Late Symptoms Research Articles

Late Blight Resistance Conferred by Rpi-Smira2/R8 in Potato Genotypes In Vitro Depends on the Genetic Background

Potato production worldwide is threatened by late blight, caused by the oomycete Phytophthora infestans (Mont.) de Bary. Highly resistant potato cultivars were developed in breeding programs, using resistance gene pyramiding methods. In Sárpo Mira potatoes, five resistance genes (R3a, R3b, R4, Rpi-Smira1, and Rpi-Smira2/R8) are reported, with the latter gene assumed to be the major contributor. To study the level of late blight resistance conferred by the Rpi-Smira2/R8 gene, potato genotypes with only the Rpi-Smira2/R8 gene were selected from progeny population in which susceptible cultivars were crossed with Sárpo Mira. Ten R8 potato genotypes were obtained using stepwise marker-assisted selection, and agroinfiltration of the avirulence effector gene Avr4. Nine of these R8 genotypes were infected with both Slovenian P. infestans isolates and aggressive foreign isolates. All the progeny R8 genotypes are resistant to the Slovenian P. infestans isolate 02_07, and several show milder late blight symptoms than the corresponding susceptible parent after inoculation with other isolates. When inoculated with foreign P. infestans isolates, the genotype C571 shows intermediate resistance, similar to that of Sárpo Mira. These results suggest that Rpi-Smira2/R8 contributes to late blight resistance, although this resistance is not guaranteed solely by the presence of the R8 in the genome.

Depression symptoms 6 years after stroke are associated with higher perceived impact of stroke, limitations in ADL and restricted participation

Late post-stroke depression symptoms are understudied. This study aimed to investigate depression symptoms 6 years after stroke, and associations with perceived impact of stroke, activities of daily living (ADL), and participation in social and everyday activities. Data was collected in a 6-year follow-up in a longitudinal study of stroke. Assessments included Hospital Anxiety and Depression Scale (HADS) for depression symptoms, Stroke Impact Scale 3.0. for perceived impact of stroke,Barthel Index for ADL, Frenchay Activities Index for participation in social and everyday activities. The research questions were addressed by bivariate analyses (with HADS-D ≥ 4 as cut-off), and hierarchical multiple regressionanalyses using continuous HADS-D scores. Forty percent of the 105 participants (57% men, age 30–91) showed depression symptoms (HADS-D ≥ 4). Depression symptoms were associated with higher perceived impact ofstroke, more dependence in ADL, and more restrictions in participation in social and everyday activities. Most of those with depression symptoms had low scores on HADS, indicating that even mild depression symptoms mightbe relevant to identify and target in treatment and rehabilitation of long-term consequences of stroke.

Factors Influencing the Practice of Breast Self-Examination among Female Tertiary Students in Ho, Ghana

Background. Despite the implementation of various interventions towards the reduction of breast cancer prevalence, many women still report late symptoms to health facilities, and this decreases their chances of survival. Breast self-examination (BSE) is the most convenient form of examination to detect the development of breast cancer. We examined the factors that influence the practice of breast self-examination among female tertiary students in Ho, Volta Region of Ghana. Methods. This was a descriptive cross-sectional study that recruited 506 female students from four tertiary institutions in the Ho Municipality in Ghana using questionnaires. Descriptive and inferential statistics comprising frequency, percentage, Chi-square, and binary logistic regression were used in analyzing the data. Results. About 73% of the respondents had ever practised BSE. Out of the respondents who have ever practiced BSE, 79% were practising it at the time of the study. Students in their fourth year were above 4 times more likely (95% CI = 1.73–9.29, p = 0.014 ) to practise BSE than those in their first year. Also, students with good knowledge of BSE were 4 times more likely to practice BSE [(95% CI = 1.1–13.46), p = 0.036 ] and students with good perception about BSE were 12 times more likely to practice BSE [(95% CI = 1.21–122.73), p = 0.034 ]. Conclusion. The study found that 27% of the female students had never practised BSE. Those who practice BSE did not practice regularly and appropriately. Also, good knowledge and perception are associated with the practice of BSE. The implication of this result is the late presentation of breast cancer cases to health facilities and increases in breast cancer-related deaths in the country. Therefore, it is recommended that the Ministry of Health, the Ghana Health Service, and other stakeholders in Ghana’s healthcare should develop and implement innovative approaches and policies such as peer and support groups’ learning, and mass media BSE awareness aimed at ensuring better understanding and access to BSE education. This should be intensified during the foundation years such as the secondary and tertiary education levels to ensure the adoption of breast self-examination practice. It is also recommended that another study must be done using a qualitative approach to get an in-depth understanding of the steps and ways, by which female students practice BSE.

