Sugarcane Mosaic Virus Isolates Research Articles

English

Sugarcane mosaic virus (SCMV) is one of the three causative viruses of mosaic in sugarcane, a sugar crop widely grown under tropical and subtropical conditions worldwide. Although molecular characterization of SCMV strains was reported from many countries, strain occurring in Pakistan, a major sugarcane producer has not been reported so far. One hundred and two (102) sugarcane samples from foremost sugarcane growing districts in Pakistan were transcribed by reverse-transcription polymerase chain reaction (RT-PCR) by means of a pair of primers. All of them were found infected with SCMV. The sequences of SCMV coat protein gene amplified in this study varied between 406 and 457 nt. The sequence assessment of 12 Pakistani SCMV isolates revealed extensive range of sequence resemblances, 82-100% nucleotide (nt) and 5.0-95% amino acid (aa) respectively. A deletion of aa residues was observed in the amplified segments of the Pakistani amplicons. 50 SCMV CP sequences (12 from Pakistan and 38 from other sugarcane growing countries) were subjected to phylogenetic and in-silico restriction analyses grouped the isolates mostly in order of their geographical origin. The 12 Pakistani SCMV isolates were included in one group. Nearly 97.0% of isolates from Pakistan have no signs for close association with earlier categorized sugarcane mosaic virus strains SCMV-A, SCMV-B, SCMV-D, SCMV-E, and SCMV-SC described from various countries. Our studies discovered that the sugarcane mosaic in Pakistan is instigated by a new group/strain SCMV-PAK. It is the first representation on the diversity and existence of novel SCMV population in Pakistan.   Key words: Sugarcane, sugarcane mosaic virus, geographical, Pakistan, reverse transcriptase polymerase chain reaction (RT-PCR).

Maize Elongin C interacts with the viral genome-linked protein, VPg, of Sugarcane mosaic virus and facilitates virus infection.

The viral genome-linked protein, VPg, of potyviruses is involved in viral genome replication and translation. To determine host proteins that interact with Sugarcane mosaic virus (SCMV) VPg, a yeast two-hybrid screen was used and a maize (Zea mays) Elongin C (ZmElc) protein was identified.ZmELC transcript was observed in all maize organs, but most highly in leaves and pistil extracts, and ZmElc was present in the cytoplasm and nucleus of maize cells in the presence or absence of SCMV. ZmELC expression was increased in maize tissue at 4 and 6 d post SCMV inoculation. When ZmELC was transiently overexpressed in maize protoplasts the accumulation of SCMV RNA was approximately doubled compared with the amount of virus in control protoplasts.Silencing ZmELC expression using a Brome mosaic virus-based gene silencing vector (virus-induced gene silencing) did not influence maize plant growth and development, but did decrease RNA accumulation of two isolates of SCMV and host transcript encoding ZmeIF4E during SCMV infection. Interestingly, Maize chlorotic mottle virus, from outside the Potyviridae, was increased in accumulation after silencing ZmELC expression.Our results describe both the location of ZmElc expression in maize and a new activity associated with an Elc: support of potyvirus accumulation.

First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum).

The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants.

English

Sugarcane mosaic disease caused by sugarcane mosaic virus (SCMV), Johnsongrass mosaic virus (JGMV), maize dwarf mosaic virus (MDMV) and sorghum mosaic Virus (SrMV) is an economically important viral disease of sugarcane worldwide. Field survey was conducted to assess the presence of the viruses involve in mosaic disease of sugarcane in Makarfi Local Government Areas of Kaduna State (Northern Guinea Savannah), Nigeria. A range of symptoms were observed on the  infected land races from the pale green stripes to yellow chlorotic stripes on a dark green background. The purple land race (“Bakarkwama”) was highly susceptible followed by green land race (“Bahausa”) and the least infected was the white land race (“fararkwama”). 63 symptomatic and asymptomatic sugarcane leaves and stem juice extract from 14 villages of Makarfi L.G.A. were screened for the four viruses using DAS and TAS ELISA methods. SCMV, MDMV and SrMV were detected from both symptomatic and asymptomatic sugarcane leaf samples whereas JGMV was not detected in the locations sampled. SCMV isolate has the highest incidence (83%) from all the locations followed by SrMV (10%) and MDMV (5%) isolates. Mixed infections of the three viruses were also detected in some samples. This is the first report of identification of virus isolates inducing sugarcane disease in one of the major sugarcane producing areas of the Northern Guinea Savannah of Nigeria.   Key words: Sugarcane, SCMV, MDMV, SrMV, TAS-ELISA, DAS-ELISA.

