ITS rRNA Gene Sequences Research Articles

Production of α-amylase from Aspergillus flavus S2-OY using solid substrate fermentation of potato (Solanum tuberosum L.) peel

Amylases find commercial applications in diverse industries. This study investigated the production of α-amylase from a fungus, using potato peel as an alternative substrate. Six fungal isolates from the soil of cassava waste dumpsite were tentatively identified as two Aspergillus species and one species each of Rhizopus, Trichocladium, Neosartorya and Ascodermis. They were screened for their relative amylolytic activities using the starch agar hydrolysis test. Molecular characterization, using the ITS rRNA gene sequencing, was used to confirm the identity of the selected fungus as Aspergillus flavus S2-OY. Amylase production from the fungus via solid substrate fermentation of potato peel was carried out and the effect of production parameters investigated. Maximum α-amylase production was at an incubation period of 72 h, pH of 5.0 and temperature of 25 °C. Casein and maltose were the best nitrogen and carbon sources, respectively while the optima inoculum and moisture volumes for enzyme production were 1.5 mL and 5.0 mL, respectively. Aspergillus flavus S2-OY has great potential for α-amylase production using potato peel as an alternative and cheap substrate, under solid substrate fermentation condition. This has implications for the cost-effective production of an industrial enzyme and reduction of environmental pollution problems through effectual management of agro-industrial wastes.

Additives improved saprotrophic fungi for formation of humic acids in chicken manure and corn stover mix composting

The objective of this study was to analyze the effects of additives (biochar (BC) and palygorskite (PG)) on predominant fungi succession throughout composting of corn stover/chicken manure mix to influence humic substances formation (HS). Results indicated that BC and PG promoted the polymerization of HS and formation of more humic acids (HA), and BC performed better than PG, 10% additive was better than 5%. ITS rRNA gene sequencing showed that predominant fungi succession was significantly affected by BC and PG in composting, correlation between HS formation and predominant fungi indicated that BC and PG boosted lignocellulose-degrading fungi which could break down fulvic acids (FA) and HM to form more HA. Fungi function analysis showed that 10% BC significantly increased saprotrophic fungi, and decreased pathogenic fungi. Therefore, addition of 10% BC was conductive to promote the formation of HA and improve compost quality.

First Detection of Ditylenchus destructor Parasitizing Maize in Northeast China

Maize is one of the most important crops in the world. Heilongjiang province has the largest maize area in China. Plant-parasitic nematodes are important agricultural pests, which cause huge economic losses every year and have attracted global attention. Potato rot nematode Ditylenchus destructor is a plant-parasitic nematode with a wide range of hosts and strong survival ability in different environments, which brings risks to agricultural production. In 2020, D. destructor was detected in seven maize fields in Heilongjiang province. Morphological identification and molecular approach were used to characterize the isolated D. destructor. The observed morphological and morphometric characteristics were highly similar and consistent with the existing description. The DNA sequencing on the D2/D3 region of the ribosomal DNA 28S and the phylogenetic analysis showed that D. destructor population obtained from maize and other isolates infesting carrot, sweet potato, and potato were in subclade I supported by a 96% bootstrap value. Additionally, the phylogenetic analysis of the ITS rRNA gene sequence further indicated that this D. destructor population from maize clustered in a clade I group and belonged to ITS rRNA haplotype C. An inoculation experiment revealed that D. destructor was pathogenic on the maize seedlings in pots and caused the disease symptoms in the stem base of maize seedlings. This is the first report of D. destructor causing stem rot of maize in Heilongjiang province, and contributes additional information on disease control and safe production of maize in the region.