PO-1090 Late toxicity-related symptoms and fraction dose affect decision regret in HNC patients

PO-1090 Late toxicity-related symptoms and fraction dose affect decision regret in HNC patients

Parkinson's Disease Symptoms Associated with Developing On-State Axial Symptoms Early after Subthalamic Deep Brain Stimulation.

Background: The relationship between axial symptoms in Parkinson’s disease (PD) and subthalamic deep brain stimulation (STN-DBS) is still unclear. Purpose: We searched for particular clinical characteristics before STN-DBS linked to on-state axial problems after surgery. Methods: We retrospectively analyzed baseline motor, emotional and cognitive features from PD patients with early axial symptoms (within 4 years after STN-DBS) and late axial symptoms (after 4 years). We also considered a group of PD patients without axial symptoms for at least 4 years after surgery. Results: At baseline, early-axial PD patients (n = 28) had a higher on-state Unified Parkinson’s Disease Rating Scale III (15.0 ± 5.6 to 11.6 ± 6.2, p = 0.020), higher axial score (2.4 ± 1.8 to 0.7 ± 1.0, p < 0.001) and worse dopaminergic response (0.62 ± 0.12 to 0.70 ± 0.11, p = 0.005), than non-axial PD patients (n = 51). Early-axial PD patients had short-term recall impairment, not seen in non-axial PD (36.3 ± 7.6 to 40.3 ± 9.3, p = 0.041). These variables were similar between late-axial PD (n = 18) and non-axial PD, but late-axial PD showed worse frontal dysfunction. Conclusions: PD patients with early axial symptoms after DBS may have a significantly worse presurgical motor phenotype, poorer dopaminergic response and memory impairment. This may correspond to a more severe form of PD.

The Post-COVID 19 long term surveillance study sequel to an add-on Ayurveda regimen

It has been 18 months now since the world-wide outbreak of COVID 19 (Corona Virus Disease 19) and still the ongoing research is being done for disease specific medicines. During June 2020 to August 2020, an attempt was made to explore if an add-on Ayurveda regimen comprising of Dasamoolkadutrayadi Kashayam and Guluchyadi Kwatham in tablet forms can be prescribed along with standard of care; which has established the clinical evidence that there is advantage of accelerated symptomatic recovery, early discharge from hospital, reducing the duration of hospital stay. After informed consent the patients were followed up over 9 months after discharged from hospital. The purpose of the present extended study was to find the impact of disease even though patients were discharged after appropriate treatment and if there were any late effects in the add-on Ayurveda treatment group after 9 months as it was one of the first few formal studies world-wide; since there was no long term follow up data available.The study concluded that no additional late effects or symptoms or complications which were known in Post COVID phase; were observed in study group who received the add-on Ayurveda regimen as compared to the control group with conventional standard of care.

