Isolates Of Ralstonia Solanacearum Research Articles

Management of seed borne ralstonia solanacearum in brinjal (Solanum melongena L.) and tomato (Lycopersicon esculentum Mill.)

Total of 165 bacterial isolates of Ralstonia solanacearum were collected from different seed samples of tomato and brinjal in various seed sources and 22 isolates were tested to find out the management tools among different management approaches. Hundred percent reduction of bacterial incidence was found with Gentamicin (0.1, 0.05%), Erythromycin (0.1, 0.05%) and Doxycycline (0.1%) over control in both brinjal and tomato treated seeds in nutrient agar medium. Seed treatment with BAU-Biofungicide (3%) exhibited 83.61% decreases of bacterial incidence over control in tomato and 90.28% reduction in brinjal seeds. Garlic also showed better performance in controlling R. solanacearum among the plant extracts. Antibiotic sensitivity test revealed that maximum number of isolates of R. solanacearum was found to be sensitive to Gentamicin and Erythromycin, and the highest number of isolate of R. solanacearum of tomato and brinjal seeds marked resistant to Doxycycline. Higher germination 40.38% was achieved over control in tomato seed and 26.67% germination was in brinjal seed when the seeds were treated with BAU-Biofungicide (3%). Among all the treatments, BAU-Biofungicide (3%) also resulted in the highest increase of vigor index (77.36%) in tomato and brinjal seed with an increase of 69.91% over untreated control. Bangladesh J. Bot. 53(1): 173-183, 2024 (March)

Evaluation of virulence among Pakistani isolates of Ralstonia solanacearum inducing bacterial wilt in chilies across different agro-ecological zones

Evaluation of virulence among Pakistani isolates of Ralstonia solanacearum inducing bacterial wilt in chilies across different agro-ecological zones

Isolation and characterization of Ralstonia solanacearum causing wilt disease in tomato

Bacterial wilt, caused by Ralstonia solanacearum, is the most serious and common disease that affects tomatoes globally. Tomato bacterial wilt is among the worst and most prevalent diseases in Ethiopia. It causes substantial tomato production losses in various parts of the country. The purpose of this study was to isolate and characterize Ralstonia solanacearum causing wilt disease in tomato. Ralstonia solanacearum isolates were isolated from wilted tomato stem samples using Casamino Acid Peptone Glucose Agar (CPG) plates and incubated at 28 ± 2 °C for 48 h. Bacterial colonies showing big, irregular smooth, and cream-white, were considered presumptive Ralstonia solanacearum isolates. Morphological, biochemical, and pathological characterization were used for identification of the bacterium. Biovar identification was determined based on the utilization of carbohydrates. A total of 76 Ralstonia solanacearum isolates were screened and identified as Ralstonia solanacearum. Out of all the isolates, 28.9% of the isolates were isolated from Mecha, followed by Fogera (27.6%), Dera (23.7%), and Bahir Dar Zuria (19.7%) districts. The pathogenicity test results also revealed that all Ralstonia solanacearum isolates tested caused wilt symptoms in tomato plants and had varying levels of virulence on tomato plants, ranging from highly virulent (G1B1, G2M2, G3H1, and G4F3 isolates) to moderately virulent (G1B1, G2M1, G2M3, G3H2, G4F1, and G4F2 isolates). Besides, 48 Ralstonia solanacearum isolates were identified as Biovar II, and 28 Ralstonia solanacearum isolates were identified as biovar III. The overall findings of this study could provide valuable information for integrated tomato bacterial wilt disease management. The molecular characterization should be carried out on Ralstonia solanacearum in different host ranges.

QTL Mapping for Resistance to Bacterial Wilt Caused by Two Isolates of Ralstonia solanacearum in Chili Pepper (Capsicum annuum L.).