Effects of Cd-resistant fungi on uptake and translocation of Cd by soybean seedlings

In this study, three cadmium (Cd)-resistant fungal strains, temporarily named as F1, F2 and F3 were isolated from the roots of Cd-tolerant soybean cultivars, rhizosphere and bulk soils, respectively, in contaminated sites. Cd-resistant strains F1, F2 and F3 were characterized for their effect on biomass, Cd uptake and translocation of two soybean cultivars (Liaodou36 and Liaodou33) grown in Cd-contaminated soils. The results showed that Cd concentration decreased significantly in Cd-supplemented culture solutions inoculated with strains F1, F2 and F3 compared to non-inoculated controls, while cell counts significantly increased during the incubation. The increase in shoot biomass of two soybean cultivars inoculated with strains F1, F2 and F3 ranged from 13% to 29%, 16%–27% and 15%–32%, respectively, compared to controls. Strain F2 had a higher potential to reduce the water-soluble Cd content (23% and 40%) and EDTA-extractable Cd content in the rhizosphere soil of Liaodou36 and Liaodou33 seedlings compared to strains F1 and F3. A significant decrease of Cd contents was observed in the root and shoot of Liaodou33 inoculated with strain F2 compared to non-inoculated controls, and inoculation with strain F2 significantly reduced the TF and BCF of Liaodou33 in comparison with controls. Based on ITS rRNA gene sequence analyses, the strains F1, F2 and F3 were identified as Mucor circinelloides (similarity 99.81%), Curvularia lunata (similarity 99.31%) and Clonostachys rosea (similarity 99.17%). The results of our study demonstrated that the strain F2 had a higher Cd biosorption and immobilization potential than strains F1 and F3. The strain F2 promoted the growth and reduced Cd uptake and translocation of Liaodou33 in Cd-polluted soils. It is worth noting that our results might provide an effective technical support for Cd immobilization remediation and safe soybean production by inoculating moderate Cd-accumulating soybean cultivars with strain F2 in Cd-contaminated soils.

Assembly processes of abundant and rare microbial communities in orchard soil under a cover crop at different periods

Soil microorganisms play key roles in agricultural ecosystems. However, little is known about their dynamic diversity patterns and community assembly processes, especially in the rare microbial biosphere in agriculture systems. In this study, we determined the responses of diversities and assembly processes of abundant and rare bacterial and fungal subcommunities to agricultural practice (i.e. cover crop) in a semiarid orchard soil by using 16S and ITS rRNA gene sequencing. We found that the community structures of abundant and rare taxa exhibited a similar response to cover crop or growth periods. Growth periods significantly changed the bacterial and fungal subcommunities structure. Only the fungal subcommunities structure was affected by cover crop. The community assembly of abundant and rare fungi was respectively dominated by stochastic process and deterministic process and less affected by cover crop and growth period. For abundant bacteria, the assembly process was dominated by heterogeneous and undominated processes, and the importance of heterogeneous selection process was increased by cover crop at setting and maturing period. The assembly process of rare bacterial community was dominated by a homogeneous selection and the relative importance of dispersal limitation was increased at maturing period. We also found that the assembly processes of abundant taxa were significantly related to the soil DON, NH4+-N, NO3–-N and pH, while the assembly processes of rare taxa were significantly related to the soil DOC, AP and SOC. Our results provide new insights into the formation of the microbial community in orchard soil under a cover crop, especially the seasonal succession of abundant and rare bacterial and fungal subcommunities.

Intestinal microbiota changes induced by TNF-inhibitors in IBD-related spondyloarthritis

BackgroundThe close relationship between joints and gut inflammation has long been known and several data suggest that dysbiosis could link spondyloarthritis (SpA) to inflammatory bowel diseases (IBD). The introduction of...

Changes in soil bacterial and fungal community composition and functional groups during the succession of boreal forests

Clarifying the response of soil microbial communities and their potential functions during succession is of great significance for understanding the biogeochemical processes and the sustainability of forest development. However, the study of microbial community dynamics during the process of succession remains poorly understood in boreal forest ecosystems. Thus, in order to study the dynamics of microbial diversity caused by succession, we adopted the "space instead of time" method and selected four habitats in a national natural reserve (including grassland, birch forest, mixed forest and larch forest) to represent the primary successional sequence of the boreal forest. We used 16S and ITS rRNA gene sequencing to detect bacterial and fungal communities and used FAPROTAX and FUNGuild database to predict bacterial and fungal functional groups. The results showed that forest succession significantly changed the community composition of bacteria and fungi, among which the fungal community was more sensitive to the changes with successional stage. The relative abundance of ectomycorrhizal fungi significantly increased with succession, while the relative abundance of bacterial functional groups involved in the nitrogen cycle did not change significantly, indicating that fungi might play a major regulatory role in the nutrient cycling process during the successional process. In this study, the soil total carbon and total nitrogen were the dominating factors affecting the soil microbial community and the structure of fungal functional groups. Our results suggest that the shifts in fungal community structure and functional groups may play a key role in soil nutrient cycling during boreal ecosystems succession.