Post-acute COVID-19 condition in Saudi Arabia: A national representative study

BackgroundMany survivors of COVID-19 have developed symptoms and diseases similar to those observed after severe acute respiratory syndrome (SARS). Therefore, this study aimed to characterize the symptoms that appear after severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection has been eradicated and to determine their relationship with COVID-19 severity. MethodsThis multicenter, retrospective cross-sectional study was conducted in all eligible confirmed cases of SARS-CoV-2 infection from Saudi Arabia. Study participants were randomly selected using computerized random sampling from a population of 314,821 patients. Descriptive statistics were used to describe baseline demographic data and clinical characteristics. Categorical variables were presented as counts and percentages, while continuous variables were presented as means and standard deviations. ResultsApproximately 70% of patients were found to have five or fewer symptoms simultaneously. Late symptoms (in the ongoing symptomatic COVID-19) occurred in 225 (22·5%) patients with the most common late symptoms being loss of smell, loss of taste, fatigue, shortness of breath, and cough (52·4%, 31·1%, 11·5%, 10·2%, and 8·9% of patients with late symptoms, respectively). We also found that the presence of acute symptoms of COVID-19 and admission to the hospital were significant independent predictors of the post-COVID-19 condition. ConclusionSaudi patients with COVID-19 develop a wide range of symptoms, similar to those observed and reported in other countries. The loss of smell, the loss of taste, shortness of breath, and fatigue were the main persistent symptoms. Regular follow-up of COVID-19 survivors is highly recommended to minimize the burden of the post-acute COVID-19 condition and improve the quality of life of patients.

Cardiac tumours in children: a single-centre experience and literature review.

Cardiac tumours are extremely rare in children. Although more than 90% are benign, children can develop obstructive or embolisation derived symptoms, arrhythmias, constitutional symptoms, cardiac tamponade, or even sudden death. Although the majority are asymptomatic, and some spontaneously regress, appropriate follow-up is needed on a case-by-case basis, as patients may develop late symptoms. Definitive diagnosis is only possible through histological analysis; however, it is possible to infer tumour type with a high grade of certainty based on imaging features, particularly cardiac magnetic resonance. Surgical resection is advocated for those causing symptoms, obstruction, cardiac dysfunction, and high risk of embolisation. The aim of this review is to present the state of the art related to cardiac tumours in the paediatric population, in the context of our own experience.

First Report of Late Blight Caused by Phytophthora infestans in Potato in Tibet, China.

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world's highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar 'Longshu 10' with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5'GGCCTTGACGACATCCAGAA3'; EF_R: 5'TAGCAGCTCAACCCGAAGTG3'), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5'TTCCCTTTGTCCTCTACCGAT3'; P2R: 5'TTACGGCGGTTTAGCACATACA3') (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. 'Favorita' for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. 'Favorita' with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

POS-814 CLINICAL PROFILE AND OUTCOME OF GRAFT PYELONEPHRITIS IN KIDNEY TRANSPLANT RECIPIENTS

Urinary tract infections (UTI’s) are a common complication in kidney transplant recipients(KTRs). Risks of UTI that are unique to transplant population include a greater risk of graft dysfunction, and a predisposition to acute rejection. Furthermore, classical signs of acute graft pyelonephritis(AGPN) are masked by immunuosuppressive medications and even graft site pain is a late symptom due to graft denervation during transplantation

Adenoid cystic carcinoma in atypical site: case report

Adenoid cystic carcinoma (ACC) is a rare form of malignant neoplasm of the salivary glands, with slow growth and late symptoms. One of the challenges presented by this tumor is its high rate of metastasis, with tropism to the nervous system, liver and bones. Treatment is based on surgical resection of the tumor, radiotherapy, and chemotherapy – it varies depending on the condition of each patient. In view of the low frequency of ACC, this study aims to report a case of ACC in a female patient, with anatomopathological diagnosis of basaloid cell neoplasm.

Coronary Artery Complications after Right Ventricular Outflow Tract Reconstruction Surgery