Bacterial wilt caused by the β-proteobacterium Ralstonia solanacearum is one of the most destructive soil-borne pathogens in peppers (Capsicum annuum L.) worldwide. Cultivated pepper fields in Korea face a continuous spread of this pathogen due to global warming. The most efficient and sustainable strategy for controlling bacterial wilt is to develop resistant pepper varieties. Resistance, which is quantitatively inherited, occurs differentially depending on R. solanacearum isolates. Therefore, in this study, we aimed to identify resistance quantitative trait loci (QTLs) in two F2 populations derived from self-pollination of a highly resistant pepper cultivar ‘Konesian hot’ using a moderately pathogenic ‘HS’ isolate and a highly pathogenic ‘HWA’ isolate of R. solanacearum for inoculation, via genotyping-by-sequencing analysis. QTL analysis revealed five QTLs, Bwr6w-7.2, Bwr6w-8.1, Bwr6w-9.1, Bwr6w-9.2, and Bwr6w-10.1, conferring resistance to the ‘HS’ isolate with R2 values of 13.05, 12.67, 15.07, 10.46, and 9.69%, respectively, and three QTLs, Bwr6w-5.1, Bwr6w-6.1, and Bwr6w-7.1, resistant to the ‘HWA’ isolate with phenotypic variances of 19.67, 16.50, and 12.56%, respectively. Additionally, six high-resolution melting (HRM) markers closely linked to the QTLs were developed. In all the markers, the mean disease index of the paternal genotype was significantly lower than that of the maternal genotype. The QTLs and HRM markers are expected to be useful for the development of pepper varieties with high resistance to bacterial wilt.

Investigation of virulence diversity in Ralstonia solanacearum isolates by a random amplified polymorphic DNA collected from Egyptian potato fields

In this study, a total of ten bacterial isolates obtained from the wilted potato plants in Egypt, identified as Ralstonia solanacearum race 3 (biovar II) were used to study the differentiation among the isolates by RAPD marker analysis. In pathogenicity experiments, all isolates demonstrated typical wilt disease symptoms on potato plants. However, the level of virulence was significantly different as the isolates GK1, GT2, and AM8 were highly virulent one isolate “ES6” was moderate virulent and one isolate “SA9” was virulent.Molecular characterization of virulent, moderate virulent, and low virulent isolates along with five avirulent isolates (originated from the same regions) was performed by RAPD marker analysis using six random ten-mer primers. The results of RAPD marker analysis showed significant variation (9-12) in the number of fragments having molecular weight from 219 to 1120 bp. The results presented here demonstrated that no correlation was observed between the RAPD profile and the geographicaly originated strains.

Bactericidal activity of some plant essential oils against Ralstonia solanacearum infection

Potato plants and their tubers in Egypt are affected by one of the most renowned soil-borne pathogen, Ralstonia solanacearum, that caused brown rot in potato tubers and wilt in plants. There is no efficient therapeutic bactericide so; control of bacterial wilt is very rough.The study investigated three different concentrations of seven essential plant oils under in vitro and in vivo conditions as a result of their effects on Ralstonia solanacearum growth and their possibility use as potato seed pieces dressing for controlling bacterial wilt disease incidence. In vitro, anise oil at the three tested different concentrations (0.04, 0.07, and 0.14% vol/vol) was the most effective one inhibiting the growth of T4 and W9 isolates of Ralstonia solanacearum then pursued by thyme, lemongrass, and clove oils. On the other hand, rocket oil at the tested concentration was the least effective one followed by fennel oil. However, wheat germ oil was not completely effective. In vivo, experiment revealed that anise oil at the three concentrations significantly reduced disease incidence and severity in sponta and hermes potato cultivars and their effect was associated with increase of peroxidase, polyphenoloxidase, phenols and the foliar fresh weight of treated plants as well as the weight of tubers/plant followed by thyme and lemongrass oils compared to the infected untreated control.Morphological differences in bacterial cell structure have been observed using a transmission electron microscope (TEM). Anise oil at higher concentration caused of cell wall rupture and degraded cellular components.

Characterization and diversity of Indian isolates of Ralstonia solanacearum inciting bacterial wilt of tomato

