First Report of Late Blight Caused by Phytophthora infestans in Potato in Tibet, China.

Abstract

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world's highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar 'Longshu 10' with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5'GGCCTTGACGACATCCAGAA3'; EF_R: 5'TAGCAGCTCAACCCGAAGTG3'), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5'TTCCCTTTGTCCTCTACCGAT3'; P2R: 5'TTACGGCGGTTTAGCACATACA3') (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. 'Favorita' for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. 'Favorita' with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.