Genetic diversity and population structure of Sugarcane mosaic virus

Sugarcane mosaic virus (SCMV) is one of the causal pathogens of mosaic diseases on sugarcane, maize, sorghum and some other graminaceous species with worldwide distribution. The global genetic diversity and molecular evolution of SCMV capsid protein (CP) gene were investigated with the nucleotide sequences available in the GenBank database. Phylogenetic analyses revealed that SCMV isolates clustered in relation to their original hosts, and geographically distinct isolates from maize or sugarcane clustered differently. The populations between maize and sugarcane showed frequent gene flows; but within maize or sugarcane geography distinct isolates had infrequent gene flow. Recombination existed in the region of CP cistron and 3′-untranslated region (UTR). Most of the codons in the CP gene were under negative selection or neutral evolution except for codons 27 and 48, which were under positive selection. This study provided systematic analyses of the evolutionary processes contributing to the observed diversification of SCMV populations.

Ultrastructural Changes in Maize Leaf Cells Infected with Maize Dwarf Mosaic Virus and Sugarcane Mosaic Virus

Plant viruses create many changes in the morphology of the plant cell once the infection process has begun. This paper describes and compares the ultrastructural changes induced in maize cells by two isolates of Maize dwarf mosaic virus (MDMV), Spanish (MDMV-Sp) and Polish (MDMV-P), and one isolate of Sugarcane mosaic virus (SCMV) at 10 and 42 days post-inoculation: the concentration and arrangement of virus particles, inclusion bodies associated with infection, and other cytological alterations. The most important difference between maize cells infected with MDMV isolates and with SCMV-P1 was in the form of cytoplasmic cylindrical inclusions. In cells infected with MDMV only typical inclusions such as pinwheels and scrolls were observed, but laminar aggregates were also present in SCMV-infected cells. No virus particles were found in plant cell organelles. Specific virion arrangements occurred in cells infected with MDMV-Sp and SCMV. The most interesting new finding was of specific amorphous inclusions in the cytoplasm of MDMV-Sp-infected cells, which clearly differentiated the two MDMV isolates studied.

Complete genomic sequence analysis of a highly virulent isolate revealed a novel strain of Sugarcane mosaic virus

Sugarcane mosaic virus (SCMV) is the most prevalent virus causing maize dwarf mosaic disease in northern China. A SCMV isolate, BD8, was obtained from the maize showing dwarf and mosaic symptoms in Baoding, China. The complete genomic sequence of BD8 is 9,576 nucleotides (nt) excluding the poly(A) tail. It contains one single open reading frame of 9,192 nt and encodes a large polyprotein of 3,063 amino acids (aa), flanked by a 5'-untranslated region (UTR) of 148 nt and a 3'-UTR of 236 nt. The entire genomic sequence of BD8 shares identities of 79.1-80.8% with those of other 13 SCMV isolates available in the GenBank at nt level, while their CP genes share identities of 76.9-82.6 and 82.8-86.9% at nt and aa levels, respectively. Phylogenetic analysis of the complete genomic sequences reveals that SCMV can be clustered to four groups: group I includes isolates from maize, group II consists of isolates from sugarcane or maize, groups III and IV contain single isolate of AU-A (AJ278405) and BD8, respectively. Thus, BD8 represents a new strain of SCMV. Furthermore analysis of the CP gene sequences of more isolates shows that BD8 is clustered to a group with the isolates from Thailand and Vietnam, which implies that isolates of this strain have been distributed in South Asia. In the greenhouse, BD8 can cause severe symptoms in all the 12 maize varieties tested with high incidence, indicating that BD8 is highly virulent.