Tomato (Solanum lycopersicum L.) a native of South America is a source of vitamins, minerals and antioxidant lycopene, and considered as protective food. In India, the crop is grown under the area of about 0.458 M ha with production of 7.277 M mt and productivity of 15.9 mt/ha. Biotic factors play a role in low productivity of the crops in India. Among various diseases, bacterial wilt disease incited by Ralstonia solanacearum (Smith) Yabuuchi et al. (1996) is a devastating bacterium causing damage to the crop ranging from 2 to 95% depending on the seasons and cultivars. In India, majority of the isolates of R. solanacearum infecting tomato crop belonged to biovar 3, race 1 and phylotype I. However, less than 10% isolates of the bacteria belonged to biovar 4 particularly in the states of Jharkhand and Himachal Pradesh. The genetic diversity of R. solanacearum has been studied by using methods such as random amplified polymorphic DNA (RAPD), PCR—RFLP (PCR—Restriction Length Fragment Polymorphism) of hrp gene, Repetitive element palindromic-polymerase chain reaction (Rep-PCR) and multilocus sequence typing (MLST). The genetic diversity was recorded in Indian R. solanacearum isolates irrespective of their occurrence in different agro-climatic conditions.

Morphological, Pathological, Biochemical and Molecular Characterization of <i>Ralstonia solanacearum</i> Isolates in Bangladesh

One thirty samples (fifty-five potato tubers, twenty-seven potato stems, three chili stems, twenty-eight soil samples, five weed samples, three banana leaves, and nine water samples) were examined and one hundred six (106) Bangladeshi isolates of Ralstonia solanacearum were isolated and identified. Isolation was made on selective media (Tetrazolium chloride media) and R. solanacearum was identified based on morphological, pathological and biochemical properties and polymerase chain reaction (PCR) by using the species-specific primers. Studies showed that 81.54% (106) samples were positive on tetrazolium chloride solid medium. Among them 90 isolates were virulent and rest of them were avirulent. Fifty isolates were selected for chemical characterization based on hypersensitivity test. R. solanacearum is gram negative, aerobic facultative bacteria on the basis of chemical characterization. Fifty tested isolates expressed as race 3 while in biovar test forty-eight showed as biovar III and the rest two showed as biovar I. In nine tested isolates from the three districts a species-specific band of 280 bp was amplified in PCR that confirmed the identity of R. solanacerum.

Pathological and biochemical descriptors of Ralstonia solanacearum of tomato (Solanum lycopersicum) in Tanzania

An experiment was conducted to identify bacterial wilt disease-causing isolates of Ralstonia solanacearum (Smith) in Tanzania. The pathological and biochemical descriptors were used to determine the virulence and biovars of 40 bacterial isolates originating from 200 wilted tomato (Solanum lycopersicum L.) stems collected from the main agro ecological zones of Tanzania. Results revealed that 53% of the investigated isolates were pathogenic, whereas 90% of isolates belonged to biovar 3 and the rest (10%) were biovar 2. Biovar 3 was present in all of the surveyed agroecological zones, whereas biovar2 prevailed in Southern zone only and is reported for the first time in Tanzania. This is an alert for plant health officers to implement standard phytosanitary measures in preventing new introduction and spread of Ralstonia to uninfected locations. Descriptors adopted successfully identified biovars of Ralstonia, thus can be integrated with other diagnosis tools to manage bacterial wilt disease.

Genetic Structure of Ralstonia solanacearum and Ralstonia pseudosolanacearum in Brazil

Bacterial wilt-causing Ralstonia threaten numerous crops throughout the world. We studied the population structure of 196 isolates of Ralstonia solanacearum and 39 isolates of Ralstonia pseudosolanacearum, which were collected from potato- and tomato-growing areas in 19 states of Brazil. Regardless of the species, three groups of isolates were identified. One group encompassed R. pseudosolanacearum isolates. The other two groups comprise isolates of R. solanacearum (phylotype II) split according to geographic regions, one made of isolates from the North and Northeast and the other made of isolates from the Central, Southeast, and South regions (CSS). Among the isolates collected in CSS, those from tomato were genetically distinct from the potato isolates. The genetic variability in the population of R. pseudosolanacearum was lower than that of R. solanacearum, suggesting that the former was introduced in Brazil. Conversely, the high genetic variability of R. solanacearum in all regions, hosts, and times supports the hypothesis that this species is autochthonous in South America, more precisely in Brazil and Peru. For R. solanacearum, higher variability and lower migration rates were observed when tomato isolates were analyzed, indicating that the variability is caused mainly by the differences of the local, native soil population. The North subpopulation was distinct from all others, possibly because of differences in environmental features of this region. The proximity of some geographic regions and the movement of potato tubers could have facilitated migration and therefore low genetic differentiation between geographic regions. Finally, geography, which also influences host distribution, affects the structure of the population of R. solanacearum in Brazil. Despite quarantine procedures in Brazil, increasing levels of trade are a threat to biosecurity, and these results emphasize the need for improving our regional efforts to prevent the dispersal of pathogens.

