Infections In Dairy Cows Research Articles

Comparison of antibody repertories against Staphylococcus aureus in healthy and infected dairy cows with a distinct mastitis history and vaccinated with a polyvalent mastitis vaccine

Staphylococcus aureus is one of the pathogens most frequently isolated from cases of mastitis worldwide. To decrease the effect of S. aureus mastitis in dairy farming, alternative strategies for controlling mastitis are needed that depend on a better knowledge of cow-to-cow variations in S. aureus antibody production. The present study sought to explore the diversity of S. aureus antibodies produced by dairy cows with a distinct mastitis history and vaccinated with a polyvalent mastitis vaccine. We obtained protein extracts from S. aureus isolates derived from persistent subclinical mastitis. Proteins were fractionated using 2-dimensional gel electrophoresis and Western blotting. Then, Western blotting membranes were exposed to sera from 24 dairy cows that had been divided into the following groups: vaccinated dairy cows that were infected with S. aureus, further subdivided according to whether they (a) remained infected by S. aureus or (b) recovered from the intramammary infection; unvaccinated dairy cows infected with S. aureus; and vaccinated healthy dairy cows with no history of S. aureus mastitis. Proteins found to be reactive by Western blot were identified by mass spectrometry (MALDI/TOF-TOF). Our most important finding was that F0F1 ATP synthase subunit α, succinyl-diaminopimelate desuccinylase, and cysteinyl-tRNA synthetase were potential candidate proteins for the prevention of S. aureus mastitis. This study strengthens the notion that variations among animals should not be ignored and shows that the heterogeneity of antibody production against anti-staphylococcal antigens in animals may enable the identification of new immunotherapy targets.

Short communication: Recombinant mammary serum amyloid A3 as a potential strategy for preventing intramammary infections in dairy cows at dryoff

Mammary serum amyloid A3 (M-SAA3) has shown potential in stimulating innate immunity during intramammary infections, at calving and at dryoff. In this study, we produced recombinant caprine M-SAA3 to test its ability to reduce intramammary infections with Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli, which are all common mastitis-producing pathogens. Recombinant production of M-SAA3 (followed by lipopolysaccharide removal to avoid lipopolysaccharide-nonspecific stimulation of the immune system) was successfully achieved. Mammary serum amyloid A3 stimulated the expression of IL-8 in a dose-dependent manner in primary mammary cultures. Although a direct killing effect on Staph. aureus by M-SAA3 was not detected, this acute phase protein was able to reduce Staph. aureus, Strep. uberis, and Strep. dysgalactiae infections by up to 50% and induced a reduction in E. coli counts of 67%. In general, the best concentration of caprine M-SAA3 for inhibiting infections was the lowest concentration tested (10 μg/mL), although higher concentrations (up to 160 μg/mL) increased its antimicrobial potential against some pathogens.

Burden and antimicrobial resistance of S. aureus in dairy farms in Mekelle, Northern Ethiopia

BackgroundStaphylococcus aureus is a frequent colonizer of human and several animal species, including dairy cows. It is the most common cause of intramammary infections in dairy cows. Its public health importance increases inline to the continuous emergence of drug-resistant strains; such as Methicillin-resistant S. aureus (MRSA). Indeed, the recent emergence of human and veterinary adapted MRSA demands serious attention. The aim of this study was to determine the burden and drug resistance pattern of S. aureus in dairy farms in Mekelle and determine the molecular characteristics of MRSA.ResultsThis study was done on 385 lactating dairy cows and 71 dairy farmers. The ages of the cows and farmworkers were between 3 and 14 and 17–63 years respectively. S. aureus was isolated from 12.5% of cows and 31% of farmworkers. Highest resistance was observed for penicillin (> 90%) followed by tetracycline (32–35%) and trimethoprim-sulphamethoxazole (10–27%). But no resistance was observed for vancomycin, daptomycin, and rifampin. Only one isolate was MRSA both phenotypically and harboring mecA. This isolate was from nasal of a farmworker and was MRSA SCCmec Iva, spa type t064 of CC8. Multi-drug resistance was observed in 6.2% of cow isolates and 13.6% of nasal isolates.ConclusionsIn this study, S. aureus infected 12.5% of dairy cows and colonized 31% of farmworkers. Except for penicillin, resistance to other drugs was rare. Although no MRSA was found from dairy cows the existence of the human and animal adapted and globally spread strain, MRSA SCCmec IVa spa t064, warrants for a coordinated action to tackle AMR in both human and veterinary in the country.

