Jujube Plants Research Articles

Jujube is at a competitiveness disadvantage to cotton in intercropped system

AbstractIntercropping is a key methodology used by farmers to improve economic benefits. However, in certain areas such as Xinjiang, China, limitations in available irrigation water make intercropping difficult to implement. Farmers are therefore challenged to improve economic benefits in water‐limited conditions. We evaluated the effectiveness of intercropped common jujube (Zizyphus jujuba Mill.) and cotton (Gossypium hirsutum L.) under different irrigation regimes. Using a factorial design, crops were planted individually and together (i.e., intercropping) under five different irrigation systems. We measured growth parameters and evaluated the temporal distribution of root system growth and fruit yield. Intercropped cotton displayed higher fitness metrics and outperformed the single‐cropped cotton in crop yield. Intercropping, however, had the opposite effect on jujube plants: the overall fitness and yield of jujube were significantly curtailed under the interspecific competition induced by this planting technique. Under low irrigation levels, cotton plants tended to invade the jujube niches that reduced jujube growth and development. Our findings suggest that in a jujube/cotton intercropping system, cotton is the dominant competitor, whose ability to inhibit the development of the less competitive jujube is exacerbated under water deficit situations. Although intercropping system affected jujube development, overall cotton yield, and therefore benefit to farmers was considerably higher using this system. However, the competitive ability of jujube gradually increases as the plant aged which could reduce the economic advantages of the intercropping system.

Deficit Irrigation-Nutrient Coupling on Growth, Yield, Fruit Quality and Water Use Efficiency of Indian Jujube

Sustainability of quality fruit production in Indian jujube is adversely affected by improper irrigation and nutrient management. A field study comprising of four irrigation levels (drip irrigation at 0.8, 0.6 and 0.4 of pan evaporation (E0) and surface irrigation at 1.0 IW/CPE with 50 mm depth) and three nutrient levels (100% RDF, 75% RDF+25% RDF as vermicompost and 50% RDF+50% RDF as vermicompost) was conducted during 2018-19 (11 months) on jujube plant. Results showed that tallest tree (3.72 m), greatest tree circumference (0.32 m), maximum fruits tree-1 (563), highest fruit weight (15.5 g) and fruit yield tree-1 (8.42 kg) were recorded with drip irrigation at 0.8 E0 with 100% RDF. Minimum growth, yield components and yield were found with drip irrigation at 0.4 E0 with 50% RDF+50% RDF as vermicompost. Seasonal ETa was 373.6, 409.4 and 446.4 mm for drip irrigation at 0.4, 0.6 and 0.8 E0, respectively and 694 mm for surface irrigation. Maximum CWUE of 18.87 g tree-1 mm-1 was obtained with drip irrigation at 0.8 E0 with 100% RDF. About 55.7-75.5% water was saved by drip irrigations which could bring an additional area of 55.5-85.8% under drip irrigated jujube. Highest predicted yield of 9.02 kg tree-1 was accomplished with 278 mm irrigation water. This model approach could serve as a good guideline to yield potential decision in relation to limited irrigation water for jujube growers in the Indo-Gangetic plains or similar agro-climatic regions.

Molecular Characteristics of Jujube Yellow Mottle-Associated Virus Infecting Jujube (Ziziphus jujuba Mill.) Grown at Aksu in Xinjiang of China.

Chinese jujube (Ziziphus jujuba Mill.) is a native fruit crop in China. Leaf mottle and dapple fruit disease is prevalent in cultivated jujube plants grown at Aksu in Xinjiang Uygur Autonomous Region of China. Jujube yellow mottle-associated virus (JYMaV), a tentative member in the genus Emaravirus, was recently identified from mottle-diseased jujube plants grown in Liaoning Province in China, but its incidence and genetic diversity in China is unknown. In this study, the genome sequences of three JYMaV isolates from two jujube cultivars and one jujube variant were determined by high-throughput sequencing (HTS) for small RNA and rRNA-depleted RNA coupled with RT-PCR assays. Comparison of these sequences together with sequences of the viral RNA segments derived by primer set 3C/5H-based RT-PCR revealed that genetic diversity was present in the virus populations and high sequence variation occurred at the non-translational regions of each of the viral genomic segments. Field investigation confirmed the close association of the virus with leaf mottle symptoms of jujube plants. Furthermore, this study revealed that P5 encoded in the viral RNA5 displayed a nuclear localization feature differing from the plasmodesma (PD) subcellular localization of the virus movement protein (P4), and the two proteins could interact with each other in the BiFC assays. Our study provides a snapshot of JYMaV genetic diversity in its natural hosts.