Genomic sequencing of two isolates of Ralstonia solanacearum causing Sergipe facies and comparative analysis with Bugtok disease isolates.

Ralstonia solanacearum is the causal agent of Moko disease in bananas, which in the state of Sergipe in northeastern Brazil causes “Sergipe facies”. This disease induces atypical symptoms similar to those of Bugtok disease in the Philippines. This study was conducted to sequence, assemble, and annotate the genomes of the Sergipe facies-causing isolates SFC and IBSBF2570 (sequevar IIA-53) and compare their genomes with two representative isolates causing Bugtok disease. The genomes were sequenced and assembled, resulting in lengths of 5.58 Mb (SFC) and 5.46 Mb (IBSBF2570) in 185 and 174 contigs, respectively. The isolates of Sergipe facies and Bugtok disease showed similarities in their gene contents. We identified 5,668 information clusters, 3,752 of which were shared by all genomes (core genes). Moreover, 3,585 single-copy genes were identified. Isolates causing Bugtok disease exclusively shared 266 more information clusters than the isolates causing Sergipe facies. These results suggest that Sergipe facies and Bugtok disease isolates show high genomic similarity. However, the similarity is even greater between the Bugtok disease isolates. This may be because of their longer period of interaction compared to Sergipe facies isolates.

Control of Ralstonia solanacearum on Selected Solaneceous Crops in Greenhouse by Selected Soil Amendments

Aims: The aim of this study was to establish the effect of selected soil amendments on Ralstonia solanacearum isolates in greenhouse on selected solaneceous crops.
 Study Design: The study was laid out as randomized complete block design (RCBD) in split pot arrangement for two seasons in the greenhouse.
 Place and Duration of Study: The experiment was carried out in Kenyattta University situated in Kiambu County about 20 km from Nairobi city along Nairobi-Thika road between July, 2017- September, 2017 and between November, 2017- January, 2018.
 Methodology: The three host crops of interest (potatoes, tomatoes and capsicum) were inoculated with prepared pure bacterial isolates; 18 (2T-Kiambu-Low Land), 71(2A-Nyeri-Low Land), 67 (2A-Nyeri-High Land), 83 (2T-Kirinyaga-Highland) and MX (18/71/67/83). Potatoes, tomatoes and capsicum were planted in pots each with a radius of 0.07 m (area 0.015 m2).The experiment had a total of 450 pots having a total area of 6.93 m2. The treatments were ChalimTM, Super-hydro-grow polymer + Metham sodium, Metham sodium, Metham sodium & Orange peel, Super-hydro-grow polymer, Brassica tissues, ChalimTM + Super-hydro-grow polymer, Brassica tissue + Orange peel, Metham sodium + Super-hydro-grow polymer and Control (no amendments).
 Results: There were significant differences (P≤0.05) in the bacterial wilt incidences in selected solaneceous crops between control and all the soil amendments used in season 1 and 2. Brassica tissue + Super-hydro-grow polymer was superior in reducing bacterial wilt incidences in selected solaneceous crops in all the R. solanacearum isolates from Kenyan highlands and lowlands both in season 1 and 2.
 Conclusion: Organic and inorganic soil amendments could serve as a viable control of bacterial wilt in solaneceous crops caused by R. solanacearum in the greenhouse.

Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan

In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyl-tetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.

Phylotypes of the potato bacterial wilt pathogen in the Philippines and their relationship to pathogen aggressiveness

Three hundred seventy-two Ralstonia solanacearum isolates were collected from potato fields, in the Philippines, and characterized based on phylotypes, distribution and aggressiveness to host plants. Two major genetic group were identified: Phylotype I (Asiaticum), which were predominant in the southern region (Bukidnon), and Phylotype II (Americanum), found mainly in the northern region (Benguet). Phylotypes I and II were both pathogenic to tomato and potato host plants, but Phylotype I induced significantly earlier wilting symptoms to tomato and potato than Phylotype II (P = 0.03 – <0.01). No correlation was found between elevation and phylotype distribution (coefficient = 0.03–0.22). Based on the current taxonomic classification of R. solanacearum species complex, R. pseudosolanacearum and R. solanacearum cause potato bacterial wilt in the Philippines. Implications for quarantine regulations and breeding programs are discussed.

