Inducible Plasmid Research Articles

Phosphorylation of interleukin (IL)-24 is required for mediating its anti-cancer activity.

Interleukin (IL)-24 is a tumor suppressor/cytokine gene that undergoes post-translational modifications (PTMs). Glycosylation and ubiquitination are important for IL-24 protein stabilization and degradation respectively. Little is known about IL-24 protein phosphorylation and its role in IL-24-mediated anti-tumor activities. In this study we conducted molecular studies to determine whether IL-24 phosphorylation is important for IL-24-mediated anti-cancer activity.Human H1299 lung tumor cell line that was stably transfected with a doxycycline (DOX)-inducible (Tet-on) plasmid vector carrying the cDNA of IL-24-wild-type (IL-24wt) or IL-24 with all five phosphorylation sites replaced (IL-24mt) was used in the present study. Inhibition of tumor cell proliferation, cell migration and invasion, and induction of G2/M cell cycle arrest was observed in DOX-induced IL-24wt-expressing cells but not in IL-24mt-expressing cells. Secretion of IL-24mt protein was greatly reduced compared to IL-24wt protein. Further, IL-24wt and IL-24mt proteins markedly differed in their subcellular organelle localization. IL-24wt but not IL-24mt inhibited the AKT/mTOR signaling pathway. SiRNA-mediated AKT knockdown and overexpression of myristolyated AKT protein confirmed that IL-24wt but not IL-24mt mediated its anti-cancer activity by inhibiting the AKT signaling pathway.Our results demonstrate that IL-24 phosphorylation is required for inhibiting the AKT/mTOR signaling pathway and exerting its anti-cancer activities.

Engineering mediator-based electroactivity in the obligate aerobic bacterium Pseudomonas putida KT2440.

Pseudomonas putida strains are being developed as microbial production hosts for production of a range of amphiphilic and hydrophobic biochemicals. P. putida's obligate aerobic growth thereby can be an economical and technical challenge because it requires constant rigorous aeration and often causes reactor foaming. Here, we engineered a strain of P. putida KT2440 that can produce phenazine redox-mediators from Pseudomonas aeruginosa to allow partial redox balancing with an electrode under oxygen-limited conditions. P. aeruginosa is known to employ its phenazine-type redox mediators for electron exchange with an anode in bioelectrochemical systems (BES). We transferred the seven core phenazine biosynthesis genes phzA-G and the two specific genes phzM and phzS required for pyocyanin synthesis from P. aeruginosa on two inducible plasmids into P. putida KT2440. The best clone, P. putida pPhz, produced 45 mg/L pyocyanin over 25 h of growth, which was visible as blue color formation and is comparable to the pyocyanin production of P. aeruginosa. This new strain was then characterized under different oxygen-limited conditions with electrochemical redox control and changes in central energy metabolism were evaluated in comparison to the unmodified P. putida KT2440. In the new strain, phenazine synthesis with supernatant concentrations up to 33 μg/mL correlated linearly with the ability to discharge electrons to an anode, whereby phenazine-1-carboxylic acid served as the dominating redox mediator. P. putida pPhz sustained strongly oxygen-limited metabolism for up to 2 weeks at up to 12 μA/cm2 anodic current density. Together, this work lays a foundation for future oxygen-limited biocatalysis with P. putida strains.

Genomic analysis reveals distinct concentration-dependent evolutionary trajectories for antibiotic resistance in Escherichia coli.

Evolution of bacteria under sublethal concentrations of antibiotics represents a trade-off between growth and resistance to the antibiotic. To understand this trade-off, we performed in vitro evolution of laboratory Escherichia coli under sublethal concentrations of the aminoglycoside kanamycin over short time durations. We report that fixation of less costly kanamycin-resistant mutants occurred earlier in populations growing at lower sublethal concentration of the antibiotic, compared with those growing at higher sublethal concentrations; in the latter, resistant mutants with a significant growth defect persisted longer. Using deep sequencing, we identified kanamycin resistance-conferring mutations, which were costly or not in terms of growth in the absence of the antibiotic. Multiple mutations in the C-terminal end of domain IV of the translation elongation factor EF-G provided low-cost resistance to kanamycin. Despite targeting the same or adjacent residues of the protein, these mutants differed from each other in the levels of resistance they provided. Analysis of one of these mutations showed that it has little defect in growth or in synthesis of green fluorescent protein (GFP) from an inducible plasmid in the absence of the antibiotic. A second class of mutations, recovered only during evolution in higher sublethal concentrations of the antibiotic, deleted the C-terminal end of the ATP synthase shaft. This mutation confers basal-level resistance to kanamycin while showing a strong growth defect in the absence of the antibiotic. In conclusion, the early dynamics of the development of resistance to an aminoglycoside antibiotic is dependent on the levels of stress (concentration) imposed by the antibiotic, with the evolution of less costly variants only a matter of time.