Background: Mechanisms and clinical manifestations of coronary artery complications after right ventricular outflow tract reconstruction surgery are not well known. Methods: Patients who had coronary artery complications after pulmonary valve replacement or the Rastelli procedure at a single tertiary centre were retrospectively analysed. Results: Coronary artery complications were identified in 20 patients who underwent right ventricular outflow tract reconstruction surgery. The median age at diagnosis of coronary artery complication was 21 years (interquartile range: 13–25 years). Mechanisms of coronary artery complications were compression by adjacent materials in 12 patients, dynamic compression of intramural course of coronary artery in two patients, and intraoperative injury in six patients. Congenital coronary artery anomalies were identified in 50% (10/20) of patients. Four patients presented with early postoperative haemodynamic instability. Fourteen patients showed late onset symptoms or signs of coronary insufficiency, including chest pain, ventricular dysfunction, or ventricular arrhythmias. Coronary artery stenosis was incidentally found on cardiac computed tomography angiography in two asymptomatic patients. Four patients underwent surgical interventions, and one patient underwent percutaneous coronary intervention for coronary stenosis. One patient with recurrent ventricular tachycardia required an implantable cardioverter-defibrillator. There were two deaths in patients with intraoperative coronary injury. Conclusion: Preoperative coronary evaluation and long-term follow-up for the development of coronary artery complications are required in patients undergoing right ventricular outflow tract reconstruction surgery to prevent ventricular dysfunction, arrhythmias, and death, especially among those with congenital coronary anomalies.

Ameloblastoma: Pathogenesis, Clinical and Radiological Features, Classification, and Management

Background: Ameloblastoma are benign epithelial odontogenic tumors affecting the jaws. Objective: The main objective of this article is to review the pathogenesis, clinical and radiological features, classification, and management of ameloblastoma. Methods: A literature review mainly of the Pubmed database was done using the keywords: “ameloblastoma pathogenesis”; “ameloblastoma classification”; “ameloblastoma history”; “clinical and radiological features of ameloblastoma”; and “management of ameloblastoma”. Results: In 2017, ameloblastomas were classified by W.H.O into three categories: a) unicystic, b) conventional, and c) extraosseous/peripheral. Clinically, they are slow-growing, localized, aggressive neoplasms. Radologically, they mainly present as extensive, radiolucent, multilocular images, with a typical “soap bubble-like” appearance with a thinner, expanded, and eroded cortical plate. The linked non-erupted tooth is displaced and the roots of the adjacent teeth undergo clear resorption. Conclusion: Because of their late signs and symptoms, ameloblastomas are usually identified at an advanced stage. Their management typically includes a large resection with safety margins and immediate reconstruction when possible. Regular long-term postoperative follow-ups are mandatory for optimum treatment outcome and recurrence prevention.

The psychiatric and neurological interface of multiple sclerosis: case report and literature review

Background: Multiple sclerosis (MS) is a neurological disorder that affects 2.5 million people worldwide. MS exemplifies the interface between neurology and psychiatry in a trajectory of neuro and psycho-pathologies that can conflate with the diagnosis of primary psychotic disorders. The protean nature of its neuropsychiatric manifestations could delay the diagnosis and management of such a challenging condition. Case Presentation: We present the case of a 52-year-old female who developed first episode of psychosis at the age of 48 years. There was no history of previous mental illness in either the patient, or in any family member. She had been formally diagnosed with a relapsing and remitting type of MS, at the age of 30 years. Six years later, she discontinued the recommended disease modifying therapy (DMT) which resulted in worsening of her MS and late onset schizophrenia-like symptoms. Her affect, however, was warm and interactive, and she exhibited a sense of general wellbeing and serenity, describing her psychosis as being &amp;quot;magical&amp;quot; despite the severity of her condition. Treatment of her psychiatric condition with depot psychotropic medication resulted in dramatic improvement of her psychosis with regain of insight, hence compliance on DMT and containment of her MS. Conclusion: Comorbid psychiatric and MS manifestations may be challenging regarding the diagnosis and management of either condition. Professionals in these fields, therefore, need to be aware of the relative high prevalence of mental health disorders in MS patients and that these may pre or post-date the diagnosis of MS, with the potential to confound the clinical picture.

Can Antipsychotics and Antidepressants Affect the Formation or Chronicization of Aortic Dissections?

Acute Stanford type-A aortic dissections (STAAD) are life-threatening diseases which require&#x0D; emergency surgery to eliminate risks of aortic rupture, severe aortic valve insufficiency, pericardial&#x0D; tamponade and cerebral and/or coronary malperfusion. Only a small subset of patients go unnoticed&#x0D; and become chronic with unclear mechanism. These patients are usually diagnosed thru late symptoms&#x0D; or incidentally. Surgical techniques requiring cardiopulmonary bypass and sometimes deep hypothermia&#x0D; and circulatory arrest are first-line treatments with considerable mortality and complications. Herein,&#x0D; an incidentally diagnosed chronic STAAD patient who was receiving antipsychotic and antidepressant&#x0D; treatment and successfully repaired with total aortic arch replacement was presented.