Responses of maize (Zea mays L.) near isogenic lines carrying Wsm1, Wsm2, and Wsm3 to three viruses in the Potyviridae

Genes on chromosomes six (Wsm1), three (Wsm2) and ten (Wsm3) in the maize (Zea mays L.) inbred line Pa405 control resistance to Wheat streak mosaic virus (WSMV), and the same or closely linked genes control resistance to Maize dwarf mosaic virus (MDMV) and Sugarcane mosaic virus (SCMV). Near isogenic lines (NIL) carrying one or two of the genes were developed by introgressing regions of the respective chromosomes into the susceptible line Oh28 and tested for their responses to WSMV, MDMV, and SCMV in the field and greenhouse. F(1) progeny from NIL × Oh28 were also tested. Wsm1, or closely linked genes, provided resistance to all three viruses, as determined by symptom incidence and severity. Wsm2 and Wsm3 provided resistance to WSMV. Wsm2 and/or Wsm3 provided no resistance to MDMV, but significantly increased resistance in plants with one Wsm1 allele. NIL carrying Wsm1, Wsm2, or Wsm3 had similar SCMV resistance in the field, but NIL with Wsm2 and Wsm3 were not resistant in the greenhouse. Addition of Wsm2 to Wsm1 increased SCMV resistance in the field. For all viruses, symptom incidence was higher in the greenhouse than in the field, and relative disease severity was higher in the greenhouse for WSMV and MDMV. An Italian MDMV isolate and the Ohio SCMV infected the Wsm1 NIL, while the Ohio MDMV and Seehausen SCMV isolates did not. Our results indicate that the three genes, or closely linked loci, provide virus resistance. Resistance conferred by the three genes is influenced by interactions among the genes, the virus species, the virus isolate, and the environment.

First Report of Sugarcane mosaic virus on Maize in the Centre Region of France.

In 2007, sweet corn plants (Zea mays cv. Challenger) with symptoms of mosaic resembling those caused by Maize dwarf mosaic virus (MDMV) were observed in production fields in the Centre Region of France. In 10 sweet corn fields surveyed, yield production was decreased by 10 to 20%. Potyvirus-like particles were observed by electron microscopy. Twenty samples from affected plants (cv. Challenger) showing severe mosaic symptoms were tested by ELISA with rabbit polyclonal antibodies to MDMV (Montpellier SupAgro, France) and SCMV (Sugarcane mosaic virus) (Bioreba, Reinach, Switzerland). For all leaves tested, slight and strong positive reactions were observed for MDMV and SCMV, respectively, indicating that the plants were infected by SCMV. Filtered phosphate buffer extracts of infected leaves of field plants (cv. Challenger) were used to mechanically inoculate leaves of different corn plants at the three-leaf stage. Sweet corn cultivars (Atugan, Challenger, Golda, Max, and Rana) and seed corn cultivars (DK315, DK3152, DKC3420, Marcello, and PR38H20) were tested. Two weeks after inoculation, mosaic symptoms were observed on leaves. The sweet corn cultivars (with the exception of cv. Max) were considerably more sensitive to the virus. Using two lots of 1,000 seeds each (cv. Challenger), a rate of seed transmission was estimated to be 0.5 to 0.6%. Total RNA was extracted from infected leaves of cv. Challenger 3 weeks after mechanical inoculation. To confirm the potyvirus species involved, a short conserved fragment of the coat protein gene was reverse transcribed, PCR amplified and sequenced (3). The sequence was deposited in GenBank (Accession No. HM014060). Multiple sequence alignment and phylogenetic analysis clearly grouped this isolate called SCMV-MFc (Maize France centre) in the 'Maize' cluster of SCMV, which consists exclusively of isolates from maize. Nucleotide sequence comparison showed that SCMV-MXVrP, a Mexican isolate (2), and SCMV-P3, a Polish isolate (4), have the two closest sequences (285 identical nucleotides of 286). SCMV-MFc is more distantly related with the described SCMV German isolates (1). This is in contrast to SCMV isolates from the traditional Saccharum officinarum cultivars that can be clustered by geographical origin (1). This result could be a consequence of the possible seed transmission of the maize isolates of SCMV. In the future, it will be interesting to check the occurrence of SCMV-MFc in maize fields to assess its economical importance.

