Juvenile Hormone Response Element Research Articles

Juvenile hormone suppresses the FoxO-takeout axis to shorten longevity in male silkworm

Juvenile hormone (JH) plays a crucial endocrine regulatory role in insect metamorphosis, reproduction, and longevity in multiple organisms, such as flies, honeybees, and migratory monarch butterflies. However, the molecular mechanism of JH affecting longevity remains largely unknown. In this study, we showed that JH III and its analog methoprene shortened the survival days significantly in the adulthood of male silkworm. At the same time, the allatostatin, a neuropeptide that inhibits the secretion of JH by the corpora allata, could extend the survival days dramatically after adult eclosion in male silkmoth. Interestingly, a central pro-longevity FoxO transcription factor was reduced upon JH stimulation in silkworm individuals and BmN-SWU1 cells. Furthermore, the analysis of the upstream sequence of the FoxO gene identified a JH response element which suggested that FoxO might be regulated as a target of JH. Surprisingly, we identified a Bmtakeout (BmTO) gene that encodes a JH-binding protein and contains a FoxO response element. As expected, FoxO overexpression and knockdown up- and down-regulated the expression of BmTO respectively, indicating that BmTO functions as a FoxO target. BmTO overexpression could release the inhibitory effect of JH on the BmFoxO gene by reducing JH bioavailability to block its signal transduction. Collectively, these results may provide insights into the mechanism of the JH-FoxO-TO axis in aging research and pest control.

Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana.

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

Juvenile hormone induces methoprene-tolerant 1 phosphorylation to increase interaction with Taiman in Helicoverpa armigera

Methoprene-tolerant 1 (Met1) is a basic-helix-loop-helix Per/Arnt/Sim (bHLH-PAS) protein identified as the intracellular receptor of juvenile hormone (JH). JH induces phosphorylation of Met1; however, the phosphorylation site and outcomes of phosphorylation are not well characterized. In the present study, using the lepidopteran insect and serious agricultural pest Helicoverpa armigera (cotton bollworm) as a model, we showed that JH III induced threonine-phosphorylation of Met1 at threonine 393 (Thr393) in the Per-Arnt-Sim (PAS) B domain. Thr393-phosphorylation was necessary for Met1 binding to the JH response element (JHRE) to promote the transcription of Kr-h1 (encoding transcription factor Krüppel homolog 1) because Thr393-phosphorylated Met1 increased its interaction with Taiman (Tai) and prevented the Met1-Met1 association. However, JH III could not prevent Met1-Met1 association after Met1-Thr393 was mutated, suggesting that Thr393-phosphorylation is an essential mechanism by which JH prevents Met1-Met1 association. The results showed that JH induces Met1 phosphorylation on Thr393, which prevents Met1-Met1 association, enhances Met1 interaction with Tai, and promotes the binding of Met1-Tai transcription complex to the E-box in the JHRE to regulate Kr-h1 transcription.

Functional characterization of two paralogous JH receptors, methoprene-tolerant 1 and 2, in the silkworm, Bombyx mori (Lepidoptera: Bombycidae)

Methoprene-tolerant (Met) is a bHLH-PAS transcription factor that functions as a core component of juvenile hormone (JH) receptors in insects. The genome of the silkworm, Bombyx mori (L.), encodes two Met paralogs, BmMet1 and BmMet2. We have previously proposed that BmMet2 forms a functional complex with steroid receptor co-activator (BmSRC) in the presence of JH and induces Kruppel-homolog 1 (BmKr-h1). In this study, we characterized BmMet2 domains and examined the role of BmMet1. A series of reporter and two-hybrid assays on BmMet2 revealed that the bHLH domain played a critical role in the binding to the JH response element of BmKr-h1 (kJHRE), the PAS-A in the transcriptional activation, and the PAS-B in the JH recognition. Furthermore, we confirmed that the BmMet2/BmSRC complex recognizes the core kJHRE (GGCCTCCACGTG). BmMet1 was found to interact with BmSRC and weakly activated the kJHRE reporter in a JH-dependent manner. The BmMet1 transcript level was much higher than the BmMet2 transcript level in the epidermis during the larval and pupal stages. By contrast, the BmMet2 transcript was hardly detected during the larval stage, but was abundant in the adult stage. These results suggest that BmMet1 is involved in the JH-dependent induction of BmKr-h1 in larvae, whereas BmMet2 is involved in adults.

