 or deletion of amino acids 234–244 disrupted (i) binding of the mutant forms of gD to both receptors and (ii) functional interactions (cell fusion and complementation) with both receptors, but were without effect on cell surface expression. Insertions in the N-terminal domain of gD (after amino acid 12, 34 or 43) disrupted binding to HVEM and functional activities with HVEM, as expected from a previously reported X-ray structure of a gD–HVEM complex, but were without effect in the case of nectin-1. These and other results indicate that the mutations disruptive of interactions with both receptors probably affect conformations of contact sites that are different for each receptor.

Function of herpes simplex virus type 1 gD mutants with different receptor-binding affinities in virus entry and fusion.

We have studied the receptor-specific function of four linker-insertion mutants of herpes simplex virus type 1 glycoprotein D (gD) representing each of the functional regions of gD. We used biosensor analysis to measure binding of the gD mutants to the receptors HVEM (HveA) and nectin-1 (HveC). One of the mutants, gD(inverted Delta 34t), failed to bind HVEMt but showed essentially wild-type (WT) affinity for nectin-1t. The receptor-binding kinetics and affinities of the other three gD mutants varied over a 1,000-fold range, but each mutant had the same affinity for both receptors. All of the mutants were functionally impaired in virus entry and cell fusion, and the levels of activity were strikingly similar in these two assays. gD(inverted Delta 34)-containing virus was defective on HVEM-expressing cells but did enter nectin-1-expressing cells to about 60% of WT levels. This showed that the defect of this form of gD on HVEM-expressing cells was primarily one of binding and that this was separable from its later function in virus entry. gD(inverted Delta 243t) showed WT binding affinity for both receptors, but virus containing this form of gD had a markedly reduced rate of entry, suggesting that gD(inverted Delta 243) is impaired in a postbinding step in the entry process. There was no correlation between gD mutant activity in fusion or virus entry and receptor-binding affinity. We conclude that gD functions in virus entry and cell fusion regardless of its receptor-binding kinetics and that as long as binding to a functional receptor occurs, entry will progress.

Structure-function studies of Escherichia coli RpoH (sigma32) by in vitro linker insertion mutagenesis.

The sigma factor RpoH (sigma(32)) is the key regulator of the heat shock response in Escherichia coli. Many structural and functional properties of the sigma factor are poorly understood. To gain further insight into RpoH regions that are either important or dispensable for its cellular activity, we generated a collection of tetrapeptide insertion variants by a recently established in vitro linker insertion mutagenesis technique. Thirty-one distinct insertions were obtained, and their sigma factor activity was analyzed by using a groE-lacZ reporter fusion in an rpoH-negative background. Our study provides a map of permissive sites which tolerate linker insertions and of functionally important regions at which a linker insertion impairs sigma factor activity. Selected linker insertion mutants will be discussed in the light of known sigma factor properties and in relation to a modeled structure of an RpoH fragment containing region 2.

Mutations of the WD repeats that compromise Tup1 repression function maintain structural integrity of the WD domain trypsin-resistant core

The yeast global transcriptional repressor Tup1 contains 7 WD repeats in its C-terminus that form a β-propeller-like structure, in which the first and last WD repeats interact to make a closed circle. The WD domains of all proteins tested, including Tup1, form a compact structure resistant to trypsin digestion (Garcia-Higuera et al., Biochemistry 35 (1996) 13985–13994). We found that the in vitro formation of the trypsin-resistant core of Tup1 requires just five WD repeats (WD2–6). Deletion of the ST region between WD1 and WD2 destabilizes the trypsin-resistant core, but maintains Tup1 repression function in vivo. Linker insertion and point mutations in the WD repeats that compromise Tup1 repression function in vivo still maintain the trypsin-resistant core in vitro These results indicate that structural perturbation of the WD domain structure cannot explain the effects of these mutations on Tup1 repression function.

The phosphoryl transfer domain of UhpB interacts with the response regulator UhpA.

Bacterial two-component regulatory systems control the expression of target genes through regulated changes in protein phosphorylation. Signal reception alters the ability of a membrane-bound histidine kinase (HK) protein to transfer phosphate from ATP to a highly conserved histidine residue. The transfer of phosphate from the histidine to an aspartate residue on the cognate response regulator (RR) changes the ability of the latter protein to bind to target DNA sequences and to alter gene transcription. UhpB is the HK protein which controls production of the sugar phosphate transporter UhpT. Elevated expression of full-length UhpB or of a soluble hybrid protein, GST-Bc, which is glutathione S-transferase (GST) fused to the cytoplasmic C-terminal portion of UhpB, results in complete blockage of uhpT expression in a uhp(+) strain. This dominant-negative interference could result from the ability of GST-Bc to bind and sequester the RR UhpA and to accelerate its dephosphorylation. The portion of GST-Bc responsible for the interference phenotype was localized using truncation, linker insertion, and point mutations to the region between residues 293 and 366 flanking His-313, the putative site of autophosphorylation. Point mutations which allow GST-Bc to activate uhpT expression or which relieve the interference phenotype were obtained at numerous sites throughout this region. This region of UhpB is related to the phosphoryl transfer domain of EnvZ, which forms half of an interdimer four-helix bundle and is responsible for dimerization of its cytoplasmic domain. The expression of GST fusion proteins carrying the corresponding portions of EnvZ strongly interfered with the activation of porin gene expression by OmpR. The GST-Bc protein accelerated dephosphorylation of P-UhpA. Reverse transfer of phosphate from P-UhpA to GST-Bc was observed in the presence of the metal chelator EDTA and depended on the presence of His-313. Phosphate transfer from P-UhpA to the liberated phosphoryl transfer domain also occurred. Taken together, these results indicate that the phosphoryl transfer-dimerization domain of UhpB participates in the specific binding of UhpA, in the control of autokinase activity, and in the dephosphorylation of P-UhpA.

Elimination of Phosphorylation Sites of Semliki Forest Virus Replicase Protein nsP3

nsP3 is one of the four RNA replicase subunits encoded by alphaviruses. The specific essential functions of nsP3 remain unknown, but it is known to be phosphorylated on serine and threonine residues. Here we have completed mapping of the individual phosphorylation sites on Semliki Forest virus nsP3 (482 amino acids) by point mutational analysis of threonine residues. This showed that threonines 344 and 345 represented the major threonine phosphorylation sites in nsP3. Experiments with deletion variants suggested that nsP3 itself had no kinase activity; instead, it was likely to be phosphorylated by multiple cellular kinases. Phosphorylation was not necessary for the peripheral membrane association of nsP3, which was mediated by the N-terminal region preceding the phosphorylation sites. Two deletion variants of nsP3 with either reduced or undetectable phosphorylation were studied in the context of virus infection. Cells infected with mutant viruses produced close to wild type levels of infectious virions; however, the rate of viral RNA synthesis was significantly reduced in the mutants. A virus totally defective in nsP3 phosphorylation and exhibiting a decreased rate of RNA synthesis also exhibited greatly reduced pathogenicity in mice.