Abstract 5207: miR-491 and miR-218: Two possible tools to reduce FOXP3 expression in breast carcinomas

Abstract The Forkhead box P3 (FOXP3) gene is a member of the forkhead/winged-helix family of transcription factors implicated in the regulation of immune system development and function. However, FOXP3 is also expressed in human epithelial cancers, where it has been reported to be associated with poor prognosis and in particular with metastasis. Aim of our work is to identify microRNAs able to regulate FOXP3 expression in breast tumors. To discover microRNAs able to regulate FOXP3 expression in breast cancer cells, an in silico analysis has been performed. Among microRNAs harboring FOXP3 seed regions, we focused our attention on miR-218 and miR-491, described to have oncosuppressive properties. Indeed, it has been reported that miR-218 expression stimulates activation of tumor suppressor genes and miR-491 expression inversely correlates with migratory potential in HCC cell lines and in vivo with metastatic potential. We therefore evaluated the ability of these microRNAs to act as oncosuppressors by targeting FOXP3 in a breast cancer model. After transient co-transfection either of miR-218 or miR-491 with FOXP3 in MDA-MB-231 cells, a significant decrease in FOXP3 expression at protein level by WB was found. To perform functional studies both in vitro and in vivo, we generated a breast cancer cell model by stable transfection of MDA-MB-231 with inducible Tet-off plasmid encoding for FOXP3 encompassing 3′UTR region, thus maintaining microRNA-mediated regulation. We demonstrated that FOXP3 expressing clones display an increased migration capacity as compared with their respective non-induced cells. Also in these stable clones a reduction of FOXP3 expression after transfection of miR-491 and miR-218 has been demonstrated by WB. Moreover, FOXP3 was confirmed to be a direct target of both microRNAs by luciferase reporter assay. We also found an inverse correlation between miR-491 levels and FOXP3 expression in human breast carcinoma specimens. Overall, these preliminary results demonstrate that microRNAs can regulate FOXP3 expression, and encourage to further investigate the biological and functional consequences of this targeting, and to exploit microRNAs as a potential therapeutic tool for FOXP3 expressing breast carcinomas. Citation Format: Martina Di Modica, Tiziana Triulzi, Viola Regondi, Marilena V. Iorio, Andrea Balsari, Elda Tagliabue, Patrizia Casalini. miR-491 and miR-218: Two possible tools to reduce FOXP3 expression in breast carcinomas. [abstract]. In: Proceedings of the 105th Annual Meeting of the American Association for Cancer Research; 2014 Apr 5-9; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2014;74(19 Suppl):Abstract nr 5207. doi:10.1158/1538-7445.AM2014-5207

Preparation of Preproinsulin Gene Construct Containing the Metallothionein2A (pBINDMTChIns) and Its Expression in NIH3T3 Cell Line and Muscle Tissue of Alloxan Diabetic Rabbits

Background: Diabetes mellitus type 1, formerly called insulin-dependent diabetes, is one of the autoimmune diseases where insulinproducing cells are destroyed by autoimmune response via T cells. The new approaches in treatment of diabetes are using the stem cells, cell transplantation of islet β cell, gene transfer by virus based plasmids, and non-viral gene constructs. Objectives: The purpose of this study was to construct glucose inducible insulin gene plasmid and use it in the muscle tissue of the rabbit. Materials and Methods: To achieve this goal, the preproinsulin, metallothionein2A promoter and the response element to carbohydrate genes were cloned into pBIND plasmid by standard cloning methods, to construct pBINDMTChIns. The gene cloning products were confirmed by the polymerase chain reaction (PCR) and restriction enzyme digestion template. The recombinant plasmid, containing the preproinsulin gene, was transferred into NIH3T3 cells and insulin gene expression was evaluated by reverse transcriptase PCR and western blotting techniques. Plasmid naked DNA containing the preproinsulin gene was injected into the rabbits’ thigh muscles, and its expression was confirmed by western blotting method. Results: This study shows the prepared gene construct is inducible by glucose. Gene expression of preproinsulin was observed in muscle tissue of rabbits. Conclusions: These finding indicated that research in diabetes mellitus gene therapy could be performed on larger animals.