Short communication: Characterization of Staphylococcus aureus from bulk tank milk of dairy cattle in Lombardy (northern Italy)

Staphylococcus aureus is one of the most important pathogens causing mastitis in cattle, and it is responsible for economic losses in dairy herds worldwide. The PCR amplification of the 16S-23S rRNA intergenic spacer (ribosomal spacer PCR, RS-PCR) allows a rapid classification of the strains in genotypes and genotypic clusters (CL), which are characterized by different epidemiological and clinical properties. Both RS-PCR and multi-locus sequence typing (MLST) were performed on strains isolated from bovine bulk tank milk (BTM) collected from dairy herds located in the Lombardy region (northern Italy), to outline the distribution of Staph. aureus genotypes in this geographical area. Out of 844 examined samples, 398 were positive for Staph. aureus, with a variable count (cfu/mL) Up to 8 colonies from each sample were genotyped. A total of 1,101 Staph. aureus strains were analyzed with RS-PCR, and only a selection of them (n = 86), in relation to their frequency and geographical origin, underwent MLST. This study revealed 8 major genotypic clusters (CLB, CLC, CLR, CLS, CLI, CLF, CLAO, and CLZ), of which Staph. aureus CLB (29.3%) was the most common. Samples of BTM positive for CLB had a Staph. aureus cfu/mL count significantly higher than the non-CLB positive ones. Our MLST analysis showed genotypes already known as bovine-associated in literature, such as clonal complexes CC8, CC97, and CC151. The same selection of 86 strains was also analyzed for the presence of the adlb gene, which was recently proposed as a possible marker of contagiousness. Most Staph. aureus belonging to CLB or CC8 carried the adlb gene (85%), whereas this gene was detected in only 9% of non-CLB strains (CLAA, CLBI, CLBJ, CLS). In conclusion, the present study confirms that Staph. aureus CLB, which is recognized as a contagious genotype, is a particularly relevant agent of intramammary infection in dairy cows in Lombardy, and indirectly supports the idea that adlb can be a possible marker of contagiousness of isolates.

Differential somatic cell count as an additional indicator for intramammary infections in dairy cows

Mastitis, often caused by intramammary infection (IMI), is a significant problem in dairy farming globally. Somatic cell count (SCC) is widely used as a parameter for screening IMI in cows that are then treated or culled. We investigated the potential of a new parameter, differential SCC (DSCC), to detect IMI at cow level when SCC is already known. We achieved this using bacterial culture (BC) and PCR to detect 4 categories of pathogens (major, minor, other, and any) in 2 Danish dairy herds. Quarter milk samples were collected from monthly dairy herd improvement samplings over 1 yr and analyzed with BC, whereas cow-level dairy herd improvement samples were analyzed using PCR. Days in milk, parity, and IMI status had a significant effect on DSCC. Using DSCC in addition to SCC significantly improved the indication of IMI compared with using only SCC in the any pathogen category in both herds as well as the minor pathogens category in herd 2 when BC was used for detection. When PCR was used to detect IMI, the use of DSCC in addition to SCC was significant for the other pathogens category in herd 1 and the minor pathogens category in herd 2. Thus, our data revealed that DSCC can add significant information describing IMI status even when SCC is already known; however, this depends on the causative pathogen. Future studies may address how to use DSCC in practice as well as consider the availability of temporal data to potentially gain insight into the course of infection.