Osteosarcoma of the Pelvis: Clinical Presentation and Overall Survival.

Introduction Osteosarcoma is the most common sarcoma of bone. Pelvic osteosarcoma presents a significant therapeutic challenge due to potential late symptom onset, metastatic dissemination at diagnosis, and inherent difficulties of wide surgical resection secondary to the complex and critical anatomy of the pelvis. The rates of survival are well reported for osteosarcoma of the appendicular skeleton, but specific details regarding presentation and survival are less known for osteosarcoma of the pelvis. Methods The Surveillance, Epidemiology, and End Results (SEER) program was queried for primary osteosarcoma of the bony pelvis from 2004 to 2015. Cases with Collaborative Staging variables (available after 2004) were analyzed by grade, histologic subtype, surgical intervention, tumor size, tumor extension, and presence of metastasis at diagnosis. The 2-, 5-, and 10-year survival rates were assessed with respect to these variables. The SEER database was then queried for age, tumor size, surgical intervention, metastasis at time of presentation, and survivorship data for patients with primary osteosarcoma of the upper extremity, lower extremity, vertebrae, thorax, and face/skull, and rates for all anatomic locations were then compared to patients with primary pelvic osteosarcoma. Results A total of 292 cases of pelvic osteosarcoma were identified from 2004 to 2015 within the database, representing 9.8% of cases among all surveyed primary sites. The most common histologic subtype was osteoblastic osteosarcoma (69.9%), followed by chondroblastic osteosarcoma (22.3%). The majority of cases were high-grade tumors (94.3%), of size >8 cm (72.0%), and with extension beyond the originating bone (74.0%). For the entire pelvic osteosarcoma group, the 2-, 5-, 10-year survival rates were 45.6%, 26.5%, and 21.4%, respectively, which were the poorest among surveyed anatomic sites. The 5-year overall survival was an abysmal 5.3% for patients with metastatic disease at diagnosis, and 37.0% for non-metastatic pelvic osteosarcoma treated with surgery and chemotherapy. When compared to other locations, pelvic osteosarcoma had higher rates of metastatic disease at presentation (33.5%), larger median tumor size (11.0 cm), and older median age at diagnosis (47.5 years). While over 85% of patients with tumors at the extremities received surgery, only 47.4% of pelvic osteosarcomas in this cohort received surgical resection—likely influenced by larger tumor size, sacral involvement, frequency of metastasis, older age, or delayed referral to a sarcoma center. Conclusion This study clarifies presenting features and clinical outcomes of pelvic osteosarcomas, which often present with large, high-grade tumors with extracompartmental extension, high likelihood of metastatic disease at diagnosis, and a potential limited ability to be addressed surgically. The survival rates of primary osteosarcoma of the pelvis are poor and are lower than osteosarcomas from other anatomic locations. While acknowledging the influence of metastasis, tumor characteristics, and advanced age on the decision to undergo surgical excision of a pelvic osteosarcoma, the rates of surgical resection are low and highlight the importance of understanding appropriate conditions for oncologic resection of pelvic sarcomas.

Multimodal neuroimaging biomarkers of Alzheimer’s disease in older adults with depression: Preliminary findings from a pilot cohort