Transformable facultative thermophile Geobacillus stearothermophilus NUB3621 as a host strain for metabolic engineering.

Metabolic engineers develop inexpensive enantioselective syntheses of high-value compounds, but their designs are sometimes confounded by the misfolding of heterologously expressed proteins. Geobacillus stearothermophilus NUB3621 is a readily transformable facultative thermophile. It could be used to express and properly fold proteins derived from its many mesophilic or thermophilic Bacillaceae relatives or to direct the evolution of thermophilic variants of mesophilic proteins. Moreover, its capacity for high-temperature growth should accelerate chemical transformation rates in accordance with the Arrhenius equation and reduce the risks of microbial contamination. Its tendency to sporulate in response to nutrient depletion lowers the costs of storage and transportation. Here, we present a draft genome sequence of G. stearothermophilus NUB3621 and describe inducible and constitutive expression plasmids that function in this organism. These tools will help us and others to exploit the natural advantages of this system for metabolic engineering applications.

Constitutive and inducible co-expression systems for non-viral osteoinductive gene therapy

Tissue regenerative gene therapy requires expression strategies that deliver therapeutic effective amounts of transgenes. As physiological expression patterns are more complex than high-level expression of a singular therapeutic gene, we aimed at constitutive or inducible co-expression of 2 transgenes simultaneously. Co-expression of human bone morphogenetic protein 2 and 7 (BMP2/7) from constitutively expressing and doxycycline inducible plasmids was evaluated in vitro in C2C12 cells with osteocalcin reporter gene assays and standard assays for osteogenic differentiation. The constitutive systems were additionally tested in an in vivo pilot for ectopic bone formation after repeated naked DNA injection to murine muscle tissue. Inductor controlled differentiation was demonstrated in vitro for inducible co-expression. Both co-expression systems, inducible and constitutive, achieved significantly better osteogenic differentiation than single factor expression. The potency of the constitutive co-expression systems was dependent on relative expression cassette topology. In vivo, ectopic bone formation was demonstrated in 6/13 animals (46% bone formation efficacy) at days 14 and 28 in hind limb muscles as proven by in vivo µCT and histological evaluation. In vitro findings demonstrated that the devised single vector BMP2/7 co-expression strategy mediates superior osteoinduction, can be applied in an inductor controlled fashion and that its efficiency is dependent on expression cassette topology. In vivo results indicatethatco-expression of BMP2/7 applied by non-viral naked DNA gene transfer effectively mediates bone formation without the application of biomaterials, cells or recombinant growth factors, offering a promising alternative to current treatment strategies with potential for clinical translation in the future.

ADP-ribosylation of Translation Elongation Factor 2 by Diphtheria Toxin in Yeast Inhibits Translation and Cell Separation

Eukaryotic translation elongation factor 2 (eEF2) facilitates the movement of the peptidyl tRNA-mRNA complex from the A site of the ribosome to the P site during protein synthesis. ADP-ribosylation (ADP(R)) of eEF2 by bacterial toxins on a unique diphthamide residue inhibits its translocation activity, but the mechanism is unclear. We have employed a hormone-inducible diphtheria toxin (DT) expression system in Saccharomyces cerevisiae which allows for the rapid induction of ADP(R)-eEF2 to examine the effects of DT in vivo. ADP(R) of eEF2 resulted in a decrease in total protein synthesis consistent with a defect in translation elongation. Association of eEF2 with polyribosomes, however, was unchanged upon expression of DT. Upon prolonged exposure to DT, cells with an abnormal morphology and increased DNA content accumulated. This observation was specific to DT expression and was not observed when translation elongation was inhibited by other methods. Examination of these cells by electron microscopy indicated a defect in cell separation following mitosis. These results suggest that expression of proteins late in the cell cycle is particularly sensitive to inhibition by ADP(R)-eEF2.