Genomic evidence of intraspecific recombination in sugarcane mosaic virus

The sugarcane mosaic virus (SCMV) of the genus potyvirus, which primarily affects maize, sugarcane, sorghum, abaca, and grasses, occurs worldwide and causes significant economic loss. Using the full genome sequences of SCMV and several recombination detection methods, in this study we report that recombination is the major driving force in the evolution and emergence of several new variants of SCMV. We reported eight highly significant (P<0.001) recombination break points, majority of which are located within 6K1-VPg-NIaPro-NIb region, thus indicating a region for recombination hotspot. The observation of commonalities of same recombination events among the SCMV isolates between the countries (Spain and Mexico), and within the country (within China, and within Mexico), suggests common origin of the isolates in respective regions.

A New Host Diagnosed with a Strain of Sugarcane mosaic virus in Florida: Red-Veined Prayer Plant (Maranta leuconeura erythroneura).

Prayer plants (Maranta spp.), which are indigenous to Brazil, are commercially produced in nurseries mainly to be sold as potted houseplants. However, in frost-free areas, they are also used as a ground cover. In March 2009, the Division of Plant Industry in Gainesville, FL received cuttings of red-veined prayer plant or red maranta (Maranta leuconeura erythroneura) from several nurseries in central Florida. The cuttings originated in Costa Rica. The presence of a viral infection was indicated by the mosaic pattern seen on the upper surface of the leaves and chlorotic lesions on the underside of leaves. Epidermal strips were taken and stained in Orange-Green (O-G) and Azure A (1). Microscopic examination revealed viral inclusions that stained only in O-G, indicating the presence of a potyvirus. Leaf dips were prepared for the electron microscope and flexuous rods consistent with a potyvirus were found. Indirect-ELISA using universal potyvirus antiserum (Agdia Inc., Elkhart, IN) confirmed the presence of a potyvirus infection. Total RNA was extracted from symptomatic tissue of five infected samples with Qiagen's RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). Reverse transcription was conducted with the oligo d(T) primer M4T with AMV-RT at 37°C for 1 h. PCR was performed with primer M4 and a degenerate primer designed to amplify the 3' end of all potyviruses (2). A target amplicon of 1.7 kb was produced from all five samples. Three of these samples were cloned and sequenced. Approximately 1,250 bp were sequenced from each sample. The sequenced regions include the 3' end of the Nib gene, the complete coat protein, and the beginning of the 3' untranslated region (UTR). The nucleotide (nt) sequences were deposited into GenBank (Accession Nos. GQ853403-GQ853405). The nt sequences of the three samples were 97 to 98% identical to each other. When compared with other potyviruses in the GenBank, the samples showed closest nt identity, 92 to 93%, with several isolates of Sugarcane mosaic virus (AJ278405, AY836523, U57357, and U57356). Of the plant species mechanically inoculated (Chenopodium amaranticolor, C. quinoa, Datura stramonium, Gomphrena globosa, Nicotiana benthamiana, and Zea mays), only Z. mays (corn) showed symptoms (a mild mosaic). The same type of viral inclusions were seen in leaf strips of infected corn as in the Maranta. The corn plant reacted positively in direct-ELISA against antiserum to Sugarcane mosaic virus (Agdia Inc.). Cuttings of infected Maranta were observed in the greenhouse and indoor situations for several months. The plants infected with Sugarcane mosaic virus lacked vigor and most eventually died. ELISA tests done on a few surviving plants were positive for Sugarcane mosaic virus, but the results were inconsistent, indicating a possible low titer of virus in the plants as they were dying. To our knowledge, this is a new host for Sugarcane mosaic virus, but it does not appear that Maranta will become a significant new reservoir of this virus for sugarcane or corn growers. However, infected cuttings can greatly decrease the production of this plant as an ornamental.

First Report of Sugarcane mosaic virus Infecting Maize in Poland.