A role for Taiman in insect metamorphosis.

Recent studies in vitro have reported that the Methoprene-tolerant (Met) and Taiman (Tai) complex is the functional receptor of juvenile hormone (JH). Experiments in vivo of Met depletion have confirmed this factor's role in JH signal transduction, however, there is no equivalent data regarding Tai because its depletion in larval or nymphal stages of the beetle Tribolium castaneum and the bug Pyrrhocoris apterus results in 100% mortality. We have discovered that the cockroach Blattella germanica possesses four Tai isoforms resulting from the combination of two indels in the C-terminal region of the sequence. The presence of one equivalent indel-1 in Tai sequences in T. castaneum and other species suggests that Tai isoforms may be common in insects. Concomitant depletion of all four Tai isoforms in B. germanica resulted in 100% mortality, but when only the insertion 1 (IN-1) isoforms were depleted, mortality was significantly reduced and about half of the specimens experienced precocious adult development. This shows that Tai isoforms containing IN-1 are involved in transducing the JH signal that represses metamorphosis. Reporter assays indicated that both T. castaneum Tai isoforms, one that contains the IN-1 and another that does not (DEL-1) activated a JH response element (kJHRE) in Krüppel homolog 1 in conjunction with Met and JH. The results indicate that Tai is involved in the molecular mechanisms that repress metamorphosis, at least in B. germanica, and highlight the importance of distinguishing Tai isoforms when studying the functions of this transcription factor in development and other processes.

Juvenile hormone regulates Aedes aegypti Krüppel homolog 1 through a conserved E box motif

Juvenile hormone (JH) plays important roles in regulation of many physiological processes including development, reproduction and metabolism in insects. However, the molecular mechanisms of JH signaling pathway are not completely understood. To elucidate the molecular mechanisms of JH regulation of Krüppel homolog 1 gene (Kr-h1) in Aedes aegypti, we employed JH-sensitive Aag-2 cells developed from the embryos of this insect. In Aag-2 cells, AaKr-h1 gene is induced by nanomolar concentration of JH III, its expression peaked at 1.5 h after treatment with JH III. RNAi studies showed that JH induction of this gene requires the presence of Ae. aegypti methoprene-tolerant (AaMet). A conserved 13 nucleotide JH response element (JHRE, TGCCTCCACGTGC) containing canonical E box motif (underlined) identified in the promoter of AaKr-h1 is required for JH induction of this gene. Critical nucleotides in the JHRE required for JH action were identified by employing mutagenesis and reporter assays. Reporter assays also showed that basic helix loop helix (bHLH) domain of AaMet is required for JH induction of AaKr-h1. 5' rapid amplification of cDNA ends method identified two isoforms of AaKr-h1, AaKr-h1α and AaKr-h1β, the expression of both isoforms is induced by JH III, but AaKr-h1α is the predominant isoform in both Aag-2 cells and Ae. aegypti larvae.

Methoprene-tolerant 1 regulates gene transcription to maintain insect larval status.

Insect molting and metamorphosis are regulated by two hormones: 20-hydroxyecdysone (20E) and juvenile hormone (JH). The hormone 20E regulates gene transcription via the nuclear receptor EcR to promote metamorphosis, whereas JH regulates gene transcription via its intracellular receptor methoprene-tolerant (Met) to prevent larval-pupal transition. However, the function and mechanism of Met in various insect developments are not well understood. We propose that Met1 plays a key role in maintaining larval status not only by promoting JH-responsive gene transcription but also by repressing 20E-responsive gene transcription in the Lepidopteran insect Helicoverpa armigera. Met1 protein is increased during feeding stage and decreased during molting and metamorphic stages. Met1 is upregulated by JH III and a low concentration of 20E independently, but is downregulated by a high concentration of 20E. Knockdown of Met1 in larvae causes precocious pupation, decrease in JH pathway gene expression, and increase in 20E pathway gene expression. Met1 interacts with heat shock protein 90 and binds to JH response element to regulate Krüppel homolog 1 transcription in JH III induction. Met1 interacts with ultraspiracle protein 1 (USP1) to repress 20E transcription complex EcRB1/USP1 formation and binding to ecdysone response element. These data indicate that JH via Met1 regulates JH pathway gene expression and represses 20E pathway gene expression to maintain the larval status.

