Tomato yellow leaf curl virus (TYLCV) was first detected in Reunion in 1997, based on symptoms and partial sequence data between the conserved nonanucleotide and the first 5 ′ quarter of the capsid protein (CP) gene (Peterschmitt et al ., 1999). A 516 bp portion of the C4 gene of the same isolate of TYLCV from Reunion was subsequently sequenced (Accession No. AJ842312), showing that it belonged to the mild strain (TYLCVMld[RE]) and the so-called nonrecombinant group (Navas-Castillo et al ., 2000). In April 2004, severe symptoms of stunting, yellowing and leaf curling, resembling the symptoms of tomato yellow leaf curl disease, were observed on tomato plants in Saint Gilles in the north-west region of Reunion. Twenty-two leaf samples from affected tomato plants were collected and tested for the presence of begomoviruses using a PCR assay with two sets of primers designed to amplify two regions of the A component of TYLCV: primers V2790 and C837 amplify a 800 bp fragment spanning the intergenic conserved region (IR) nonanucleotide sequence and two-thirds of the CP gene, while primers TY1944 (TTGTTTTGCCTGTTCTGCTA) and TY2460 (CATCTCCATGTGCTTATCCA) amplify a 516 bp portion of the C4 gene. The latter region was chosen to differentiate the Israeli strain (syn. TYLCV-IL Accession No. X15656) from the mild strain (TYLCVMld; Accession No. X76319). All the leaf samples produced PCR products of the expected size with both sets of primers. For three samples, a 483 bp fragment of the C4 gene was sequenced using the primer set TY1944/TY2460 (Accession Nos AJ842309, AJ842310, AJ842311) and a 685 bp fragment of IR/CP region was sequenced using the primer set V2790 (ATCCGTATAATATTACCGGATGG) and C837 GCAAATCATTCTTCACTGTTGC) (Accession Nos AJ842306, AJ842307, AJ842308). The sequences were aligned with those of known TYLCV strains using dnaman (Lynnon Biosoft, Quebec, Canada). The 685 bp fragment showed 98–99% nucleotide identity with TYLCV, TYLCV-Mld and -Mld[RE]. However, the 483 bp fragment showed a 98% nucleotide identity with TYLCV, but only 77% nucleotide identity with TYLCV-Mld and the previous Reunion isolate TYLCV-Mld[RE]. This is the first report of the presence of the Israeli strain, which belongs to the so-called recombinant group of TYLCV, from Reunion island.