Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan

Muhammad Junaid,Muhammad Ali,Musharaf Ahmad,Yousaf Noor,Amina Bibi

doi:10.21608/nrmj.2019.30611

Abstract

In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyl-tetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.

Highlights

Tomato (Solanum lycopersicum L.) is one of the most important vegetable crops of the world, and is a member of the Solanaceae family
Among which; tomato Bacterial wilt (BW) caused by R. solanacearum (Smith) was considered to be one of the most destructive diseases, due to its economic impact
The current study focuses on the pathogenicity and molecular identification of R. solanacearum

Summary

Introduction

Tomato (Solanum lycopersicum L.) is one of the most important vegetable crops of the world, and is a member of the Solanaceae family ( known as night shade family). Among which; tomato BW caused by R. solanacearum (Smith) was considered to be one of the most destructive diseases, due to its economic impact. Up to 30% of annual losses in tomatoes and potatoes crops were common in Pakistan (Junaid et al, 2018). This pathogenic bacterium has a very wide host range, as more than 200 plant species were attacked by this pathogen

Objectives

Methods

Results

Discussion

Conclusion