Feeding supplemental 25-hydroxyvitamin D3 increases serum mineral concentrations and alters mammary immunity of lactating dairy cows

Objectives were to determine the effects of feeding supplemental 25-hydroxyvitamin D3 [25(OH)D3] on concentrations of vitamin D metabolites and minerals in serum, mammary immune status, and responses to intramammary bacterial infection in dairy cows. Sixty multiparous, pregnant lactating Holstein cows with somatic cell count <200,000/mL were blocked by days in milk and milk yield and randomly assigned to receive a daily top-dressed dietary supplement containing 1 or 3 mg of vitamin D3 (1mgD or 3mgD), or 1 or 3 mg 25(OH)D3 (1mg25D or 3mg25D) for 28 d (n = 15/treatment). Cows were kept in a freestall barn and fed a total mixed ration in individual feeding gates. Individual dry matter intake (DMI) and milk yield were recorded daily, and milk and blood samples were collected at 0, 7, 14, and 21 d relative to the start of treatment. At 21 d, cows fed 1mgD and 3mg25D received an intramammary challenge with Streptococcus uberis. Cows were observed for severity of mastitis, and blood and milk samples were collected every 12 h to measure inflammation. The 1mg25D and 3mg25D cows had greater serum 25(OH)D3 concentrations at 21 d compared with 1mgD and 3mgD cows (62 ± 7, 66 ± 8, 135 ± 15, and 232 ± 26 ng/mL for 1mgD, 3mgD, 1mg25D, and 3mg25D, respectively). The 3mg25D cows had greater concentrations of Ca and P in serum at 21 d compared with other treatments (Ca = 2.38, 2.4, 2.37, and 2.48 ± 0.02 mM, 1.87, 1.88, and 2.10 ± 0.08 mM for 1mgD, 3mgD, 1mg25D, and 3mg25D, respectively). Yields of milk and milk components, DMI, body weight, and concentrations of 1,25-dihydroxyvitamin D and Mg in serum did not differ among treatments. Abundance of mRNA transcripts for interleukin-1β (IL1B) and inducible nitric oxide synthase (iNOS) in milk somatic cells before S. uberis challenge were increased in cows fed 25(OH)D3 compared with cows fed vitamin D3. Furthermore, IL1B, iNOS, β-defensin 7, and β-defensin 10 in milk somatic cells increased as concentrations of 25(OH)D3 increased in serum. Cows fed 3mg25D had less severe mastitis at 60 and 72 h after challenge with S. uberis compared with cows fed 1mgD. Concentrations of bacteria, somatic cells, and serum albumin in milk after challenge did not differ between treatments; however, an interaction between treatment and day was detected for lactate dehydrogenase in milk. Expression of adhesion protein CD11b on milk neutrophils after the S. uberis challenge was greater among 3mg25D cows compared with 1mgD cows. Transcripts of CYP24A1 and iNOS in milk somatic cells during mastitis also were greater in 3mg25D cows compared with 1mgD cows. Feeding 25(OH)D3 increased serum 25(OH)D3 more effectively than supplemental vitamin D3, resulting in increased serum mineral concentrations, increased expression of vitamin D-responsive genes, and altered immune responses to intramammary bacterial challenge.

Investigation of differential somatic cell count as a potential new supplementary indicator to somatic cell count for identification of intramammary infection in dairy cows at the end of the lactation period

The objective of this study was to investigate the new differential somatic cell count (DSCC) as a supplementary indicator to SCC for the identification of intramammary infection (IMI) in dairy cows at the end of the lactation period. Different approaches for identification of cows with IMI (i.e. often based on SCC) and targeted antimicrobial treatment of those rather than of all cows have been developed (i.e. selective dry cow treatment). Recently, DSCC representing the proportion of polymorphonuclear neutrophils and lymphocytes, has been introduced as an additional indicator for the presence of IMI. We used the last dairy herd improvement (DHI) samples taken within 42 d prior to dry-off as well as hand-stripped samples collected within 5 days prior to dry-off to measure DSCC and SCC. The bacteriological status was determined using quarter foremilk samples collected close to drying off. In total, 582 cows were dried off during our study but not all of them could be included in the data analysis for different reasons (e.g. incomplete data, samples too old for reliable determination of SCC and DSCC, contamination). Eventually, the final data set comprised of 310 cows of which 64 and 149 were infected with major and minor pathogens, respectively, and 97 were uninfected. The area under receiver-operating characteristics curves (AUC) were calculated to compare the diagnostic abilities of the different parameters. The AUC for identification of IMI by major pathogens when using the combination of DSCC and SCC was 0.64 compared to 0.62 for SCC alone and 0.62 for DSCC alone. The different parameters were further compared based on test characteristics and predictive values. For example, classifying cows as infected based on a cut-off of 200,000 cells/ml for SCC alone and in terms of using DSCC combined with SCC based on either >60% and/or >200,000 cells/ml, the sensitivity changed from 47 to 66% and the specificity from 74 to 54%. At the same time, the negative predictive value changed from 84 to 86% and the positive predictive value from 32 to 27%. Test characteristics and predictive values of the parameters DSCC and SCC were similar using DHI and hand-stripped samples. In conclusion, our study provides first indications on test characteristics and predictive values for the combination of DSCC and SCC. However, more work on this subject and the actual practical application is needed.