Short-Term Effect in Soil Microbial Community of Two Strategies of Recovering Degraded Area in Brazilian Savanna: A Pilot Case Study.

The Brazilian Cerrado is a highland tropical savanna considered a biodiversity hotspot with many endemic species of plants and animals. Over the years, most of the native areas of this biome became arable areas, and with inadequate management, some are nowadays at varying levels of degradation stage. Crop-livestock integrated systems (CLIS) are one option for the recovery of areas in degradation, improving the physicochemical and biological characteristics of the soil while increasing income and mitigating risks due to product diversification. Little is known about the effect of CLIS on the soil microbial community. Therefore, we perform this pilot case study to support further research on recovering degraded areas. The bacterial and fungal soil communities in the area with CLIS were compared to an area under moderate recovery (low-input recovering - LI) and native savanna (NS) area. Bacterial and fungal communities were investigated by 16S and ITS rRNA gene sequencing (deep rRNA sequencing). Ktedonobacteraceae and AD3 families were found predominantly in LI, confirming the relationship of the members of the Chloroflexi phylum in challenging environmental conditions, which can be evidenced in LI. The CLIS soil presented 63 exclusive bacterial families that were not found in LI or NS and presented a higher bacterial richness, which can be related to good land management. The NS area shared 21 and 6 families with CLIS and LI, respectively, suggesting that the intervention method used in the analyzed period brings microbial diversity closer to the conditions of the native area, demonstrating a trend of approximation between NS and CLIS even in the short term. The most abundant fungal phylum in NS treatment was Basidiomycota and Mucoromycota, whereas Ascomycota predominated in CLIS and LI. The fungal community needs more time to recover and to approximate from the native area than the bacterial community. However, according to the analysis of bacteria, the CLIS area behaved differently from the LI area, showing that this treatment induces a faster response to the increase in species richness, tending to more accelerated recovery. Results obtained herein encourage CLIS as a sustainable alternative for recovery and production in degraded areas.

Report of the Texas peanut root-knot nematode, Meloidogyne haplanaria (Tylenchida: Meloidogynidae) from American pitcher plants (Sarracenia sp.) in California.

During the winter and spring of 2021, the root-knot nematodes were extracted from samples of galled roots of potted American pitcher plants (Sarracenia sp.). Samples were collected from a botanical garden nursery in Los Angeles County, California. The root-knot nematode was identified by molecular methods as Meloidogyne haplanaria. In the USA, M. haplanaria was initially found in Texas, and subsequently reported from Arkansas and Florida. Molecular characterization of the Californian M. haplanaria isolate was done using the analysis of the D2-D3 of 28S rRNA, ITS rRNA, mitochondrial l-rRNA, COI, and nad5 gene sequences. Some rRNA gene clusters of M. haplanaria were similar with those of M. arenaria. Possible hybridization events within mitotic parthenogenetic root-knot nematodes are discussed. This study confirmed that reliable diagnostics of M. haplanaria should be based on mtDNA sequence analysis. This is a first report of M. haplanaria from Sarracenia sp. and California. Consequently, this nematode was considered to be eradicated from this botanical garden nursery and the State of California.

Phosphorus forms in the sediment of seagrass meadows affected mainly by fungi rather than bacteria: a preliminary study based on 31P-NMR and high-throughput sequencing

Abstract Microorganisms play an important role in the circulation of phosphorus (P) in the sediment of coastal wetland ecosystems. In this study, solution 31P nuclear magnetic resonance (NMR) was used to determine different forms of P in the sediments of four different seagrass meadows and a bare tidal flat, while high-throughput 16S and ITS rRNA gene sequencing was used to determine the microbial community composition. The solution 31P-NMR spectra revealed six forms of the P compounds detected by the NaOH-EDTA extraction of sediments, where Ortho-P was the most dominant P compound, followed by Mono-P. The Po compounds were more varied in the seagrass meadow sediments and more abundant compared to the bare tidal flat. Bacterial communities in the sediments collected from E. acoroides and fungal communities in the bare tidal flat were relatively different from those at the other sites. The relative abundance of P-cycling-related fungi belonging to the phylum Ascomycota was 26.20% and was much higher than that of bacteria (only 0.29%) belonging to the class Bacilli. Mono-P was the major factor determining the distribution of P-cycling-related fungi and negatively correlated with the relative abundance of Aspergillus and Trichoderma. We believe that fungi can affect P forms in the sediment of seagrass meadows more than bacteria.