Biomining active cellulases from a mining bioremediation system

Functional metagenomics has emerged as a powerful method for gene model validation and enzyme discovery from natural and human engineered ecosystems. Here we report development of a high-throughput functional metagenomic screen incorporating bioinformatic and biochemical analyses features. A fosmid library containing 6144 clones sourced from a mining bioremediation system was screened for cellulase activity using 2,4-dinitrophenyl β-cellobioside, a previously proven cellulose model substrate. Fifteen active clones were recovered and fully sequenced revealing 9 unique clones with the ability to hydrolyse 1,4-β-d-glucosidic linkages. Transposon mutagenesis identified genes belonging to glycoside hydrolase (GH) 1, 3, or 5 as necessary for mediating this activity. Reference trees for GH 1, 3, and 5 families were generated from sequences in the CAZy database for automated phylogenetic analysis of fosmid end and active clone sequences revealing known and novel cellulase encoding genes. Active cellulase genes recovered in functional screens were subcloned into inducible high copy plasmids, expressed and purified to determine enzymatic properties including thermostability, pH optima, and substrate specificity. The workflow described here provides a general paradigm for recovery and characterization of microbially derived genes and gene products based on genetic logic and contemporary screening technologies developed for model organismal systems.

Silencing Mutated β-Catenin Inhibits Cell Proliferation and Stimulates Apoptosis in the Adrenocortical Cancer Cell Line H295R

ContextAdrenocortical carcinoma (ACC) is a rare and highly aggressive endocrine neoplasm, with limited therapeutic options. Activating β-catenin somatic mutations are found in ACC and have been associated with a poor clinical outcome. In fact, activation of the Wnt/β-catenin signaling pathway seems to play a major role in ACC aggressiveness, and might, thus, represent a promising therapeutic target.ObjectiveSimilar to patient tumor specimen the H295 cell line derived from an ACC harbors a natural activating β-catenin mutation. We herein assess the in vitro and in vivo effect of β-catenin inactivation using a doxycyclin (dox) inducible shRNA plasmid in H295R adrenocortical cancer cells line (clone named shβ).ResultsFollowing dox treatment a profound reduction in β-catenin expression was detectable in shβ clones in comparison to control clones (Ctr). Accordingly, we observed a decrease in Wnt/βcatenin-dependent luciferase reporter activity as well as a decreased expression of AXIN2 representing an endogenous β-catenin target gene. Concomitantly, β-catenin silencing resulted in a decreased cell proliferation, cell cycle alterations with cell accumulation in the G1 phase and increased apoptosis in vitro. In vivo, on established tumor xenografts in athymic nude mice, 9 days of β-catenin silencing resulted in a significant reduction of CTNNB1 and AXIN2 expression. Moreover, continous β-catenin silencing, starting 3 days after tumor cell inoculation, was associated with a complete absence of tumor growth in the shβ group while tumors were present in all animals of the control group.ConclusionIn summary, these experiments provide evidences that Wnt/β-catenin pathway inhibition in ACC is a promising therapeutic target.

LuxS influencesEscherichia colibiofilm formation through autoinducer-2-dependent and autoinducer-2-independent modalities

Escherichia coli produces biofilms in response to the small molecule autoinducer-2 (AI-2), a product of the LuxS enzyme. LuxS is part of the activated methyl cycle and could also affect biofilm development by AI-2-independent effects on metabolism. A luxS deletion mutant of E.coli W3110 and an inducible plasmid-luxS-complemented strain were used to identify AI-2-independent phenotypes. Differential interference contrast microscopy revealed distinct surface colonization patterns. Confocal microscopy followed by quantitative image analysis determined differences in biofilm topography correlating with luxS expression; deletion mutant biofilms had a 'spreading' phenotype, whereas the complement had a 'climbing' phenotype. Addition of exogenous 4,5-dihydroxy-2,3-pentanedione (DPD), an AI-2 precursor, to the deletion mutant increased biofilm height and biomass, whereas addition of the methyl donor S-adenosyl methionine or aspartate prevented the luxS-complemented strain from producing a thick biofilm. The luxS-complemented strain autoaggregated, indicating that fimbriae production was inhibited, which was confirmed by transmission electron microscopy. DPD could not induce autoaggregation in the deletion mutant, demonstrating that fimbriation was an AI-2-independent phenotype. Carbon utilization was affected by LuxS, potentially contributing to the observed phenotypic differences. Overall, the work demonstrated that LuxS affected E.coli biofilm formation independently of AI-2 and could assist in adapting to diverse conditions.