Ultrasound Assisted Extraction of Phenolic Compounds from a Jujube By-Product with Valuable Bioactivities

Jujube plant is a potential source of polyphenols with biological propreties. The purpose of this study was to investigate the application of ultrasound technique for extracting phenolic compounds (TPC) from seeds of Zizyphus lotus under optimization conditions based on response surface methodology. A maximum TPC, total flavonoids content (TFC), and total condensed tannins content (TTC) of 2383.10 ± 0.87 mg GAE/100g, 486.50 ± 0.38 mg QE/100g and 15,787.10 ± 0.10 mg CE/100g, respectively obtained under ethanol concentration 50.16%, sonication temperature 29.01 °C, sonication time 15.94 min and solvent-to-solid ratio 34.10:1 mL/g. The optimized extract was then evaluated for its antioxidant, antiacethylcholinesterase, antihypercholesterolemia, and antiproliferative activities. The results showed that ultrasound method is a green and safe method that can be used to effectively extract TPC from jujube seeds. The biological activity of Zizyphus extract exhibited a very good antioxidant against DPPH (EC50 = 0.39 µg/mL) and FRAP (1670.42 ± 6.5 mg/100 g). Additionally, it possesses acetylcholinesterase (AChE) inhibitory effect (IC50 = 0.93 ± 0.01 mg/mL) and HMGR inhibition (45.41%) using 100 µg/mL. The extract significantly inhibits cell proliferation on the MCF-7 and HepG2 tumor cell lines with an IC50 values of <0.05 and 3 ± 0.55 mg/mL, respectively. Therefore, the ultrasound method can be considered a method for obtaining a significant anticancer activity with respect to the lines and therefore makes it possible to recover a maximum of phenolic compounds in less time with an AChE and HMGR inhibitory activity. Thus, it can be suggested that Zls extract is a promising fruit for the development of supplementary dietary due to its potential behaviour as nutraceutical.

Comparative population genomics dissects the genetic basis of seven domestication traits in jujube

Jujube (Ziziphus jujuba Mill.) is an important perennial fruit tree with a range of interesting horticultural traits. It was domesticated from wild jujube (Ziziphus acidojujuba), but the genomic variation dynamics and genetic changes underlying its horticultural traits during domestication are poorly understood. Here, we report a comprehensive genome variation map based on the resequencing of 350 accessions, including wild, semi-wild and cultivated jujube plants, at a >15× depth. Using the combination of a genome-wide association study (GWAS) and selective sweep analysis, we identified several candidate genes potentially involved in regulating seven domestication traits in jujube. For fruit shape and kernel shape, we integrated the GWAS approach with transcriptome profiling data, expression analysis and the transgenic validation of a candidate gene to identify a causal gene, ZjFS3, which encodes an ethylene-responsive transcription factor. Similarly, we identified a candidate gene for bearing-shoot length and the number of leaves per bearing shoot and two candidate genes for the seed-setting rate using GWAS. In the selective sweep analysis, we also discovered several putative genes for the presence of prickles on bearing shoots and the postharvest shelf life of fleshy fruits. This study outlines the genetic basis of jujube domestication and evolution and provides a rich genomic resource for mining other horticulturally important genes in jujube.