Juvenile hormone regulates an expression of a late gene encoded in a polydnavirus, Cotesia plutellae bracovirus

An endoparasitoid wasp Cotesia plutellae encodes two host translation inhibitory factors (HTIFs) that are expressed in late larval stage of Plutella xylostella parasitized by C. plutellae. The late expressions of HTIFs seemed to be associated with decreasing titer of juvenile hormone (JH) at the last larval instar because an addition of pyriproxyfen (PYR, a JH analog) inhibited the late expression pattern of two HTIF genes. To understand their late expression control, promoter region of an HTIF gene called CpBV15α was cloned by inverse PCR. The cloned HTIF upstream region (1113bp) possessed a putative JH response element (JHRE) and other promoter elements. The putative promoter region was rejoined with an open reading frame of enhanced green fluorescence protein (EGFP). When the recombinant vector construct was injected into early third instar larvae of nonparasitized P. xylostella, it was expressed in fourth larval instar at 72h after injection, compared to relatively early expression in 24h after injection of control construct containing a baculovirus immediate-early promoter. However, recombinant EGFP construct lost the late expression pattern when its promoter region was incomplete by truncating JHRE region. PYR application inhibited EGFP expression of the recombinant construct, but gave little influence on truncated constructs. Interestingly, when the complete promoter construct was injected to pupal stage, its late expression pattern was lost and showed early expression pattern. However, an addition of PYR to pupae, which had been injected with the complete promoter construct, inhibited the reporter gene expression. These results suggest that late expression of a HTIF (CpBV15α) is controlled by its promoter, which is sensitive to host JH titer.

Transcriptional regulation of juvenile hormone-mediated induction of Krüppel homolog 1, a repressor of insect metamorphosis

The Krüppel homolog 1 gene (Kr-h1) has been proposed to play a key role in the repression of insect metamorphosis. Kr-h1 is assumed to be induced by juvenile hormone (JH) via a JH receptor, methoprene-tolerant (Met), but the mechanism of induction is unclear. To elucidate the molecular mechanism of Kr-h1 induction, we first cloned cDNAs encoding Kr-h1 (BmKr-h1) and Met (BmMet1 and BmMet2) homologs from Bombyx mori. In a B. mori cell line, BmKr-h1 was rapidly induced by subnanomolar levels of natural JHs. Reporter assays identified a JH response element (kJHRE), comprising 141 nucleotides, located ∼2 kb upstream from the BmKr-h1 transcription start site. The core region of kJHRE (GGCCTCCACGTG) contains a canonical E-box sequence to which Met, a basic helix-loop-helix Per-ARNT-Sim (bHLH-PAS) transcription factor, is likely to bind. In mammalian HEK293 cells, which lack an intrinsic JH receptor, ectopic expression of BmMet2 fused with Gal4DBD induced JH-dependent activity of an upstream activation sequence reporter. Meanwhile, the kJHRE reporter was activated JH-dependently in HEK293 cells only when cotransfected with BmMet2 and BmSRC, another bHLH-PAS family member, suggesting that BmMet2 and BmSRC jointly interact with kJHRE. We also found that the interaction between BmMet2 and BmSRC is dependent on JH. Therefore, we propose the following hypothesis for the mechanism of JH-mediated induction of BmKr-h1: BmMet2 accepts JH as a ligand, JH-liganded BmMet2 interacts with BmSRC, and the JH/BmMet2/BmSRC complex activates BmKr-h1 by interacting with kJHRE.

Heterodimer of two bHLH-PAS proteins mediates juvenile hormone-induced gene expression