Maize (Zea mays) has become an important crop in Poland with a constant increase in crop acreage since the 1990s. In 2007, maize plants with characteristic leaf mosaic were observed in two locations in the Wielkopolska Region near Poznań and Krotoszyn. Ninety-two samples from plants showing leaf mosaic, some leaf discoloration, stunting, or no symptoms were collected and tested for Maize dwarf mosaic virus (MDMV) and Sugarcane mosaic virus (SCMV) by double-antibody sandwich (DAS)-ELISA (Bioreba, Basel, Switzerland). SCMV was detected only in three samples with distinct leave mosaic symptoms. Electron microscopy of leaf extracts revealed numerous potyvirus-like particles. Immuno-specific electron microscopy (ISEM) with the SCMV antiserum gave positive results for all three samples. Each virus isolate was propagated by mechanical inoculation on five varieties of dent maize and three varieties of sweet maize, cockspur grass (Echinochloa crus-galli (L.) Beauv.), crab grass (Digitaria sanguinalis (L.) Scop.), and green bristle-grass (Setaria viridis (L.) P.B.). Leaf mosaic appeared 4 to 5 days postinoculation. ELISA detected all three isolates in the symptomless hosts of oat (Avena sativa L.), wheat (Triticum aestivum L.), and triticale (Triticale). The three isolates induced local leaf necrosis on sorghum (Sorghum vulgare L.), in which the virus occurred in low concentrations as determined by ELISA so infections of sorghum plants were confirmed by reverse transcription (RT)-PCR) with primers PS/PSC (1). Barley (Hordeum vulgare L.), true millet (Panicum miliaceum L.), and wind grass (Agrostis spica-venti (L.) P.B.) were not susceptible (2). Using the total RNA extracted with the RNeasy Mini Kit (Qiagen, Hilden, Germany) from leaves of inoculated maize plants, a one step RT-PCR (Qiagen) amplified a ~800-bp cDNA fragment of the coat protein gene with SCMV-specific primers PS/PSC (1). Six cDNA clones were sequenced for each isolate. Nucleotide sequences of the 823-bp cDNA clones of isolates SCMV-P1 and P2 (GenBank Accession Nos. EU761241 and EU761242, respectively) were 99% identical and each was 92% identical to the sequence of SCMV-P3 (FJ376609). The clones of SCMV-P1 and SCMV-P2 shared 99, 98, 90, and 87% nucleotide sequence identity with two German SCMV isolates (X981697 and X98168), a Spanish isolate (AM110759), the UT6 isolate from Thailand (AY630923), and the Nancheng isolate (EU346720) from China, respectively. The SCMV-P3 sequence was 98, 94, 92, 89, and 92% identical to the Mx isolate from Mexico (AY195610), a Bulgarian SCMV isolate (AJ006201), the German Seehausen (X98166) and Borsdorf (X98167) isolates, the SC-UD1 (DQ647661), the KL - Co86032 (DQ866744) isolates from Thailand and India, and the Chinese Nanchang (EU346720) and Pengze2 (EU346718) isolates, respectively. In 2008, SCMV was again detected by ELISA in mixed infections with MDMV in samples from the Wielkopolska Region, but only sporadically, and the virus is considered not to be important economically in maize production in Poland.

Identification of new variants of SCMV causing sugarcane mosaic in India and assessing their genetic diversity in relation to SCMV type strains

Sugarcane mosaic virus (SCMV) is one of the two causative viruses of mosaic in sugarcane, a sugar crop widely grown under tropical and subtropical conditions worldwide. Although molecular characterization of SCMV strains was reported from many countries, strains occurring in India, a major sugarcane producer have not been reported so far. Twenty-six sugarcane samples represented by seven major sugarcane growing states in India and USA were subjected to reverse-transcription polymerase chain reaction (RT-PCR) using a pair of newly designed coat protein specific primers. Among them 17 were found positive to the SCMV infection. The lengths of the sequences derived in this study using the new set of primers varied between 812 and 866 nt. The amino acid sequence comparison of 30 Indian SCMV isolates showed wide range of sequence similarities in core region (88.80-100%) and hyper variable region (51.3-100%). In the N-terminal region of the five Indian isolates, a deletion of 12 aa residues between aa 11 and 30 was observed, whereas the deletion was between aa 45 and 50 in SCMV-B and -D and between aa 61 and 70 in SCMV-A. The phylogenetic analyses performed with 46 SCMV CP sequences for both hyper variable region and core region separated the isolates mostly according to their geographical origin. The 30 Indian SCMV isolates were included exclusively in four groups besides SCMV-IND, which was grouped with SCMV-SC, a type of strain from Australia. Nearly 97.0% of the Indian isolates have no signs for close relationships with previously characterized SCMV type strains (SCMV-A, -B, -D, -E, and -SC) reported from other countries. Our studies revealed that the sugarcane mosaic in India are caused by at least nine new SCMV variants (IND-CC1, -CC2, -CC3, -CC4, -CO1, -CO2, -CP, -CS, and -J) and a type strain SCMV-SC represented by SCMV-IND. This is the first report on the variability and occurrence of new SCMV population in India.