Preliminary Characterization of the First Phosphate Solubilizing Bacteria Isolated From the Rhizospheric Soil of the Jujube Plant Ziziphus

The use of rhizobacteria that solubilize inorganic phosphates as biofertilizers is considered as a suitable solution for sustainable agriculture. Only limited number of studies have been carried out on the jujube plant Ziziphus, which is frequently encountered the Mediterranean basin, particularly in North Africa. Here, we conducted the first study on jujube to characterize the native phosphate solubilizing bacteria (PSB) from its rhizospheric soil. jujube was selected because of its ability to survive within arid climates by tolerating biotic and abiotic stresses. A total of 41 rhizobacteria isolated from rhizospheric jujube collected from the experimental farm of Benguerir (Morocco) were able to solubilize tri-calcium phosphate (TCP) on NBRIP agar. Next, thirteen of the best performing isolates were subsequently tested for phosphate solubilization in liquid media and for antibiotics resistance. Eleven exhibit a great ability to release soluble phosphate from TCP with ranged concentrations between minima at 160 mg/L and maxima at 260 mg/L. Moreover, several PSB strains confer resistance at least to one of the tested antibiotics. Analysis of 16S rDNA sequencing demonstrated that PSB isolates were closely related to the genus Pseudomonas, Bacillus, Enterobacter, or Paenibacillus.

Identification, expression and miRNA targeting of auxin response factor genes related to phyllody in the witches' broom disease of jujube.

Jujube witches' broom (JWB) disease, associated with the presence of phytoplasmas, induces huge crop losses in the woody perennial fruit tree Ziziphus jujuba. An imbalance in the phytohormone auxin is thought to be a key factor in the development of the witches' broom symptoms, and in the alteration of floral development into leafy structures, termed phyllody. The Auxin Response Factor (ARF) gene family controls auxin-responsive gene expression during plant growth and development. However, it remains unknown if the ARF genes are involved in the formation of leaf-like flowers. In the present study, sixteen jujube ARF genes were identified bioinformatically and annotated based on the Z. jujuba cv. Dongzao genome. The ZjARFs were homologous to 12 out of the 23 Arabidopsis ARFs and were distributed in 8 jujube chromosomes and 3 unmapped scaffolds. Phylogenetic analysis grouped the ZjARFs into three classes. Spatio-temporal expression analysis revealed that the ZjARF genes were differentially expressed among different tissues during normal development. The expression of seven ZjARF genes was significantly decreased from flower buds to flowering. JWB-infected jujube plants developed the typical phyllody symptoms and showed lower auxin accumulation during floral development. ZjARF1, ZjARF2, ZjARF3, ZjARF4 and ZjARF8 resulted differentially regulated after phytoplasma infection. ZjARF4 was down-regulated before and during floral development in phytoplasma-infected plants, but it was significantly up-regulated before flowering and down-regulated during flowering in the healthy plants. Target site analysis showed that miRNA167, miRNA529 and miRNA2950 could directly target ZjARF4. Together, the data showed that the auxin-controlled ARF4 gene is likely involved in the disruption of floral development in phytoplasma-infected jujube plants.

Identification of phytoplasma strains associated with witches’ broom and yellowing in Ziziphus jujube nurseries in Iran

Phytoplasma symptoms, including proliferation, witches’ broom, leaf rolling and yellowing, were observed in jujube (Ziziphus jujube) nurseries in the East of Iran. Total nucleic acid was extracted from symptomatic and symptomless plants, and was tested for phytoplasma presence using nested PCR. Amplicons of about 1.8 kb (primer pair P1/P7) and 1.25 kb (R16F2n/R16R2) were obtained from all symptomatic plants but not from symptomless plants. Restriction fragment length polymorphism (RFLP) analysis of R16F2n/R2 amplicons using KpnI, HaeIII, RsaI, AluI, HpaII, HhaI, TaqI, MseI, BfaI and ThaI restriction enzymes showed two RFLP patterns referable to 16SrI and 16SrVI phytoplasma groups. The consensus sequences of Z. jujube yellowing and witches’ broom of six samples correspond to ‘Candidatus Phytoplasma asteris’ and ‘Candidatus Phytoplasma trifolii’-related strains. Two R16F2n/R16R2 16S rDNA sequences representative of each RFLP profile, one each from witches’ broom (accession number MK379605) and yellowing (MK379604) host symptoms, were submitted to the GenBank. Phylogenetic analysis confirmed that the phytoplasma strains associated with jujube yellowing clustered within the 16SrI phytoplasma clade, and those associated with witches’ broom clustered within the 16SrVI clade. Restriction analysis confirmed that virtual RFLP patterns of the jujube yellowing and witches’ broom phytoplasma strains were identical to the reference pattern of 16SrI-B and 16SrVI-A. This is the first report of these phytoplasma strains associations with witches’ broom and yellowing in jujube plants.