ELMO Domains, Evolutionary and Functional Characterization of a Novel GTPase-activating Protein (GAP) Domain for Arf Protein Family GTPases

The human family of ELMO domain-containing proteins (ELMODs) consists of six members and is defined by the presence of the ELMO domain. Within this family are two subclassifications of proteins, based on primary sequence conservation, protein size, and domain architecture, deemed ELMOD and ELMO. In this study, we used homology searching and phylogenetics to identify ELMOD family homologs in genomes from across eukaryotic diversity. This demonstrated not only that the protein family is ancient but also that ELMOs are potentially restricted to the supergroup Opisthokonta (Metazoa and Fungi), whereas proteins with the ELMOD organization are found in diverse eukaryotes and thus were likely the form present in the last eukaryotic common ancestor. The segregation of the ELMO clade from the larger ELMOD group is consistent with their contrasting functions as unconventional Rac1 guanine nucleotide exchange factors and the Arf family GTPase-activating proteins, respectively. We used unbiased, phylogenetic sorting and sequence alignments to identify the most highly conserved residues within the ELMO domain to identify a putative GAP domain within the ELMODs. Three independent but complementary assays were used to provide an initial characterization of this domain. We identified a highly conserved arginine residue critical for both the biochemical and cellular GAP activity of ELMODs. We also provide initial evidence of the function of human ELMOD1 as an Arf family GAP at the Golgi. These findings provide the basis for the future study of the ELMOD family of proteins and a new avenue for the study of Arf family GTPases.

Designing and using RNA scaffolds to assemble proteins in vivo

RNA scaffolds are synthetic noncoding RNA molecules with engineered 3D folding harnessed to spatially organize proteins in vivo. Here we provide a protocol to design, express and characterize RNA scaffolds and their cognate proteins within 1 month. The RNA scaffold designs described here are based on either monomeric or multimeric units harboring RNA aptamers as protein docking sites. The scaffolds and proteins are cloned into inducible plasmids and expressed to form functional assemblies. RNA scaffolds find applications in many fields in which in vivo organization of biomolecules is of interest. RNA scaffolds provide extended flexibility compared with DNA or protein scaffolding strategies through programmed modulation of multiple protein stoichiometry and numbers, as well as the proteins' relative distances and spatial orientations. For synthetic biology, RNA scaffolds provide a new platform that can be used to increase yields of sequential metabolic pathways.

Metabolic engineering of Escherichia coli BL21 for biosynthesis of heparosan, a bioengineered heparin precursor

As a precursor of bioengineered heparin, heparosan is currently produced from Escherichia coli K5, which is pathogenic bacteria potentially causing urinary tract infection. Thus, it would be advantageous to develop an alternative source of heparosan from a non-pathogeneic strain. In this work we reported the biosynthesis of heparosan via the metabolic engineering of non-pathogenic E. coli BL21 as a production host. Four genes, KfiA, KfiB, KfiC and KfiD, encoding enzymes for the biosynthesis of heparosan in E. coli K5, were cloned into inducible plasmids pETDuet-1 and pRSFDuet-1 and further transformed into E. coli BL21, yielding six recombinant strains as follows: sA, sC, sAC, sABC, sACD and sABCD. The single expression of KfiA (sA) or KfiC (sC) in E. coli BL21 did not produce heparosan, while the co-expression of KfiA and KfiC (sAC) could produce 63mg/L heparosan in shake flask. The strain sABC and sACD could produce 100 and 120mg/L heparosan, respectively, indicating that the expression of KfiB or KfiD was beneficial for heparosan production. The strain sABCD could produce 334mg/L heparosan in shake flask and 652mg/L heparosan in 3-L batch bioreactor. The heparosan yield was further increased to 1.88g/L in a dissolved oxygen-stat fed-batch culture in 3-L bioreactor. As revealed by the nuclear magnetic resonance analysis, the chemical structure of heparosan from recombinant E. coli BL21 and E. coli K5 was identical. The weight average molecular weight of heparosan from E. coli K5, sAC, sABC, sACD, and sABCD was 51.67, 39.63, 91.47, 64.51, and 118.30kDa, respectively. This work provides a viable process for the production of heparosan as a precursor of bioengineered heparin from a safer bacteria strain.