AbstractBackgroundSubclinical depressive symptoms in older adults have been linked to AD pathology and cognitive decline. However, it’s unclear how these findings translate to the spectrum of clinically significant late life depressive symptoms. To explore this, we examined cross‐sectional associations between depressive symptoms and neuroimaging biomarkers of AD (ATN) in a pilot cohort of older adults with moderate‐to‐severe depressive symptoms and compared these participants to non‐depressed older adults.MethodSeventeen community‐dwelling clinically‐normal (CN) older adults meeting DSM5 criteria for major depression (73.4±4.7 y.o., 58.8% female) underwent MRI, amyloid‐(C11‐PiB)‐PET, and tau‐(F18‐FTP)‐PET and completed a clinical battery including the 30‐item Geriatric Depression Scale (GDS) and Preclinical Alzheimer’s Cognitive Composite (PACC). A comparison group of non‐depressed older adults (no history of depression, GDS≤5; 73.0±5.5 y.o., 63.2% female) derived from existing observational studies at our site with similar clinical‐neuroimaging batteries were matched using nearest neighbor propensity score to depressed participants by age, sex, and APOE‐ε4 carrier status in a 4:1 ratio (Table 1). We examined cortical amyloid and regional tau and atrophy in a priori regions of interest (ROI) previously implicated in AD and mood (medial temporal lobe, amygdala, frontal cortex). We utilized t‐tests to explore group differences and linear regressions adjusted for age to investigate associations between depressive symptoms and ATN biomarkers.ResultIn the depressed group, depressive symptoms were significantly associated with elevated FTP in all ROI and with lower hippocampal volume, but not with cortical PiB (Table 2, Fig. 1). There were no significant group differences compared to non‐depressed controls in cortical PiB, regional FTP, or volume measures; however, participants with depression had worse cognitive performance on the PACC than non‐depressed participants (t=‐2.04, p=0.050).ConclusionPreliminary findings in this pilot sample suggest that moderate‐to‐severe depressive symptoms in older adults may be more closely associated cross‐sectionally with tau and hippocampal volume than cortical amyloid. Future work in a larger depressed cohort and with longitudinal follow‐up is needed to characterize risk in older adults with depression and consider opportunities for AD prevention.

Strategies to Improve the Antitumor Effect of Immunotherapy for Hepatocellular Carcinoma.

Hepatocellular carcinoma (HCC), one of the most fatal malignancies in the world, is usually diagnosed in advanced stages due to late symptom manifestation with very limited therapeutic options, which leads to ineffective intervention and dismal prognosis. For a decade, tyrosine kinase inhibitors (TKIs) have offered an overall survival (OS) benefit when used in a first-line (sorafenib and lenvatinib) and second-line setting (regorafenib and cabozantinib) in advanced HCC, while long-term response remains unsatisfactory due to the onset of primary or acquired resistance. Recently, immunotherapy has emerged as a promising therapy in the treatment of several solid tumors, such as melanoma and non-small cell lung cancer. Moreover, as the occurrence of HCC is associated with immune tolerance and immunosurveillance escape, there is a potent rationale for employing immunotherapy in HCC. However, immunotherapy monotherapy, mainly including immune checkpoint inhibitors (ICIs) that target checkpoints programmed death-1 (PD-1), programmed death-ligand 1 (PD-L1), and the cytotoxic T lymphocyte antigen-4 (CTLA-4), has a relatively low response rate. Thus, the multi-ICIs or the combination of immunotherapy with other therapies, like antiangiogenic drugs and locoregional therapies, has become a novel strategy to treat HCC. Combining different ICIs may have a synergistical effect attributed to the complementary effects of the two immune checkpoint pathways (CTLA-4 and PD-1/PD-L1 pathways). The incorporation of antiangiogenic drugs in ICIs can enhance antitumor immune responses via synergistically regulating the vasculature and the immune microenvironment of tumor. In addition, locoregional treatments can improve antitumor immunity by releasing the neoplasm antigens from killed tumor cells; in turn, this antitumor immune response can be intensified by immunotherapy. Therefore, the combination of locoregional treatments and immunotherapy may achieve greater efficacy through further synergistic effects for advanced HCC. This review aims to summarize the currently reported results and ongoing trials of the ICIs-based combination therapies for HCC to explore the rational combination strategies and further improve the survival of patients with HCC.