Effect of pruning intensity on soil moisture and water use efficiency in jujube (Ziziphus jujube Mill.) plantations in the hilly Loess Plateau Region, China

Jujube (Ziziphus jujube Mill.) is a traditional economic forest crop and is widely cultivated in hilly areas of the Loess Plateau, China. However, soil desiccation was discovered in jujube plantations. Pruning is recognized as a water-saving method that can reduces soil water consumption. In this study, we monitored the jujube plots with control (CK), light (C1), medium (C2) and high (C3) pruning intensities during the jujube growing period of 2012–2015 to explore the effect of pruning intensity on soil moisture and water use efficiency (WUE) of jujube plantations in the hilly Loess Plateau Region. The results showed that pruning is an effective method for soil water conservation in jujube plantations. Soil moisture increased with increasing pruning intensity during the jujube growing period of 2012–2015. C1, C2 and C3 pruning intensities increased soil water storage by 6.1–18.3, 14.4–40.0 and 24.3–63.3 mm, respectively, compared to CK pruning intensity. Pruning promoted soil moisture infiltration to deeper soil layer. Soil moisture infiltrated to soil depths of 240, 280 and >300 cm under C3 pruning intensity, 220, 260 and 260 cm under C2 pruning intensity, 200, 240 and 220 cm under C1 pruning intensity, and 180, 200 and 160 cm under CK pruning intensity in 2013, 2014 and 2015, respectively. Soil water deficit was alleviated by higher pruning intensity. In 2013–2015, soil water change was positive under C2 (6.4 mm) and C3 (26.8 mm) pruning intensities but negative under C1 (−20.5 mm) and CK (−40.6 mm) pruning intensities. Moreover, pruning significantly improved fresh fruit yield and WUE of jujube plants. Fresh fruit yields were highest under C1 pruning intensity with the values of 6897.1–13,059.3 kg/hm2, which were 2758.4–4712.8, 385.7–1432.1 and 802.8–2331.5 kg/hm2 higher than those under CK, C2, and C3 pruning intensities during the jujube growing period of 2012–2015, respectively. However, C3 pruning intensity had the highest WUE values of 2.92–3.13 kg/m3, which were 1.6–2.0, 1.1–1.2 and 1.0–1.1 times greater than those under CK, C1 and C2 pruning intensities, respectively. Therefore, C3 pruning intensity is recommended to jujube plantations for its economic and ecological benefits. These results provide an alternative strategy to mitigate soil desiccation in jujube plantations in the hilly Loess Plateau Region, which is critical for sustainable cultivation of economic forest trees in this region.

Coordinated changes in photosynthetic machinery performance and water relations of the xerophytic shrub Ziziphus lotus (L.) Lam. (Rhamnaceae) following soil drying

Aim of this study was to investigate the effect of water shortage in wild jujube plants, Ziziphus lotus (L.) Lam, and how it is related to its ecological success. All leaf anatomical traits were significantly affected following soil drying. Stressed plants displayed more negative stem water potential (ψw) and osmotic potential values of ca. -3.5 and -4.5 MPa, respectively, after 30 d. The relative water content declined although it still maintained high values (≥ 75%). The net photosynthetic rate, stomatal conductance, and transpiration rate were significantly inhibited as ψw decreased. However, the intrinsic water-use efficiency increased as water deficit was intensified; the difference became significant only after 30 d. As a consequence, the effective quantum yield of PSII photochemistry and the photochemical quenching coefficient significantly decreased although the maximal quantum yield of PSII photochemistry ratio remained statisticaly unchanged. Plants could maintain their water status sufficiently by increasing proline 1.7-fold and sucrose 1.8-fold in their leaves, respectively. The largest accumulation of both solutes may avoid photodamages at cellular level and play a critical role in maintaining osmotic adjustment.