Comparison of Defined Course Doses (DCDvet) for Blanket and Selective Antimicrobial Dry Cow Therapy on Conventional and Organic Farms.

Simple SummaryThe general public is increasingly concerned about using antibiotics to treat animals in food production systems. It is vital that sick animals should be treated and that veterinarians should have treatment options available to prevent unnecessary suffering. Nevertheless, farmers and veterinarians are working together to reduce antibiotic use. In Austria, antibiotics can only be obtained from veterinarians and any antimicrobials dispensed must be reported to the authorities. This study aimed to compare antibiotic use on dairy farms, using a standardised unit, the Defined Course Dose. The most common bacterial infection in dairy cows is mastitis (udder infection). For decades, the use of antibiotic treatments to prevent or cure mastitis during the dry period (approximately 4–8 weeks when cows are not milked) has been routine. However, the need to reduce antibiotic use has seen farmers and veterinarians consider a more selective use of these drugs, only using them in cows proven to have bacterial infections, rather than treating all cows in a “blanket” approach. This study determined that farmers choosing a selective approach used fewer antibiotics overall than those using blanket treatment. No difference was found between conventional and organic dairy farms with respect to antibiotic use at drying off.Antimicrobial use in livestock production is a controversial subject. While antimicrobials should be used as little as possible, it is still necessary, from both an animal health and welfare point of view, to treat infected animals. The study presented here aimed to analyse antimicrobial use on Austrian dairy farms by calculating the number of Defined Course Doses (DCDvet) administered per cow and year for dry cow therapy. Antimicrobial use was analysed by production system and whether farmers stated that they used blanket dry cow therapy (i.e., all cows in the herd were treated) or selective dry cow therapy (i.e., only cows with a positive bacteriological culture or current/recent history of udder disease were treated). A statistically significant difference (p < 0.001) was determined between antimicrobial use for blanket (median DCDvet/cow/year: 0.88) and selective dry cow therapy (median DCDvet/cow/year: 0.41). The difference between antimicrobial use on conventional and organic farms for dry cow therapy as a whole, however, was not statistically significant (p = 0.22) (median DCDvet/cow/year: 0.68 for conventional; 0.53 for organic farms). This analysis demonstrates that selective dry cow therapy leads to a lower overall use of antimicrobials and can assist in a more prudent use of antimicrobials on dairy farms.

Molecular detection of Treponema species organisms in foremilk and udder cleft skin of dairy cows with digital dermatitis.

Identification of reservoirs and transmission routes of digital dermatitis (DD)-associated Treponema spp. is considered an effective means for controlling DD infection in dairy cows. The objective of this study is to identify and characterize the potential reservoir niches for DD-associated Treponema spp. from healthy udder cleft skin and foremilk in lactating dairy cows. A large dairy farm was visited weekly from March to July 2015. Clinical investigation revealed that a total of 25 lame cows had DD lesions located at the plantar aspect of the interdigital cleft. A total of 75 samples, three per cow, were collected including deep swabs from DD lesions (n = 25), non-aseptically collected foremilk samples (n = 25) and skin swabs from udder cleft (n = 25). Treponema spp. were identified using nested PCR assays and confirmed by DNA sequencing. Results revealed that Treponema phagedenis (T. phagedenis)-like was the most identified species in the foremilk 40% (10/25), in comparison with DD lesions and udder cleft skin samples with 32% (8/25) and 20% (5/25), respectively. On the other hand, Treponema pedis (T. pedis) was the most identified species in the udder cleft skin 80% (20/25), in comparison with DD lesions and foremilk samples with 68% (17/25) and 60% (15/25), respectively. None of the examined samples were identified by PCR as containing DNA from Treponema medium (T. medium) or Treponema vincentii (T. vincentii)-like. To the best of our knowledge, this is the first report for detection of T. phagedenis-like and T. pedis from healthy skin of udder cleft and foremilk samples. Detection of DD Treponema spp. from udder cleft skin and foremilk samples indicates that these sites could be potential reservoirs for spirochetes involved in DD. Udder cleft skin and foremilk may have a role in transmission routes of DD Treponema in dairy farms.