Juvenile hormone (JH) plays crucial roles in many aspects of insect life. The Methoprene-tolerant (Met) gene product, a member of the bHLH-PAS family of transcriptional regulators, has been demonstrated to be a key component of the JH signaling pathway. However, the molecular function of Met in JH-induced signal transduction and gene regulation remains to be fully elucidated. Here we show that a transcriptional coactivator of the ecdysteroid receptor complex, FISC, acts as a functional partner of Met in mediating JH-induced gene expression. Met and FISC appear to use their PAS domains to form a dimer only in the presence of JH or JH analogs. In newly emerged adult female mosquitoes, expression of some JH responsive genes is considerably dampened when Met or FISC is depleted by RNAi. Met and FISC are found to be associated with the promoter of the early trypsin gene (AaET) when transcription of this gene is activated by JH. A juvenile hormone response element (JHRE) has been identified in the AaET upstream regulatory region and is bound in vitro by the Met-FISC complex present in the nuclear protein extracts of previtellogenic adult female mosquitoes. In addition, the Drosophila homologs of Met and FISC can also use this mosquito JHRE to activate gene transcription in response to JH in a cell transfection assay. Together, the evidence indicates that Met and FISC form a functional complex on the JHRE in the presence of JH and directly activate transcription of JH target genes.

A DNA-binding protein, tfp1, involved in juvenile hormone-regulated gene expression in Locusta migratoria

A partially palindromic 15-nt. sequence upstream from a juvenile hormone-regulated gene ( jhp21) was previously identified in the African migratory locust, Locusta migratoria. This sequence was proposed as a juvenile hormone (JH) response element (JHRE), and a protein that bound to it, as a transcription factor (TF). A yeast strain was constructed containing four tandem copies of the JHRE and after transfection with a cDNA library made to fat bodies from vitellogenic females, yeast one-hybrid experiments yielded sequences for four putative binding proteins. One of these sequences, corresponding to a transcript that was present in fat body irrespective of JH stimulation, encodes a 35 kDa protein. This was designated tfp1 and appears to have a leucine zipper motif and a lipid-binding motif. Recombinant tfp1 bound to JHRE in electrophoretic mobility shift experiments and addition of tfp1 antibody in the binding reaction resulted in the disappearance or shift of TF. We suggest that JH induces the association of pre-existing proteins, including tfp1, to form an active complex, which binds to the JHRE upstream from jhp21 and regulates its transcription.

Juvenile hormone diol kinase, a calcium-binding protein with kinase activity, from the silkworm, Bombyx mori

Juvenile hormone (JH) diol kinase (JHDK) is an important enzyme involved in the JH degradation pathway. Bombyx mori ( Bommo)-JHDK cDNA (637 bp) contains an open reading frame encoding a 183-amino acid protein, which reveals a high degree of identity to the two previously reported JHDKs. JHDK is similar to GTP-binding proteins with three conserved sequence elements involved in purine nucleotide binding, contains eight α-helices and three EF-hand motifs, and resembles the three-dimensional model of 2SCP and some other calcium-binding proteins. The Bommo-JHDK gene has only a single copy in the silkworm haploid genome, contains only one exon, and its 5′-upstream sequence does not have a JH response element. Although Bommo-JHDK is highly expressed in the gut of the silkworm, its mRNA expression remains at a constant level during larval development suggesting this enzyme is constitutive and not regulated by JH, at least at the transcriptional level. Recombinant Bommo-JHDK catalyzed the conversion of 10 S-JH diol into JH diol phosphate, confirming its enzymatic function. Recombinant enzyme formed a dimer and had biochemical characteristics similar to other JHDKs. Bommo-JHDK, a calcium-binding protein with kinase activity, provides unique insights on how JH levels are regulated in the silkworm.

The homeodomain protein PBX participates in JH-related suppressive regulation on the expression of major plasma protein genes in the silkworm, Bombyx mori

In the silkworm, Bombyx mori, major plasma proteins referred to as 30K proteins are the most abundant proteins in the hemolymph of final (fifth) instar larvae. Surgical extirpation of corpora allata, the source of a juvenile hormone (JH), causes rapid accumulation of 30K proteins in the hemolymph of fourth instar larvae. The 30K protein 6G1 (30K6G1) gene was repressed in primary cultured fat body cells treated with a JH analog (JHA), methoprene. To identify the JH response element present in the promoter region of the 30K6G1 gene, we performed transfection analyses of the 5′-deletion mutants of the 30K6G1 gene using primary cultured fat body cells, gel retardation assays and in vivo footprinting analysis. The results from those analyses revealed that a JH response element exists in the sequence between positions −147 and −140. When the promoter construct mutated at positions −143, −142, and −141 was transfected to fat body primary cultured cells, the suppression effect on the reporter gene expression caused by JHA was reduced. Gel retardation assay using specific antibody revealed that a PBX protein binds to the JH response element. Northern blot analysis revealed that the gene expression of Bombyx PBX is enhanced in the fat body cells by JHA treatment. These results indicate that PBX proteins are involved in the JH signaling pathway and play an important role in suppressing 30K protein gene expression in the fat body of B. mori.