Viruses causing mosaic disease in sugarcane and their genetic diversity in southern China

A survey of cultivated hybrid sugarcane (Saccharum inter-specific hybrid) and noble sugarcane (Saccharum officinarum) in southern China for the presence of Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV) and Sugarcane streak mosaic virus (SCSMV) was conducted by RT-PCR from the years 2003 to 2006. SCMV and SrMV, but not SCSMV, were found. A high incidence of SCMV and SrMV coinfection was revealed in both hybrid and noble sugarcanes. All coinfected plants showed mosaic symptom, whereas plants infected with a single virus were symptomatic or asymptomatic. It appears that virus mixtures are more virulent than single infections. The nucleotide sequences of the coat protein (CP) gene of 33 SCMV and 10 SrMV isolates from this study were compared to those of CP genes of SCMV and SrMV reported in GenBank. One hundred and seventy-three SCMV isolates, with the exception of MDB and Abaca strains, can be grouped into five groups, which include three previously known groups, the sugarcane (SCE), maize (MZ), and Thailand groups, and two newly identified groups, the noble sugarcane (NSCE) and Brazil groups. Twenty-two SrMV isolates were divided into two groups, HS (hybrid sugarcane) and NS (noble sugarcane) groups. Five out of eight SrMV hybrid isolates belonged to the HS group, and two SrMV noble isolates and three hybrid isolates were within the NS group. Interestingly, the three hybrid isolates within the NS group were isolated from hybrid sugarcane co-infected with SCMV. This indicates that SCMV helps the NS group SrMV to infect hybrid sugarcane.

Duplex — reverse transcription — polymerase chain reaction (D-RT-PCR)-a technique for the simultaneous detection of viruses causing sugarcane mosaic

Sugarcane mosaic virus (SCMV) and Sugarcane streak mosaic virus (SCSMV) are the two major RNA viruses that are widely prevalent in most of the Asian countries including India and are the causative viruses of mosaic in sugarcane. We have established that these two viruses either alone or in combination cause mosaic in sugarcane through RT-PCR. Further studies were conducted to detect the associated viruses in a single reaction. To optimize simultaneous detection of these viruses, a new set of primers were designed from the coat protein region of the viruses to suit duplex reverse transcription polymerase chain reaction (D-RT-PCR) and the conditions were standardized to amplify the target viruses in this assay. Of the 29 sugarcane samples tested for the simultaneous occurrence of SCMV and SCSMV, 10 sugarcane varieties were found to be infected with both the viruses with positive amplifications of ∼860 bp and ∼690 bp respectively, for SCMV and SCSMV. In the remaining 19 varieties, SCSMV was detected alone as the causative virus of mosaic. None of the selected varieties were found infected with SCMV alone. Further, the D-RT-PCR was found equally reliable to uniplex RT-PCR performed with SCMV and SCSMV primers in separate reactions. The D-RT-PCR products were cloned, sequenced and the respective sequence information confirmed the authenticity of the viruses amplified in D-RT-PCR. The lengths of the amplified fragments from SCMV isolates were ranged between 812 and 877 bp and in SCSMV it ranged from 683 to 689 bp. This diagnostic approach will be useful to establish distribution map of the virus(es) associated with mosaic in India and in other sugarcane growing countries.