Transcriptome Profiling Analysis of Bovine Vaginal Epithelial Cell Response to an Isolated Lactobacillus Strain.

Lactobacillus strain SQ0048 isolated from bovine vagina has been shown to exhibit specific adherence to the epithelium and to produce inhibitory substances; however, the underlying mechanisms remain unclear. We cultured and identified primary bovine vaginal epithelial cells treated with SQ0048 to investigate the pathways involved in host cell responses using transcriptome sequencing (RNA-seq). Transcription profiling showed 296 significantly altered differentially expressed genes (DEGs), of which 170 were upregulated and 126 downregulated. Gene Ontology (GO) enrichment analysis of the DEGs revealed significant enrichment of 424 GO terms throughout the differentiation process (P < 0.05). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the DEGs were successfully annotated as members of 171 pathways, with 23 significantly enriched KEGG pathways (P < 0.05). A relatively high number of genes were enriched for the endoplasmic reticulum protein processing and interleukin-17 (IL-17) signaling pathways and for antigen processing and presentation. DEGs were verified by quantitative reverse transcription-PCR (RT-qPCR) and determination of which were most enriched for endoplasmic reticulum protein processing pathways, the activation of which might be a major factor underlying Lactobacillus adhesion to cells and pathogenic inhibition.IMPORTANCE Bovine bacterial vaginitis causes infertility, abortion, and postpartum uterine diseases, causing serious economic loss to the dairy industry. The large-scale use of antibiotics destroys normal genital tract flora and hinders the defense mechanisms of the host. Recent research suggests that lactobacilli present in the vaginal microflora of healthy cows constitute the primary microbiological barrier to infection by genital pathogens, exerting a protective role on the reproductive tract via specific adherence to the epithelium and the production of inhibitory substances. Our research identified the mechanisms for Lactobacillus adhesion and pathogenic inhibition, providing valuable information for the development of new probiotics and the discovery of novel therapeutic targets for the prevention of infections in dairy cows.

Seroprevalence and risk factors of Leptospira serovar Pomona and Leptospira serovar Hardjo infection in dairy cows in Jordan.

This study was carried out to determine the seroprevalence and risk factors associated with Leptospira serovars Pomona and Hardjo infection in dairy cows. Seroprevalence was determined using ELISA using 160 healthy and 80 recently aborted cows. Risk factor assessment was carried out using a pre-validated questionnaire. The true farm seroprevalence of Leptospira serovars Pomona and Hardjo was 92.3% (95% CI: 66%-98%). In healthy cows, the true and apparent cow seroprevalence of Leptospira serovars Pomona and Hardjo were 26.9 (95% CI: 20-34%), 26.25% (95% CI: 20-33%) and 28.75% (95% CI: 22-36%) and 27.5% (95% CI: 21-35%), respectively. Semi-intensive management system (OR = 11.43; P < 0.01), surface water as a source of drinking water (OR = 1.21; P < 0.03), lack of special wear for visitors (OR = 1.39; P < 0.05), and previous history of abortion (OR = 1.02; P < 0.05) were associated with high rate of seropositivity against Leptospira serovars Pomona and Hardjo. In recently aborted cows, the true and apparent seroprevalence rates of Leptospira serovars Pomona and Hardjo were 53.25% (95% CI: 47.5-62%), 53.75% (95% CI: 48.5-63.2%) and 56% (95% CI: 49-61%), 56.25% (95% CI: 49.8-61.2%), respectively. Leptospirosis is an endemic disease in Jordan and further studies are required to effectively control the disease in dairy cows.