A new phytoplasma strain in group 16SrV associated with witches'broom disease of Ziziphus oenoplia in Karnataka, India

Ziziphus oenoplia, also known as jackal jujube or small fruited jujube is a spiny, evergreen small tropical fruit tree. During a survey in October-November 2019, the jujube trees exhibited severe witches’ broom symptoms, therefore, an investigation was carried out, to verify the presence of phytoplasmas in these symptomatic plants. Total DNA was extracted from leaves of jujube plants using a CTAB method and a PCR assay was performed using 16S rRNA gene specific primer pairs P1/P7 and 3Far/3Rev. Amplicons of about 1.3 kb were consistently amplified from all the symptomatic plant samples in nested PCR assays, while, no amplification was observed in non-symptomatic samples. The phylogenetic analysis of 16Sr DNA sequence of the detected phytoplasma strain indicates its clustering with ‘Candidatus Phytoplasma balanitae’ strains and also its close relatedness to 16SrV-F subgroup phytoplasmas. The virtual RFLP analysis of the 16Sr DNA sequence revealed that it could tentatively be classified into a novel phytoplasma subgroup since its AluI restriction profile was unique to earlier reported subgroup strains in 16SrV group.

Transformation With a JrVTE1 Gene for Tocopherol Cyclase Increasing the Content Of Total Tocopherol in Sour Jujube (Zizyphus jujuba Mill.var. spinosus Hu.)

Tocopherol cyclase (VTE1) plays a key role in promoting the production of tocopherol and increasing vitamin E content in plants. JrVTE1 gene isolated and cloned from walnut was transformed into genome of sour jujube (Zizyphus jujuba Mill. var. spinosus Hu.) by Agrobacterium tumefaciens. Putative transgenic lines were checked by polymerase chain reaction (PCR). The content of tocopherol of the transgenic plants were determined by high performance liquid chromatography (HPLC). Compared to the non-transgenic sour jujube plants, the total content of tocopherol in transgenic plants was markedly increased in all tested tissues including the stems and leaves.

Effects of pruning and mulching measures on annual soil moisture, yield, and water use efficiency in jujube (Ziziphus jujube Mill.) plantations

Soil desiccation and water shortage are major challenges of rain-fed crop production in the semi-arid areas of the Loess Plateau of China. Mulching and pruning were considered effective strategies to improve harvest by reducing soil water evaporation and plant transpiration rates. In the present study, the possible synergistic effects of the combination of mulching and pruning on soil water status, growth, yield, and water use efficiency were explored in the jujube plant. Field experiments were conducted in a typical hilly semi-arid region over three growing seasons and two dormancy seasons in 2015–2017. The three treatments applied to mountain jujube plantations throughout the year were grassland (CK), regular pruning (PR), and pruning and mulching (PM). Soil water storage (0–200 cm) was higher in the PM than the PR treatment but lower than that of the CK in all three growing seasons. Relative to PR and CK, PM significantly decreased soil water loss during the dormancy season. The soil moisture infiltration depths were 300 cm, 160 cm, and 420 cm in 2016 and 420 cm, 280 cm, and 460 cm in 2017 for PM, PR, and CK, respectively. Soil desiccation was substantially reduced under the PM treatment in the deep soil layer but was less effectively mitigated under the PR treatment. In the CK treatment, soil desiccation appeared at 0–200 cm but was alleviated by heavy rainfall. Fresh fruit yield ranged from 6643–11,056 kg ha−1 for the PM treatment in 2015–2017. This range was 1221–2628 kg ha−1 higher than that for the PR treatment. Water use efficiency was 2.28 kg m−3, 2.05 kg m−3, and 2.22 kg m−3 under the PM treatment in 2015, 2016, and 2017, respectively. These rates were 1.27 × , 1.26 × , and 1.39 × higher, respectively, than those for the PR treatment. These results suggest that the combination of mulching and pruning is an alternative strategy for mitigating soil desiccation in the hilly regions of the Loess Plateau of China. This alternative land management system may be critical for the sustainable cultivation of economically important forest trees in the Loess Plateau region and elsewhere.

Transcriptome analysis of genes involved in defense against alkaline stress in roots of wild jujube (Ziziphus acidojujuba).