RibM from Streptomyces davawensis is a riboflavin/roseoflavin transporter and may be useful for the optimization of riboflavin production strains

BackgroundThe bacterium Bacillus subtilis, which is not a natural riboflavin overproducer, has been converted into an excellent production strain by classical mutagenesis and metabolic engineering. To our knowledge, the enhancement of riboflavin excretion from the cytoplasm of overproducing cells has not yet been considered as a target for (further) strain improvement. Here we evaluate the flavin transporter RibM from Streptomyces davawensis with respect to improvement of a riboflavin production strain.ResultsThe gene ribM from S. davawensis, coding for a putative facilitator of riboflavin uptake, was codon optimized (ribMopt) for expression in B. subtilis. The gene ribMopt was functionally introduced into B. subtilis using the isopropyl-β-thiogalactopyranoside (IPTG)-inducible expression plasmid pHT01: Northern-blot analysis of total RNA from IPTG treated recombinant B. subtilis cells revealed a ribMopt specific transcript. Western blot analysis showed that the his6-tagged heterologous gene product RibM was present in the cytoplasmic membrane. Expression of ribM in Escherichia coli increased [14C]riboflavin uptake, which was not affected by the protonophore carbonyl cyanide m-chlorophenylhydrazone (CCCP). Expression of ribMopt supported growth of a B. subtilis ΔribB::Ermr ΔribU::Kanr double mutant deficient in riboflavin synthesis (ΔribB) and also deficient with respect to riboflavin uptake (ΔribU). Expression of ribMopt increased roseoflavin (a toxic riboflavin analog produced by S. davawensis) sensitivity of a B. subtilis ΔribU::Kanr strain. Riboflavin synthesis by a model riboflavin B. subtilis production strain overproducing RibM was increased significantly depending on the amount of the inducer IPTG.ConclusionsThe energy independent flavin facilitator RibM could in principle catalyze riboflavin export and thus may be useful to increase the riboflavin yield in a riboflavin production process using a recombinant RibM overproducing B. subtilis strain (or any other microorganism).

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Abstract 2182: IGFBP-6 in nasopharyngeal carcinoma is a candidate tumor suppressor gene by regulating the expression of EGR-1

Abstract Nasopharyngeal carcinoma (NPC) is one of the common cancers in South-Eastern Asia, particularly southern China, Singapore and Taiwan. It has been proposed to be closely associated with Epstein-Barr virus (EBV), but other researches also show that EBV can enhance the NPC proliferation but not related with initiation or promotion of NPC carcinogenesis. The aim of this study was to identify the pivotal genes that may be altered during NPC progression. Using cDNA microarray analysis, we compared the expression of 18 genes between NPC and normal nasomucosal cells. Q-RT-PCR analysis found the expression of IBFBP-6 in NPC cell lines and immunolocalization of IGFBP-6 in NPC cells and biopsy specimens to be very weak. To explore the effects of IGFBP-6 on NPC tumor growth, we constructed inducible plasmids containing full-length IGFBP-6 cDNA (pBIG2i-IGFBP-6) and established pBIG2i-IGFBP-6-transfected NPC stable cell lines (NPC-TW01-pBIG2i-IGFBP-6). We then performed in vitro and in vivo functional analysis of the IGFBP-6 in these cell lines. Over-expression of IGFBP-6 significantly suppressed the proliferation, invasion and metastatic activity of NPC cells and increased their apoptosis. We found the EGR-1, caspase-1 and TSP-1 genes to be markedly up-regulated when NPC-TW01-pBIG2i-IGFBP-6 was treated with doxycycline. Knocking down EGR-1 with EGR-1 siRNA resulted in a decrease in expression of caspase-1, TSP-1 and EGR-1 but not the expression of IGFBP-6. However, in knockdown cells the unchanged expression of IGFBP-6 did not inhibit the migration of NPC cells. Chromatin immunoprecipitation and luciferase reporter assay experiments showed that IGFBP-6 bound the EGR-1 promoter regions and activated EGR-1 promoter. We conclude that IGFBP-6 can regulate the progression of NPC by regulating the expression of EGR-1. These results suggest that IGFBP-6 could be used as a new target for NPC therapy. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8 Suppl):Abstract nr 2182. doi:10.1158/1538-7445.AM2011-2182