Non-antimicrobial approaches at drying-off for treating and preventing intramammary infections in dairy cows. Part 1. Meta-analyses of efficacy of using an internal teat sealant without a concomitant antimicrobial treatment.

Use of antimicrobial approaches at drying-off for preventing new intramammary infections (IMI) during the dry period in dairy cows could be replaced by non-antimicrobial approaches. Such approaches would be of interest not only for organic but also for conventional dairy producers. The objective of the current review was to quantify the effect of non-antimicrobial internal teat sealant (ITS)-based approaches at drying-off for treating and preventing IMI, when compared with no treatment or with an antimicrobial-based approach. The protocol for this review was published before initiating the review. A total of 18 trials from 16 articles could be used to investigate the effect of an ITS-based approach. With the available results, we conclude with a high level of confidence that non-antimicrobial ITS-based dry-off approaches are efficient for preventing new IMI during the dry period when compared with no treatment, and would reduce risk of new IMI by 52%. Moreover, we are relatively confident that a bismuth subnitrate-based ITS performed better than an antimicrobial for preventing new IMI during the dry period (a risk reduction of 23%). Similarly, we are relatively confident that an ITS-based approach would only slightly or not at all reduce the prevalence of IMI at calving compared with untreated quarters.

MicroRNA-145 regulates immune cytokines via targeting FSCN1 in Staphylococcus aureus-induced mastitis in dairy cows.

Dairy cow mastitis is a detrimental factor in milk quality and food safety. Mastitis generally refers to inflammation caused by infection by pathogenic microorganisms. Our studies in recent years have revealed the role of miRNA regulation in Staphylococcus aureus-induced mastitis. In the present study, we overexpressed and suppressed miR-145 to investigate the function of miR-145 in Mac-T cells. Flow cytometry, ELISA and EdU staining were used to detect changes in the secretion of several Mac-T cytokines and in cell proliferation. We found that overexpression of miR-145 in Mac-T cells significantly reduced the secretion of IL-12 and TNF-α, but increased the secretion of IFN-γ; the proliferation of bovine mammary epithelial cells was also inhibited. Using quantitative real-time PCR (qRT-PCR), Western blotting and luciferase multiplex verification techniques, we found that miR-145 targeted and regulated FSCN1. Knock-down of FSCN1 significantly increased the secretion of IL-12, while the secretion of TNF-α was significantly downregulated in Mac-T cells. Upon S.aureus infection of mammary gland tissue, the body initiated inflammatory responses; Bta-miR-145 expression was downregulated, which reduced the inhibitory effect on the FSCN1 gene; and upregulation of FSCN1 expression promoted mammary epithelial cell proliferation to allow the recovery of damaged tissue. The results of the present study will aid in understanding the immune mechanism opposing S.aureus infection in dairy cows and will provide a laboratory research basis for the prevention and treatment of mastitis.

Efficacy of MALDI-TOF mass spectrometry as well as genotypic and phenotypic methods in identification of staphylococci other than Staphylococcus aureus isolated from intramammary infections in dairy cows in Poland.

We compared the effectiveness of various methods for the identification of Staphylococcus spp. other than S. aureus isolated from intramammary infections of cows on 3 dairy farms in Lower Silesia, Poland. A total of 131 isolates belonging to 18 Staphylococcus species were identified by sequence analysis of the 16S rRNA and dnaJ genes, as well using a commercial identification system (ID 32 STAPH; bioMérieux) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS; Bruker Daltonics). Sequencing of the 16S rRNA gene was found to have low discriminatory value because only 43% of isolates were recognized unequivocally. Much better results were obtained with the dnaJ gene (all isolates were correctly identified at the species level). However, some of these isolates achieved a low similarity level (<97%) and required a confirmatory test (sequencing of the rpoB gene). The performance of ID 32 STAPH was poor. Regardless of the probability level used (80% or 90%), the commercial system obtained identification rates <40%. Using MALDI-TOF MS and the commercial Bruker database, 67% of isolates were identified correctly with scores ≥2.0 (acceptable species-level identification) but this number increased to 97% after the database was expanded. The definitive identification of Staphylococcus spp. other than S. aureus causing intramammary infections in cattle often requires a combination of different procedures, and the existing databases should be updated.