Risk Factors for Late Persistent Fatigue After Chemoradiotherapy in Patients With Locally Advanced Cervical Cancer: An Analysis From the EMBRACE-I Study

This study aimed to evaluate patient- and treatment-related risk factors for late persistent fatigue within the prospective, multicenter EMBRACE-I study. Fatigue was prospectively assessed (Common Terminology Criteria for Adverse Events, version 3) at baseline and during regular follow up in 993 patients with locally advanced cervical cancer after treatment with chemoradiotherapy and magnetic resonance imaging-guided brachytherapy. Risk factors for baseline and late persistent fatigue were evaluated with multivariable logistic regression. Late persistent fatigue was defined when either grade ≥1 or ≥2 was scored in at least half of the follow ups. The median follow-up time was 57 months. Baseline fatigue grade ≥1/≥2 (35.8%/6.3%, respectively) was associated with preexisting comorbidities, World Health Organization performance status, being underweight, severe pain, and tumor volume. Late persistent grade ≥1/≥2 fatigue (36.3%/5.8%, respectively) was associated with patient-related factors (baseline fatigue, younger age, obesity) along with the size of irradiated volumes and the level of radiation doses from external beam radiation therapy (EBRT) and brachytherapy (EBRT: V43Gy, V57Gy; EBRT+brachytherapy: V60Gy equivalent dose in 2-Gy fractions). Large-volume lymph node (LN) boost increased the risk for late persistent fatigue grade ≥2 by 18% and 5% in patients with and without baseline fatigue, respectively, compared with no LN boost. The risk for late persistent fatigue grade ≥1 increased by 7% and 4% with V43Gy <2000 cm³ versus >3000 cm³ in patients with and without baseline fatigue, respectively. Late persistent grade ≥1 fatigue occurred in 13% of patients without late persistent organ-related symptoms (gastrointestinal, genitourinary, and vaginal) versus 34% to 43%, 50% to 58%, and 73% in patients suffering from persistent symptoms involving 1, 2, or 3 organs, respectively. Late persistent fatigue occurs in a considerable number of patients after chemoradiotherapy, and is associated with patient-related factors, the size of volumes irradiated to intermediate and high EBRT and brachytherapy doses, and other persistent organ-related morbidity. These findings support the importance of ongoing efforts to better tailor the target dose and reduce irradiation of healthy tissue without compromising target coverage, using highly conformal EBRT and brachytherapy techniques.

Conjunctivitis as a sign of persistent SARS-COV-2 infection? An observational study and report of late symptoms.

PurposeTo investigate if symptomatic conjunctivitis during the recovery phase of the disease could be associated to a persistent presence of SARS-CoV-2 in the upper respiratory tract. Secondary end points were to analyze the presence of SARS-CoV-2 in the conjunctiva of ocular symptomatic patients and to record the presence of ocular disturbances at this point of the disease.MethodsAn observational study including consecutive COVID19 patients treated at Humanitas Clinical and Research Hospital who were attending for nasopharyngeal swab to confirm the resolution of SARS-CoV-2 infection and end of isolation. We examined 129 consecutive patients from May to June 2020. The primary end point was to determine if symptomatic conjunctivitis at this point of the disease could be associated to a persistent presence of SARS-CoV-2 in the upper respiratory tract. Secondary end points were to analyze the presence of SARS-CoV-2 in the conjunctiva of ocular symptomatic patients and to record the presence of ocular disturbances at this point of the disease.ResultsOne hundred twenty eight patients were included, 9.38% had conjunctivitis, none resulted positive to conjunctival PCR swab test, while two of them had positive nasopharyngeal result. Mean time elapsed since the first COVID-19 positive swab to the time of examination was 6 weeks ( ± 3). The only significant association was the presence of conjunctivitis with older age (65.3 ± 12.7 vs 56.7 + 13.5. p = 0.046). Nasopharyngeal swab resulted positive in 22 patients (17.19%). While 88 patients (68.2%) did not have any ocular complain during their COVID19 disease. The 40 patients (31.8%) reporting ocular disturbances complained about: redness (25.43%), tearing (19.53%), burning (18.35%), foreign body sensation (17.18%), itching (15.62%), and discharge (12.5%).ConclusionThis study showed that late conjunctivitis cannot be considered as a marker of persistent infection when patients are sent to confirm the resolution of SARS-CoV-2 infection.