Impact of a Nature-Inspired Engineered Soil Structure on Microbial Diversity and Community Composition in the Bulk Soil and Rhizosphere of Tomato Grown Under Saline Irrigation Water

Smart Capillary Barrier (SCB) has been recently promoted to decrease soil salinity and improve water use efficiency and the sustainability of arid land agriculture. In this study, we investigated the effect of SCB on soil microbial diversity, enumeration, and respiration in a tomato field trial. SCB soil and control (unstructured homogenous soils, H) plots were irrigated with four levels of salinity (ECw = 0.8, 3, 6, and 9 dS m−1). Microbial diversity was assessed by ITS and 16S rRNA gene sequencing, enumeration of culturable heterotrophs by agar plates, and microbial respiration by MicroResp™ assays. Salinity was the main driver of the soil microbial diversity, showing a substantial reduction in the number of operational taxonomic units (− 8% for both bacteria and fungi), enumeration of culturable heterotrophs (− 51% for bacteria and − 53% for fungi), and respiration (− 18%) at 9 dS m−1 water salinity. Microbial community composition was significantly different between the SCB and H soils, as evidenced by multivariate analyses and by the appearance of 3352 unique operational taxonomic units at SCB samples that were absent in H plots. The SCB soil showed a steeper metabolic quotient increase in response to soil salinity than the H soils. The abundance of functional microbes such as nitrogen-fixing and nitrifying prokaryotes, as well as mycorrhiza, was also significantly increased in the SCB soils in comparison with the H soils. Our findings suggest that adopting SCB design leads to higher overall soil microbial biodiversity, including those communities unable to withstand extreme soil salinity conditions.

Molecular characterisation and phylogenetic relationships of sedentary nematodes of the genus Meloinema Choi & Geraert, 1974 (Nematoda: Tylenchida)

Summary Molecular characterisation of two species of Meloinema: M. chitwoodi from Oregon, USA, and M. odesanens from South Korea, is given based on the partial 18S rRNA, the D2-D3 of 28S rRNA, ITS rRNA, and COI gene sequences. In the phylogenetic trees, Meloinema clustered with Meloidogyne, in a basal position and more closely with Meloidogyne indica and M. nataliei. The Shimodaira-Hasegawa (SH) maximum likelihood testing of an alternative topology with two gene fragments (D2-D3 of 28S rRNA and 18S rRNA genes) did not reject a sister relationship of Meloidogyne and Meloinema. Molecular results confirmed the view of Siddiqi (2000) that Meloidogyne and Meloinema evolved from a Pratylenchidae-type ancestor. The clade Meloinema + Meloidogyne + Nacobbus was rejected by the SH test of the D2-D3 of 28S rRNA gene sequence dataset. The molecular results suggested that the genus Nacobbus should be placed not in the Meloidogynidae, but in a separate subfamily, the Nacobbinae, under the family Pratylenchidae.

Antimicrobial finishing of hide/leather by atmospheric pressure plasma and extracts of Cassia renigera and Cassia fistula bark

In this study, pre-tanning stage goat hide was treated with atmospheric pressure air dielectric barrier discharge with the aim to provide an eco-friendly antimicrobial finishing. The untreated and the air plasma-treated hide pieces were incubated in sterilized agar media. Upon incubation, untreated sample showed noteworthy growth of fungus, while the plasma-treated piece remains unaffected which clearly reveals the sterilization capacity of the plasma treatment. The fungus grown on untreated sample was cultured and identified with fungal specific ITS rRNA gene sequence and Basic Local Alignment Search Tool and found to be strains of Curvularia sp. with 100% similarity to Curvularia caricae-papayae and 99% similarity to Curvularia pseudobrachyspora. The untreated and plasma-treated goat hide samples were subsequently dipped into the extract obtained from bark of two Cassia species: Cassia renigera and Cassia fistula to provide antifungal/antibacterial finishing. Effectiveness of this anti-fungal finishing was demonstrated by inoculating the samples with culture of the fungus and incubation. The obtained results indicate that samples treated with the plasma and the extracts finishing deliver substantial antifungal activity in comparison to that of untreated extract finished goat hide. Additionally, the plasma treated followed by plant extract finished samples provide evidence of antibacterial finish which has been confirmed by zone of inhibition against a Gram-positive bacteria Staphylococcus aureus. Activation of hide surface and generation of various functional groups due to the plasma treatment were accountable for better uptake of the extracts and thus imparting antimicrobial finish.