Wild jujube (Ziziphus acidojujuba Mill.) is highly tolerant to alkaline, saline and drought stress; however, no studies have performed transcriptome profiling to study the response of wild jujube to these and other abiotic stresses. In this study, we examined the tolerance of wild jujube to NaHCO3-NaOH solution and analyzed gene expression profiles in response to alkaline stress. Physiological experiments revealed that H2O2 content in leaves increased significantly and root activity decreased quickly during alkaline of pH 9.5 treatment. For transcriptome analysis, wild jujube plants grown hydroponically were treated with NaHCO3-NaOH solution for 0, 1, and 12 h and six transcriptomes from roots were built. In total, 32,758 genes were generated, and 3,604 differentially expressed genes (DEGs) were identified. After 1 h, 853 genes showed significantly different expression between control and treated plants; after 12 h, expression of 2,856 genes was significantly different. The expression pattern of nine genes was validated by quantitative real-time PCR. After gene annotation and gene ontology enrichment analysis, the genes encoding transcriptional factors, serine/threonine-protein kinases, heat shock proteins, cysteine-like kinases, calmodulin-like proteins, and reactive oxygen species (ROS) scavengers were found to be closely involved in alkaline stress response. These results will provide useful insights for elucidating the mechanisms underlying alkaline tolerance in wild jujube.

Comparative transcriptome analysis of Ziziphus jujuba infected by jujube witches’ broom phytoplasmas

Abstract Ziziphus jujuba is one of the most important and widely grown fruits in China. Jujube witches' broom (JWB), an important disease in Z. jujube, could cause heavy loss for its industry. The disease is associated with the presence of ‘Candidatus Phytoplasma ziziphi’, a prokaryote, and very little knowledge is known about its interactions with jujube plants. Therefore, in the present study cDNA samples from healthy and diseased plants were sequenced on Illumina HISeq2000 and gene expression and metabolism regulation were compared. In the two libraries obtained from the leaves, 4266 differentially expressed genes (DEGs) were identified. Among them, 2070 genes were upregulated, and 2196 genes were downregulated. The comparison between the libraries from flowers showed 3800 DEGs, with 1965 upregulated and 1835 down-regulated genes. Among all these some specific genes were identified to be functionally related to the amino acid metabolism and the carotenoid pathway, which may be related to the lack of nutrition and the main symptoms of yellowing, brooming and small leaves. The results of this work provides a valuable resource for further studies of the disease on genetic and molecular levels.

Effects of arbuscular mycorrhizae on growth and mineral nutrition of greenhouse propagated fruit trees from diverse geographic provenances

Description of the subject. Arbuscular mycorrhizal (AM) fungi are known to promote plant growth by enhancing mineral uptake in nutrient deficient soils. These beneficial effects on plant growth may vary considerably between cultivars of a given species and between plant species originating from different locations. Objectives. The present experiment evaluated the response of three Sahelian fruit trees: néré (Parkia biglobosa [Jacq.] G.Don), tamarind (Tamarindus indica L.), and jujube (Ziziphus mauritiana Lam.), originating from five different geographic provenances, to mycorrhizal colonization, evaluate their respective mycorrhizal dependency (MD) and analyze their leaf and stem mineral composition. Method. Trees were cultivated in a nursery on pre-sterilized soil substrate low in available P (2.18 μg·g-1) with or without inoculum of Glomus aggregatum (Schenck & Smith emend. Koske). The experiment was arranged in a factorial design for each fruit tree species separately: 5 provenances x 2 AM treatments (inoculated and non-inoculated [control]) with 10 replicates per treatment. Plants were harvested six months after inoculation and different parameters were measured. Results. Overall, the results showed significant provenance variations in the plant response to mycorrhizal inoculation. Néré mycorrhizal plants, from two seed sources, tamarind and jujube plants from one seed source had significant higher dry weight and shoot height than those from other provenances. Jujube plants from 3 out of the 5 provenances showed significant higher MD. It then appears that seed provenance happened to be determinant even though AM-root colonization levels (80-90%) do not vary much from one provenance to another. In all cases, the fruit trees benefited from AM fungi with increased N, P and K mineral uptake in aerial parts. In particular P uptake was proportional to MD concentration in AM-jujube plants. Conclusions. These results demonstrate the importance of considering seed provenance when performing pre-selection of mycotrophic plant candidates prior to large-scale fruit tree propagation in orchards and agroforestry systems.