Characterisation and diversity of Indian isolates of Ralstonia solanacearum causing bacterial wilt of Capsicum annuum L.

Genetic diversity of 13 isolates of Ralstonia solanacearum causing bacterial wilt in hot pepper and bell pepper (Capsicum annuum L.) from 6 states of India was assessed. All isolates of R. solanacearum belonged to biovar 3, race 1 and phylotype I. These isolates consisted of 4 distinct DNA types at 75% similarity coefficient using ERIC, BOX and REP-PCRs techniques. Multilocus sequence analysis of hrpB, fliC and egl genes of 6 isolates of R. solanacearum along with 2 out group bacteria was done and they showed high level of variability within these three regions of the genome involving in pathogenicity.

Antigenic and pathogenicity activities of Ralstonia solanacearum race 3 biovar 2 molecularly identified and detected by indirect ELISA using polyclonal antibodies generated in rabbits

Eight molecular-characterized isolates of Ralstonia solanacearum from potato belonging to race 3 biovar 2, their virulence were evaluated on potato cv. Lady Rosette, tomato cv. Strain B, eggplant cv. Balady and pepper cv. Balady and showed high virulence on potato and tomato, and lower virulence on eggplant and pepper. A laboratory study conducted to produce polyclonal antibodies against the potato brown rot bacterium; R. solanacearum cells were generated in female New Zealand white rabbits. A modification were made on the technique of indirect enzyme-linked immunosorbent assay (ELISA) to improve the sensitivity of detection, including antigenic and sensitivity to R. solanacearum race 3 biovar 2 isolates. Determination of the optimum period to collect the antiserum (including, polyclonal antibodies) showed that the best collection dates were at 14, 3 and 7 days, in that order. The efficiency of the antiserum was compared among 42 isolates that cause potato brown rot disease; our polyclonal antiserum (14 days) reacted positively with all tested isolates at a dilution of 1:6.4 × 103. Data indicated the different reactions of eight R. solanacearum isolates at various dilutions (1:1.6 × 103 to 1:5.12 × 106) at 14 days against polyclonal antiserumat a concentration of approximately 1 × 108 CFU/mL and we found the lowest detection level by the indirect ELISA technique was 106 CFU/mL. Finally we recommended the reasonable sensitivity results of the ELISA technique to detect the bacterial pathogen given than the cost of this technique if much lower than that of other expensive molecular techniques.

Genetic diversity of Indian isolates of Ralstonia solanacearum causing bacterial wilt of eggplant (Solanum melongena)

Thirty-eight isolates of Ralstonia solanacearum were isolated from wilted eggplants from seven states of India, i.e. Uttarakhand, Himachal Pradesh, Jharkhand, Odisha, West Bengal, Karnataka and Meghalaya on TTC medium to study their genetic diversity using BOX, ERIC and REP-PCR’s. All isolates of R. solanacearum produced fluidal, irregular pinkish-white colonies and they belonged to biovar 3, race 1 and phylotype I. The study also included five out-group bacteria (Bacillus subtilis DTBS-5, Pseudomonas fluorescence DTPF-3, Xanthomonas campestris pv. campestris Xcc-C4, X. citri subsp. citri Xac-C63 and X. oryzae pv. oryzae Xoo-4). The isolates of R. solanacearum and out group bacteria were grouped into10 DNA types at 75% similarity coefficient. Maximum 11 isolates of R. solanacearum isolated from West Bengal were grouped into DNA Type 2. The isolates collected from Uttarakhand grouped into DNA types 6, 7, 8 and 10. However, all out-group bacteria were clearly separated from the isolates of R. solanacearum as DNA type 9. Multilocus sequence analysis of 18 isolates of R. solanacearum along with sequences obtained from NCBI database of 2 out- group bacteria (Burkholderia multivoransATCC-17616 and X. campestris pv. campestris ATCC-33913) was done using sequences of hrpB (hypersensitive response gene), fliC (flagelline protein) and egl (endoglucanase gene). Sequence comparisons showed high level of variability within these three regions of the genome involved in pathogenicity. On the basis of phylogenetic analysis, the selective pressure on virulence-related genes of R. solanacearum was identified. This genetic diversity presents major challenges for developing effective long-term management strategies to control the wilt disease of eggplant.