Anti-Helicobacter pylori Activity of Red Sea Hyrtios erectus sponge and micro-organisms Extracts

Helicobacter pylori were considered one of the most bacterial infections in the world. Recently, the resistance of antibiotic against H. pylori is increasing and hence, it is necessary to find new and natural effective agents. Marine organisms and microorganism produce complex secondary metabolites and some of these compounds are antimicrobials agents. This study aimed to provide preliminary data to determine if marine Hyrtios erectus sponge, actinomycetes, and fungi extracts can inhibit the growth of H. pylori. In this study, the methanol extracts of the three samples of Hyrtios erectus sponge and the ethyl acetate extracts of seven actinomycetes strains and four fungi strains were used to determine the antibacterial effect against a standard strain of H. pylori. The samples of actinomycetes and fungi were identified by using 16S rRNA amplification for actinomycetes and Internal Transcribed Spacer-PCR for fungi using Genetic Analyzer 3500, and then the DNA sequences were compared through BLAST and alignment with other actinomycetes and fungi which already present in the GenBank from various study areas. Results indicated that the anti-H. pylori screening showed that only 13 from 14 extracts exhibited anti-H. pylori effect. Among them, the methanol extract of Hyrtios erectus (1), the ethyl acetate extract of actinomycete strain S7 and the ethyl acetate extracts of fungi strains M1, M2, M3, M4 exhibited strong effect against H. pylori more than other extract with minimal inhibitory concentrations 3.9, 15.63, 3.9, 15.63, 3.9 and 7.81 µg/ml, respectively. The 16S rRNA and ITS rRNA gene sequences and phylogenetic analysis provided strong evidence for the isolates of actinomycetes and fungi, respectively. The actinomycetes were identified as seven species that belong to Streptomyces genus. The fungi isolates were identified as three species that belong to Aspergillus genus and one species that belong to Penicillium genus.

First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.

Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24-48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines. Measurements of females (n = 20) included vulval slit length = 26.4 ± 2.7 (23.6 to 31.2) µm, vulval slit to anus distance = 22.1 ± 2.4 (18.9 to 24.7) µm. The J2s had long and narrow tails with bluntly rounded tail tips and distinct hyaline tail termini. Measurements of J2s (n = 20) were body length = 432.4 ± 23.1 (386.8 to 465.3) µm, body width = 16.2 ± 1.8 (14.2 to 18.9) µm, stylet = 12.8 ± 0.5 (11.6 to 13.7) µm, dorsal esophageal gland orifice to stylet base = 3.6 ± 0.4 (3.1 to 4.8) µm, tail = 52.9 ± 3.8 (46.3 to 61.4) µm, hyaline tail length = 15.7 ± 2.6 (12.5 to 19.2) µm. These morphological characteristics were consistent with the original description of M. enterolobii (Yang and Eisenback 1983). Molecular biology analyses were also conducted to confirm species identification. Genomic DNA was extracted from a single J2 (Song et al. 2017). The ITS rRNA gene and D2-D3 region of the 28S rRNA gene were amplified using the primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The ITS rRNA gene sequence (765 bp, GenBank accession No. MT654126) was 100% identical to M. enterolobii sequences previously obtained from Fujian, China (MT406251) and Vietnam (MG773551), and the D2/D3 region sequence of 28S rRNA gene (759 bp, MT654127) revealed 99% identity with M. enterolobii sequences from Fujian (MT193450) and Taiwan (KP411230), China, and South Carolina, USA (MH800969). In addition, species identification was further confirmed using the M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) and MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA/CGAACTCGCTCGAACTCGAC), respectively (Long et al. 2006; Tigano et al. 2010). The PCR products had the expected fragment lengths of 236 bp and 520 bp, which were consistent with those previously reported for M. enterolobii (Long et al. 2006; Tigano et al. 2010). The pathogenicity test of this nematode was performed in a greenhouse at 25°C. Ten industrial hemp seedlings (cv. Longma No. 5 ) maintained in 12-cm diameter and 12-cm high pots containing autoclaved soil, were inoculated with 800 freshly hatched J2s of the original population of M. enterolobii per plant, and 8 non-inoculated seedlings were used as controls. At 60 d after inoculation, all inoculated plants exhibited gall symptoms on the roots similar to those in the field, and the nematode reproduction factor (final population density/initial population density) was 18.2. No symptoms were observed on control plants. These results confirmed the pathogenicity of M. enterolobii on industrial hemp. To our knowledge, this is the first report of industrial hemp as a new host of M. enterolobii in China. As M. enterolobii has a broad host range, a strong pathogenicity, and a high reproduction rate, it could become a major threat to industrial hemp production. Further monitoring and research on effective control strategies are needed.

