Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana.

Azza M Elgendy,Bernard Duvic,Muhammad Tufail,Amr A Mohamed,Makio Takeda

doi:10.3389/fphys.2021.723072

Abstract

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

Highlights

The American cockroach, Periplaneta americana, thrives in temperate climate bands across the globe
In P. americana, we identified a direct repeat separated by a 2-nucleotide spacer designated, Vg1HRE, that is similar to the Drosophila ecdysone response element (EcRE) direct repeat 4 (DR4) (Elgendy et al, 2019)
The non-vitellogenic female nuclear protein extract (NPE) contains a 71 kDa protein that binds to the newly identified Vitellogenin 2 (Vg2) cis-acting elements, Vg2RE. This candidate nuclear protein is still under study. These findings suggest that Vg2RE efficiently drives the expression of Vg2 to support sufficient yolk formation for the developed embryo through the classical juvenile hormone (JH) molecular action including nuclear protein candidates, such as Met receptor and FoxO

Summary

Introduction

The American cockroach, Periplaneta americana, thrives in temperate climate bands across the globe. Cockroaches live in houses, groceries, stores, and hospitals causing disease in humans, such as allergic reactions that include lung and skin reactions They are potential mechanical vectors for several pathogens, such as Clostridium perfringens, Pseudomonas aeruginosa, and Salmonella enterica serotype Bredeney causing anthrax, cholera, and diphtheria, respectively (Baumholtz et al, 1997; Atiokeng Tatang et al, 2017). Their widespread occurrence is due to a high reproductive capacity and rich nutrients supplement to the future developed embryos by female cockroaches. Few studies have investigated the hormone-mediated transcriptional regulation of Vg in hemimetabolous insects (Elgendy et al, 2019; Wu et al, 2021)

Methods

Results

Discussion

Conclusion