Selective media for detection and quantification of Brazilian Ralstonia solanacearum isolates in soil

ABSTRACT The efficacy of five selective media described in the literature for the detection of Ralstonia solanacearum in soil was evaluated using isolates from different regions of Brazil. The selective media were evaluated regarding their sensitivity, target-pathogen repression index, capacity for suppressing contaminating microorganisms and recovery rate of the pathogen in soil. No bacterial growth was observed at the concentrations tested for FSM and SM-1 media. Some isolates grew on the PCCG medium with the addition of antimicrobial agents, but only at concentrations of 106 cfu/mL. For the SM and SMSA-E media, adequate sensitivity for the detection of R. solanacearum in soil was observed, enabling detection at a concentration of approximately 103 cfu/gram of soil. SMSA-E (Selective Medium South Africa - Elphinstone) was found to be the most effective in suppressing the growth of contaminating microorganisms, resulting in the lowest rate of repression of R. solanacearum and the highest recovery rate of the bacterium in the soil.

Molecular characterization of Ralstonia solanacearum strains from Ethiopia and tracing potential source of bacterial wilt disease outbreak in seed potatoes

Bacterial wilt, caused by Ralstonia solanacearum, is emerging as a major threat to potato production in Ethiopia, reaching epidemic proportions in the Chencha district recently, with a prevalence of 97% of potato fields in 2015. The recent disease outbreak in the district coincided with a significant introduction of seed potatoes. This research was therefore initiated to genetically characterize the pathogen so as to trace its source, identify its relationship with outbreaks in the rest of the country, and make intervention recommendations. Ralstonia solanacearum isolates were sampled both from seed and ware potato fields in Chencha and from seed potato fields in production regions suspected of being potential sources of the pathogen. Multiplex PCR and phylogenetic analysis of partial endoglucanase gene sequences identified all of the isolates as phylotype IIB sequevar 1. VNTR sequence analysis distinguished 11 different haplotypes, nine of which were unique to the Chencha district. However, one of the haplotypes was common to all seed potato producer regions of Ethiopia except for the Shashemene area. The unique and diverse VNTR haplotypes of the pathogen in Chencha indicates that it is well established in the district. When a geographical map of the VNTR haplotypes was superimposed with the main cross‐regional seed potato distribution pattern of the country, it became evident that the pathogen was being disseminated via latently infected seed from the Holeta‐Jeldu area in the Central Highlands of Ethiopia. Identification of largely uninfected highland districts and multiplication of high‐grade seed potato exclusively in those districts should be given priority.

English

Development of molecular biology based techniques have led to reliable characterization and determination of the genetic diversity among phytopathogens. Single-strand conformation polymorphism (SSCP) and Low-stringency single specific primer (LSSP)-PCR were assessed for genetic typing of Ralstonia solanacearum isolates from suspicious bacterial wilt fields. R. solanacearum isolates obtained were amplified by colony PCR analysis with egl specific primers which amplified a PCR product of 237 bp. These amplified products were denatured and separated in a polyacrylamide gel to develop PCR-SSCP fingerprints, which confirms R. solanacearum by producing similar four banding patterns. The amplified product of colony-PCR was subsequently used as a template for LSSP-PCR analysis. The individual genotyping of each R. solanacearum obtained by LSSP-PCR were able to discriminate solanaceae and ginger isolates into two different clusters along with pathogenic and non-pathogenic. The LSSP-PCR profile of R. solanacearum isolates were closely related and evolved by the genome of host origin and diverge in genomic stability which was further confirmed by sequence analysis. In conclusion, SSCP and LSSP-PCR techniques were most effective compared to biochemical and physiological assays for identification and genetic variability in R. solanacearum, which has high genetic divergence. The rapid identification of R. solanacearum plays a crucial role in prevention of bacterial wilt. Key words: Ralstonia solanacearum, Bacterial wilt, SSCP-PCR, LSSP-PCR, Molecular detection.