Cactodera solani n. sp. (Nematoda: Heteroderidae), a new species of cyst-forming nematode parasitising tomato in Mexico

Summary A new species of cyst-forming nematode, Cactodera solani n. sp., from Mexico is described. The new species was found in a glasshouse in Mexico City parasitising tomato and common lambsquarter. This cyst nematode has light brown to almost black cysts, presents a small vulval cone with circumfenestra and morphologically it most resembles C. milleri. Cactodera solani n. sp. can be differentiated from C. milleri by having smaller cysts that are 417 (291-581) × 324 (204-505) vs 632 (515-730) × 506 (419-598) μm in size and a longer stylet in the second-stage juveniles of 25 (24-27) vs 22 (21-23) μm. Phylogenetic relationships within populations and species of Cactodera are given based on the analysis of the ITS rRNA and the partial COI gene sequences. The ITS rRNA and COI gene sequences clearly differentiated C. solani n. sp. from other Cactodera species. This new cyst-forming nematode has several generations per year and its life cycle can be completed in 49 days on tomato and in 40 days on common lambsquarter at 20-25°C.

Characterization of a new spiral nematode, Helicotylenchus asiaticus n. sp., and three known species from Korea; with comments on the validity of Helicotylenchus microlobus Perry in Perry, Darling & Thorne, 1959

A new spiral nematode Helicotylenchus asiaticus n. sp., recovered from sandy rhizosphere of Poa pratensis from Korea, is characterized based on integrative taxonomy, considering both morphological and molecular phylogenetic inferences from analyses of the 28S-rRNA and ITS-rRNA gene sequences. Additionally, H. caudatus is characterized for the first time outside its type locality; notes on the taxonomic status of H. microlobus are stated, and the existence of H. dihystera in Korea is molecularly confirmed. The new species is characterized by a lip region not offset; hemispherical, bearing 4–5 annuli; stylet knobs sloping posteriorly, rarely anteriorly flattened; spermatheca, offset and filled with sperms; incisures of the lateral field areolated in pharyngeal region, with incomplete areolation in the tail region; inner incisures usually distally modified into a u-shape or y-shaped configuration; phasmids postanal, situated at 3–8 annuli posterior to anus level; tail conical, bearing 8–15 annuli, ending in a rounded to pointed extremity; and males abundant. The new species is morphologically similar to H. erythrinae, H. californicus, H. electropicus, H. tropicus, H. conicus, H. elegans, H. interrogativus, H. saxeus, H. certus and H. silvaticus but differs from all, either by lip region shape, stylet knob shape, sperm filled spermatheca, phasmid position, tail termini shape and (or) presence of males. Sequence data analyses from amplified regions suggest that Helicotylenchus asiaticus n. sp. is a sister species to unidentified Helicotylenchus sp. From Korea.