Identification and Characterization of a Juvenile Hormone (JH) Response Region in the JH Esterase Gene from the Spruce Budworm, Choristoneura fumiferana

Using a differential display of mRNA technique we discovered that the juvenile hormone (JH) esterase gene (Cfjhe) from Choristoneura fumiferana is directly induced by juvenile hormone I (JH I), and the JH I induction is suppressed by 20-hydroxyecdysone (20E). To study the mechanism of action of these two hormones in the regulation of expression of this gene, we cloned the 1270-bp promoter region of the Cfjhe gene and identified a 30-bp region that is located between -604 and -574 and is sufficient to support both JH I induction and 20E suppression. This 30-bp region contains two conserved hormone response element half-sites separated by a 4-nucleotide spacer similar to the direct repeat 4 element and is designated as a putative juvenile hormone response element (JHRE). In CF-203 cells, a luciferase reporter placed under the control of JHRE and a minimal promoter was induced by JH I in a dose- and time-dependent manner. Moreover, 20E suppressed this JH I-induced luciferase activity in a dose- and time-dependent manner. Nuclear proteins isolated from JH I-treated CF-203 cells bound to JHRE and the binding was competed by a 100-fold excess of the cold probe but not by 100-fold excess of double-stranded oligonucleotides of unrelated sequence. JH I induced/modified nuclear proteins prior to their binding to JHRE and 20E suppressed this JH I induction/modification. These results suggest that the 30-bp JHRE identified in the Cfjhe gene promoter is sufficient to support JH induction and 20E suppression of the Cfjhe gene.

A locust DNA-binding protein involved in gene regulation by juvenile hormone

Although juvenile hormone (JH) has essential roles in insect development and reproduction, the molecular mechanisms of gene regulation by JH remain an enigma. In Locusta migratoria, the partially palindromic 15-nt sequence, GAGGTTCGAG A/ TCCT T/ C, found upstream of a JH-induced gene, jhp21, was designated as a putative juvenile hormone response element (JHRE). When JH-deprived adult female locusts were treated with the active JH analog, methoprene, a fat body nuclear factor that bound specifically to JHRE appeared after 24 h. Binding exhibited a preference for an inverted repeat with GAGGTTC in the left half-site, a single nucleotide spacer, and a right half-site in which some variation is acceptable. Binding to JHRE was abolished by phosphorylation catalyzed by a C-type protein kinase present in the nuclear extracts. The DNA-binding protein is thus believed to be a transcription factor, which is brought to an active state through the action of JH and then participates in the regulation of certain JH-dependent genes.

Juvenile hormone regulation of an insect gene: a specific transcription factor and a DNA response element

We have used locust fat body nuclear protein extracts and upstream DNA of the juvenile hormone (JH)-inducible locust gene, jhp21, to examine the regulation of specific transcription by JH. Promoter activity was assayed with G-free cassette reporter constructs. Nuclear extracts from adult female fat body, previously exposed to JH or an analog, actively transcribe from the jhp21 promoter and a control adenovirus major late ( AdML) promoter, whereas extracts from JH-deprived female fat body, or other tissues, transcribe strongly from the AdML promoter but weakly or not at all from the jhp21 promoter. Transcription is enhanced by sequences between −140 and −211 nt from the jhp21 transcription start point ( tsp), which include a CAAT box, and also by sequences between −1056 and −1200. A 15-nt partially palindromic sequence element found at −1152, resembling known hormone response elements, was shown to stimulate transcription when restored to truncated jhp21 DNA. Two very similar sequences occur further upstream. In electrophoretic mobility shift assays (EMSA), the same sequence element was shown to specifically bind a protein that was present in nuclear extracts from JH-exposed, but not from JH-deprived, fat body. Several lines of evidence suggest that the DNA element may be a JH response element (JHRE). The JH-induced protein that binds to it appears to be a transcription factor that activates the initiation of JH target gene ( jhp21) transcription, and could be a JH receptor.