Jujube fruit water relations at fruit maturation in response to water deficits

The fruit maturation stage is considered the optimal phenological stage for implementing water deficit in jujube (Zizyphus jujuba Mill.), since a low, moderate or severe water deficit at this time has no effect on yield, fruit volume or eating quality. However, no information exists at fruit water relations level on the mechanisms developed by Z. jujuba to confront drought. The purpose of the present study was to increase our understanding of the relationship between leaf and fruit water relations of jujube plants under different irrigation conditions during fruit maturation, paying special attention to analysing whether fruit size depends on fruit turgor. For this, adult jujube trees (cv. Grande de Albatera) were subjected to five irrigation treatments. Control plants (T0) were irrigated daily above their crop water requirements in order to attain non-limiting soil water conditions in 2012 and 2013. T1 plants were subjected to deficit irrigation throughout the 2012 season, according to the criteria frequently used by the growers in the area. T2 (2012), T3 and T4 (2013) were irrigated as T0 except during fruit maturation, in which irrigation was withheld for 32, 17 and 24 days, respectively. The results indicated that the jujube fruit maturation period was clearly sensitive to water deficit. During most of this stage water could enter the fruits via the phloem rather than via the xylem. From the beginning of water withholding to when maximum water stress levels were achieved, fruit and leaf turgor were maintained in plants under water deficit. However, a direct relation between turgor and fruit size was not found in jujube fruits, which could be due to an enhancement of a cell elasticity mechanism (elastic adjustment) which maintains fruit turgor by reducing fruit cells size or to the fact that jujube fruit growth depends on the fruit growth-effective turgor rather than just turgor pressure.

Soil water and root distribution under jujube plantations in the semiarid Loess Plateau region, China

This study aimed to analyze the spatial correlation between soil water and root distribution in dense-dwarf jujube plantations in the Hilly Loess Region (HLR) of China. The soil coring method was used to sample roots at different depths within the 0–1,000 cm soil profile. The results showed that increase in average annual root depth decreased with increasing jujube stand age. The maximum root depth of the 12-year-old jujube was 520 cm. The difference between the maximum and minimum root depths in the 12-year-old jujube trees was 180 cm. Lateral roots started developing intersection networks 3 years after planting. Soil water fluctuation was not induced by vertical root systems of dense-dwarf jujube plants. With increasing jujube stand age, root depth, dry soil layer depth (below 240 cm) and annual soil water variance within the top 0–200 cm soil layer increased. However, root-zone soil water content decreased with increasing stand age while dry soil layer depth was slightly larger than root depth. The results of this study have important significance to provide vital technical support for jujube cultivation especially under semiarid conditions and were expected to find application in water management for plantations in the HLR.

Laboratory Testing of the Toxicity of Jujube (Zizyphus jujuba) Oil and Leaf Extracts AgainstCulex pipiens(Diptera: Culicidae)

Botanical insecticides are considered to be the best alternative to synthetic chemical insecticides because they pose little threat to the environment or to human health. This study is the first report on the effect of jujube (Zizyphus jujuba) plant extracts against larvae of Culex pipiens mosquitoes. The study was designed to evaluate the larvicidal potency of jujube plant oil, dry ground leaves, and organic extracts of leaves using different solvents against third instar larvae. The ingredients of jujube were extracted by two ways: by grinding fresh leaves immediately in solvents or by soaking dry ground leaves powder in solvents for 72 h. The results showed that larvae were highly susceptible to jujube oil, plant extracts and crude plant powder. The best results were obtained with jujube oil, followed by the dry leaf extract in petroleum ether, and finally the crude plant powder. Histological and ultrastructural studies on jujube oil-treated larvae revealed that gut, muscles and cuticle layers were severely damaged, which indicates the toxic effect of jujube oil. In conclusion, the jujube plant oil and organic extracts are promising agents for controlling Cx. pipiens larvae.

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China.

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China.