Temporal and spatial variation of soil microorganisms and nutrient under white clover cover

Cover crops have been implemented for decades as sustainable agricultural soil management practice. However, knowledge about the temporal and spatial variation in soil nutrients and the succession of microorganisms during soil restoration under cover crops maintained for a different number of years are still poorly understood. Here, using the 16S and ITS rRNA gene sequencing techniques, we investigated the evolution of microbial community structure, and the pattern of nutrient accumulation was analyzed in a chronosequence of white clover used as a cover crop for 4, 8, and 13 years in a semiarid orchard on the Loess Plateau, China. Clean tillage was used as the control. We found that 4 years of cover crop had little effect on the soil nutrients, while 8- and 13-year-old cover crops contributed greatly to the soil nutrients. The use of cover crops for 13 years effectively increased the bacterial alpha diversity and the relative abundances of Actinobacteria, Firmicutes and Ascomycota in the 0−20 cm soil layer. These results indicated that long-term organic input stimulated transformation of the dominant population of microorganisms into a population conducive to the decomposition of plant residues. Furthermore, bacteria were more sensitive to the implementation of cover practices than fungi. Notably, on the genus level, the evolution of the bacterial community structure was more stable, while the evolution of the fungal community structure was more disordered with an increase in the years of cover crop. The nitrogen components were the best environmental predictors of the state of the microbial community. Overall, this study adds to our understanding of the patterns of nutrient accumulation and microbial succession under different years of cover crops and has implications for the formulation of a sustainable development strategy in semiarid agriculture systems.

Purification, characterization and optimization conditions of protease produced by Aspergillus brasiliensis strain BCW2

Proteases are a group of enzymes in high demand due to their wide and different biotechnological applications. However, the cost of production of proteases on industrial scale is high. Hence, this study was aimed at screening fungal strains having ability to produce protease using cheaper agricultural wastes, purifying and characterizing the protease produced. Fungi isolated were screened for protease production and identified using traditional and molecular means. Optimum conditions for protease production, purification and characterization were determined using standard methods. Proteolytic activity of the selected isolate BCW2 measured in zone of hydrolysis was 38 mm. The selected isolate shared 99% sequence homology with Aspergillus brasiliensis JC-A3. Hence, the isolate was tagged as Aspergillus brasiliensis BCW2. Production of protease by solid state fermentation was optimum at pH 9.0, temperature of 30 °C, 10% orange peel as carbon source, 2% yeast as nitrogen source, 60% moisture content and an incubation period of 72 h. The purified protease has a molecular weight of 68 KDa, a yield of 28% and 13.3 fold. The partially purified protease was stable between pH 4-6 and temperature of 30-40 °C, exhibited enhanced activity with Ca2+, and Tween-20 and had specificity to gelatin as substrate. The suitability of orange peel as a substrate for protease production by the strain Aspergillus brasiliensis BCW2 will reduce production cost. The use of orange peel as organic substrate is first being reported through this work. The purified enzyme has de-clotting and blood stains removal properties, making the enzyme open up to wider biotechnological applications. GenBank accession number for the strain A. brasiliensis BCW2 ITS rRNA gene sequence is MF599164.1.

Taxonomic notes on three Tylenchorhynchus spp. (Nematoda, Telotylenchidae) associated with turfgrass in Korea

Two populations of Tylenchorhynchus annulatus, recovered from loamy-soil rhizosphere of Zoysia japonica from Korea are described and illustrated based on integrative taxonomy, considering both morphological and molecular phylogenetic inferences from analyses of the 28S-rRNA and ITS-rRNA gene sequences. One of the populations manifested variation in species diagnostic characters; continuous lateral field incisures past the phasmid was not a constant character in all specimens examined, with some specimens manifesting fusion of inner incisures of the lateral field below the level of the phasmid and incomplete areolation of the lateral fields. The fusion of the inner incisures of the lateral field past the phasmid level is therefore a variable character within the group, and when used alone, may not be taxonomically reliable to delineate species within the genus. This is molecularly supported by genetic resemblance of the two populations with other characterized T. annulatus isolates based on D2-D3 expansion segment and ITS-rRNA. The overlapping disparities between the two populations are therefore herein treated as intraspecific variations within T. annulatus populations. Furthermore, comparison within all the published sequences of T. annulatus are made and recommendations for sequence corrections are given. Tylenchorhynchus thermophilus is characterized herein for the first time in Korea while T. annulatus and T. claytoni are molecularly confirmed.