Dual expression system for assembling phage lambda display particle (LDP) vaccine to porcine Circovirus 2 (PCV2)

The bacteriophage lambda small capsid protein D forms trimers on the phage head. D-fusion polypeptides can be expressed from plasmids in E. coli and remain soluble without aggregation. We report a dual expression system for the display of four immunodominant regions of porcine Circovirus 2 (PCV2) capsid protein (CAP) as D-CAP fusions on lambda display particles (LDP). The LDP-D-CAP preparation proved an effective vaccine in pigs, eliciting both cellular and humoral immune responses and PCV2 neutralizing antibodies. In our dual system wild type D expression was encoded by a heteroimmune infecting phage. The D-fusion protein expression in the infected cells was from an inducible plasmid, enabling the deferral of D-fusion expression until needed. The effective vaccine preparation depended upon the gradient purification of very high concentration, essentially tail-less display particles, not previously described.

Síntesis y purificación de apolipoproteína apo A-I Zaragoza (L144R) recombinante

Introduction Apolipoprotein A-I Zaragoza (apo A-I Z, L144R mutation) is an apolipoprotein A-I variant whose carriers have low HDL-cholesterol (HDL-c) concentrations but, paradoxically, no atherosclerotic symptoms despite the presence of additional atherogenic risks. In vivo metabolic studies performed on heterozygous carriers of this apo A-I variant revealed a two-fold increased fractional catabolic rate compared to the wild type protein, suggesting an enhanced effect on the overall reverse cholesterol transport process. Objectives To establish an expression and purification system of recombinant wild type apo A-I and apo A-I Z with high yield and purity in order to compare their properties related to reverse cholesterol transport as well as other anti-atherogenic characteristics. Methods A cDNA clone of wild type apo A-I was used as a PCR template to amplify the mature peptide sequence. Specially designed primers allowed the cloning of the sequence into an inducible expression pET-45 plasmid adding a Histidine tag in the N-terminal expressed peptide. Site directed mutagenesis was used to produce the L144R mutation in the apo A-I sequence to be expressed in the same system. E. coli BL21(DE3) were transformed with the prepared plasmids, peptide expression was induced and purification was performed in non-denaturing conditions by nickel affinity chromatography. Results Expression and purification of both proteins was achieved and verified by SDS-PAGE and immunochemical procedures. Actual yields were over 30 mg of purified protein per litre of culture and a 94% purity grade for the wild type protein and 93% for the mutant protein were obtained. Conclusions A system for the expression and purification of wild type apo A-I and apo A-I Z with high yield and purity grade has been set up. This will be the basis for future structural and functional characterization of the L144R apo A-I mutant allowing the study of its anti-atherogenic properties.

Downregulation of voltage-dependent anion channel-1 expression by RNA interference prevents cancer cell growth in vivo

The voltage-dependent anion channel 1 (VDAC1), located at the outer mitochondrial membrane (OMM), is a key protein in regulating the exchange of ions, nucleotides and variety of metabolites in and out of the mitochondria. As such, VDAC serves a crucial role in cellular energy maintenance. We have previously shown that silencing VDAC1 expression in T-Rex-293cells by means of RNA interference using shRNA directed to human (h)VDAC1 resulted in reduced ATP production and a decrease in cell growth. Since cancer cells highly express VDAC, we examined here the effects of shRNA-hVDAC1-mediated silencing of VDAC1 expression on cancer cell growth in an animal model. To this end, HeLa cervical cancer cells were stably transfected with an inducible shRNA plasmid encoding for a sequence directed to hVDAC1. VDAC1 expression in these cells was decreased almost completely. Stably transfected shRNA-hVDAC1 HeLa cells proliferated much slower than did control cells, pointing to VDAC1 expression as being essential for normal growth of HeLa cancer cells. We further studied the ability of hVDAC1 silencing to block cancer cell proliferation in vivo. Nude mice subcutaneously inoculated with stably transfected shRNA-hVDAC1 HeLa cells developed about 40-fold smaller tumors than did mice inoculated with control HeLa cells. Taken together, the results of this study demonstrate, for the first time, the anti-cancer therapeutic potential of VDAC1 down-regulation by means of shRNA.