Characteristic profiles of biofilm, enterotoxins and virulence of Staphylococcus aureus isolates from dairy cows in Xinjiang Province, China.

As an important zoonotic pathogen, Staphylococcus aureus has led to serious mastitis and endometritis in infected dairy cows. In this study, a total of 164 strains of S. aureus were isolated from dairy cows in Xinjiang Province, China, and subjected to assays to determine drug susceptibility and biofilm (BF) formation ability. Enterotoxin-related genes were detected, and the transcription levels of genes related to BF formation were determined by using reverse transcription-quantitative polymerase chain reaction. Moreover, the pathogenicity of isolates with different BF formation abilities was determined by measuring their hemolysis activity, half lethal dose (LD50) and organ bacterial load. The results showed that 86.0% of S. aureus isolates could form BF. Among them, 42.1% of the strains had weak BF formation ability, and most strains with a strong BF formation ability were ica gene carriers. The S. aureus isolates displayed multidrug resistance and their drug resistance was positively correlated with their BF formation ability. Moreover, 96.3% of the S. aureus isolates carried enterotoxin genes. Among them, the detection rates of the novel enterotoxin genes were higher than those of conventional enterotoxin genes. Furthermore, isolates with a strong BF formation ability had higher LD50 but lower hemolysis ability and organ bacterial load than those of the isolates with weak or no BF ability. However, isolates without BF ability produced more severe pathological changes than those of isolates with strong BF formation ability. These findings suggest that higher BF ability and presence of novel enterotoxin genes are important characteristics of S. aureus isolates from dairy cows in Xinjiang Province, China, and such isolates may pose potential threats to food safety.

LPS-induces IL-6 and IL-8 gene expression in bovine endometrial cells “through DNA methylation”

Uterine infection in dairy cows causes great economic loss. In bovine endometrial cells, lipopolysaccharide (LPS)-stimulated increase in interleukin 6 (IL-6) and interleukin 8 (IL-8) mRNA is crucial for the inflammatory response; however, the regulatory mechanisms remain unclear. Here, we investigated the role of DNA methylation in IL-6 and IL-8 mRNA expression following LPS-induction in bovine endometrial cells. IL-6 and IL-8 mRNA expression was evaluated under DNA methylation inhibition using 5-Aza-2′-deoxycytodine (5Aza) following LPS stimulation. Expression of DNA methyltransferases (DNMT1, DNMT3A, and DNMT3B), methyl CpG-binding protein 2 (MeCP2) and DNA methylation at IL-6 and IL-8 regions, were analyzed using quantitative real-time PCR (qRT-PCR) and bisulfite sequencing PCR (BSP) following 24 h of LPS treatment. Inhibition of DNA methylation significantly enhanced LPS-induced IL-6 and IL-8 mRNA expression. LPS increased IL-6 and IL-8 mRNA expression, and decreased methylation levels of specific CpG sites at the IL-6 promoter (at −366 and −660) and the IL-8 promoter (at −120 and −48) after 24 h. Furthermore, LPS treatment for 24 h significantly increased DNMT1, DNMT3A, DNMT3B, and MeCP2 mRNA expression. Our results indicate that treating bovine endometrial cells with LPS induces the expression of IL-6 and IL-8 mRNA regulated by IL-6 and IL-8 promoter methylation.

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods &amp; Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.