Complete genome sequences of Maize dwarf mosaic and Sugarcane mosaic virus isolates coinfecting maize in Spain

The genomes of Spanish isolates of Maize dwarf mosaic virus (MDMV-Sp) and Sugarcane mosaic virus (SCMV-Sp) were completely sequenced. Nucleotide sequence identities of SCMV-Sp to those of other SCMV isolates ranged from 79 to 90%. MDMV-Sp shared 85% nucleotide identity with the only other fully sequenced isolate of MDMV. MDMV-Sp and SCMV-Sp differed from each other by 31% in their nucleotide sequences. Phylogenetic analyses showed that SCMV isolates group by host rather than by geographical location. Two significant recombination signals were identified in the NIa and NIb regions of the SCMV-Sp genome.

Detecção do Sugarcane mosaic virus no Paraná e limpeza somaclonal por cultura de tecidos

Um isolado do Sugarcane mosaic virus (SCMV) causando sintomas de mosaico em plantas de cana-de-açúcar do clone RB925268 foi identificado no estado do Paraná. Gemas axilares extraídas de colmos infectados, medindo de 4 a 8 mm, foram utilizadas como explantes e regeneradas em plântulas em meio de cultura MS, suplementado ou não com o antiviral ribavirina, nas concentrações variando de 10-60 mg/L. O efeito fitotóxico da ribavirina foi constatado, resultando na morte dos explantes em concentrações iguais ou superiores a 30 mg/L. Após seis meses de aclimatação das plantas em estufa plástica, o vírus não foi detectado nas plantas provenientes do meio MS contendo ribavirina na concentração de 25 mg/L, confirmado através dos ensaios de inoculação mecânica em sorgo 'Rio' e de RT-PCR.

Heritability of resistance in maize to the Czech isolate ofSugarcane mosaic virus

The heritability of maize resistance to one Czech isolate of Sugarcane mosaic virus (SCMV) was determined. Parental maize lines with different degree of resistance or susceptibility, their F 1 and F 2 progeny were mechanically inoculated by this virus and symptom development were observed during 63 days. The analysis of resistance of F 1 hybrids, derived from resistant lines and lines with a different degree of susceptibility, suggests that there was no hybrid found which would not exhibit any symptom of infection induced by SCMV, but the symptoms appeared one or two weeks later, compared with the susceptible line, the onset of infection was very gradual and the percentage of infection never reached 100 percent. Heritability of this trait, determined on the basis of the variances of parents, F 1 hybrids, and the development of infection in F 2 populations was relatively high and ranged from 0,70 to 0,91. From these results we can assume that the resistance of tested lines to SCMV detected in the greenhous...

Coat protein gene sequence of a Mexican isolate of Sugarcane mosaic virus and its infectivity in maize and sugarcane plants

Coat protein gene sequence of a Mexican isolate of Sugarcane mosaic virus and its infectivity in maize and sugarcane plants

Cloning and sequence analysis of coat protein gene for characterization of sugarcane mosaic virus isolated from sugarcane and maize in Thailand

Three isolates of sugarcane mosaic virus (SCMV) from sugarcane and maize in Thailand, were selected and used as viral sources for coat protein (CP) genes cloning by immunocapture reverse transcription polymerase chain reaction (IC-RT-PCR). The CP gene sequences and their deduced amino acids were determined. The sequences of three cloned CP genes, UT6TH-sgc and UD7TH-sgc from sugarcane, and SBC2TH-mz from maize were compared with other previously reported sequences of SCMV-CP gene and their phylogeny were studied. The analysis revealed that Thai SCMV CP gene contained 942 nucleotides encoded for coat protein MW of 33.65 kDa. The nucleotide sequence identity among cloned CPs from three isolates were 98-99% to each other. The N-terminus of the Thai SCMV CP contained a distinctive sequence, especially at nucleotide positions 28-46 of the N-terminal variable 70 amino acid residues which discriminated Thai SCMV from all previously reported SCMV isolates. Thai SCMV were placed in a separate branch of SCMV-MDB cluster which is closely related to most of SCMV isolates from maize, and distinct from the other cluster containing sugarcane-SCMV strains.