Proteomic content of circulating exosomes in dairy cows with or without uterine infection

In the past few decades, there has been a global decrease in dairy cow reproductive performance. An activated inflammatory system, due to uterine infection, has been associated with decreased cow fertility and as such, there is a need to detect uterine disease earlier. Early detection could be achieved by identifying biomarkers for uterine disease. Exosomes are small nanovesicles known to package and deliver protein, mRNA, and miRNAs to near and distant sites. Therefore, the content of circulating exosomes may have the potential to carry biomarkers for earlier diagnosis of disease. We hypothesized that circulating exosomes from cows with and without uterine infection may contain information representative of endometrial health or disease. We compared the proteomic content of circulating exosomes derived from plasma of dairy cows with (n = 10) or without (n = 10) induced uterine infection, using high-performance liquid chromatography tandem mass spectrometry (HPLC MS/MS). Our results demonstrate that there were a total of 103 bovine and 9 Trueperella pyogenes proteins found in plasma exosomes derived from infected cows (infected exosomes), and 90 bovine and 5 T. pyogenes proteins found in exosomes derived from plasma of non-infected cows (non-infected exosomes). 71 bovine proteins were found to be unique to the infected exosomes while only 4 bovine proteins were found to be unique to the non-infected exosomes. 8 unique T. pyogenes proteins were identified in infected exosomes and 4 were found to be unique to the non-infected exosomes. Pathway analysis showed that infected exosomes had more proteins involved in structural molecule activity and immune system processes than non-infected exosomal protein. Additionally, proteins from infected exosomes were involved in unique pathways: angiogenesis and integrin signaling pathway. Our data provide preliminary evidence of a potential role for exosomes in the early diagnosis of uterine infection in dairy cows.

Excretion patterns of Campylobacter jejuni by dairy cows

ABSTRACTExcretion of the human bacterial pathogen Campylobacter jejuni by naturally infected dairy cows was investigated by monitoring 18 and 17 cows on two different commercial farms fortnightly for up to 12 months. C. jejuni was enumerated in the collected faeces by a most probable number technique and genotyped by enterobacterial repetitive intergenic consensus (ERIC) sequences. On both farms, C. jejuni excretion was highly variable among the studied cows, with excretion patterns ranging from chronic to sporadic. Chronic excretion of C. jejuni was associated with long-term predominance of a given genotype, co-excretion of a few genotypes, or succession over time of dominant genotypes. Sporadic excretion was with re-excretion of the same C. jejuni genotype when there was less than 1.5 months between C. jejuni-positive samples. Overall, the results showed the complexity of C. jejuni excretion pattern by dairy cows with an animal and farm specificity.

The effect of patent Dictyocaulus viviparus (re)infections on individual milk yield and milk quality in pastured dairy cows and correlation with clinical signs

BackgroundInfections with the bovine lungworm Dictyocaulus viviparus might lead to reduced milk production and detrimental impacts on milk quality resulting in considerable economic losses in dairy farming.MethodsIn the presented field study, 1988 faecal samples were collected from 1166 Black and White dairy cows allocated in 17 small and medium-sized German grassland farms. Faecal samples were collected in summer and autumn 2015 to assess D. viviparus larvae excretion. Test-day records were used to estimate the association between patent D. viviparus infections in individual cows and the milk production parameters milk yield, milk protein and milk fat content by using linear mixed models. Bulk tank milk (BTM) samples from each farm and individual milk samples from those cows which were excreting larvae in summer were collected in autumn. In addition, occurrence of the clinical symptom “coughing” was noted in individual cows during autumn sampling to determine its association with patent lungworm infections.ResultsPatent D. viviparus infections were found on 23.5% (4/17) of farms with a prevalence at the individual cow level of 0.9% (9/960) in summer and 3.4% (35/1028) in autumn. No BTM sample exceeded the BTM ELISA cut-off value of 0.410 optical density ratio (ODR), the mean value was 0.168 ODR. Only one individual milk sample exceeded the individual milk ELISA cut-off value of 0.573 ODR (mean value of 0.302 ODR). A patent D. viviparus infection status was associated with a lower average daily milk yield of 1.62 kg/cow/day (P = 0.0406). No significant association was found with milk protein or fat content representing milk quality parameters. Coughing was observed in 5.9% (61/1028) of cows. Of the coughing cows, only 4.9% (3/61) had a patent lungworm infection. Fisher’s exact test showed no significant difference between infected and non-infected coughing cows.ConclusionsFarmers and veterinarians should be aware that patent lungworm (re)infections in dairy cows reduce milk yield, despite the absence of clinical signs. Furthermore, if dairy cows present with coughing, other differential diagnoses need to be considered in addition to dictyocaulosis.