Indehiscent Capsules Research Articles

Notas acerca da morfologia, taxonomia e distribuição geográfica de Apeiba (Malvaceae, Grewioideae) na Amazônia brasileira

ABSTRACT Apeiba (Malvaceae, Grewioideae) is an important component of the Neotropical flora, but taxonomic knowledge of its species is limited, particularly within the Amazon region. This study aimed to provide an updated taxonomic treatment of Apeiba native to Brazil, with focus on Amazonian collections. Species of Apeiba are trees with large yellowish-white flowers with a very particular fruit, an indehiscent capsule, usually globose to slightly flattened, covered either by long and numerous bristles, or densely apiculate. We provide synoptic descriptions for each Amazonian Apeiba species from Brazil, and comments on relevant synonyms and designated lectotypes for three names. We also provide an identification key, a list of examined material and distribution data, including a list of new occurrence records for some Brazilian states. Illustrations and notes on taxonomy and nomenclature are also included when appropriate.

Molecular phylogenetics, biogeography and character evolution inSesamum(Pedaliaceae)

AbstractAs recently circumscribed, Sesamum was rendered monophyletic by including the three segregate genera Ceratotheca, Dicerocaryum and Josephinia. Here, the monophyly of Sesamum and the currently accepted infrageneric taxa was tested using expanded phylogenetic analyses. In addition, nine taxonomically useful morphological characters were optimized on the resulting phylogenetic tree to assess their evolutionary pattern. The phylogenetic analyses support the expanded circumscription of Sesamum and the monophyly of Sesamum section Sesamum relative to Sesamum sections Aptera, Ceratotheca, Chamaesesamum, Dicerocaryum, Josephinia and Sesamoptera. Most sections were retrieved as monophyletic, except Sesamum section Ceratotheca which was shown to be paraphyletic. Character reconstruction infers the ancestor of Sesamum to have had an erect growth habit, simple leaves with entire margins, ovaries with incompletely divided locules, indehiscent capsules that are oblong-quadrangular in lateral view with a beaked apex and winged seeds. Relative to the ancestral states, Sesamum has dehiscent fruits and fully divided locules as synapomorphies, with reversals to the ancestral state (indehiscence, undivided locules) in Sesamum sections Josephinia and Dicerocaryum. The absence of trichomes on mature vegetative parts and the development of lobed leaves are synapomorphies for Sesamum section Sesamopteris. Characters such as dentate and lobulate leaf margins and discoid fruit with horn-like protrusions are homoplastic in Sesamum. Dated phylogeny and ancestral range estimation suggest a southern African origin for the genus with subsequent diversification to tropical Africa, India and Australia. Sesamum has an estimated crown age of 38.1 ± 5.2 Myr with subsequent dispersal scenarios into tropical Africa, Asia and Australia during the Miocene from 24.5 Mya. Dispersal, rather than continental vicariance, is the probable explanation for the pantropical distribution of Sesamum.

Elucidating the pleiotropic effects of sesame KANADI1 locus on leaf and capsule development.

Autonomous seed dispersal is a critical trait for wild plants in natural ecosystems; however, for domesticated crop-plants it can lead to significant yield losses. While seed shattering was a major selection target during the initial domestication of many crops, this trait is still targeted in breeding programs, especially in 'orphan crops' such as sesame, whose capsules dehisce upon ripening. Here we used a mapping population derived from a cross between wild-type (dehiscent) × indehiscent lines to test the hypothesis that the selection against indehiscent alleles in sesame is a consequence of complex genetic interactions associated with yield reduction. We identified a major pleiotropic locus, SiKANADI1, associated with abnormal hyponastic leaf and indehiscent capsule, and genetically dissected its underlying mechanism using a set of near-isogenic lines. Transcriptional, anatomical and physiological information shed light, for the first time, on the polar regulatory gene network in sesame. The pleiotropic effect of SiKANADI1 on leaf and capsule structure and its influence on photosynthetic capacity and final yield are thoroughly characterized. Overall, our results provide new insights on the genetic and morphological mechanisms regulating capsule indehiscence in sesame, and discuss their evolutionary consequences and potential for future sesame breeding.

Effect of the medium composition on the asymbiotic germination and in vitro development of the Laeliocattleya hybrid

In vitro cultivation techniques are viable alternatives for the germination and production of orchid seedlings in a short period. From another perspective, when studying the optimal germination conditions, knowing about the seeds viability is essential. Therefore, this research aimed to study the appropriate medium for germination and in vitro development of xLaeliocattleya Richard Muller. In addition, optimal preconditioning was determined to enhance the tetrazolium test. Initially, the indehiscent capsules were collected in a nursery in Bochalema-Norte de Santander. From them, seeds were obtained for the preconditioning and germination tests. One portion was subjected to different precondition treatments: distilled water, sodium hypochlorite (0.5–1.0%) and sucrose (10%). Afterwards, seeds were rinsed and exposed to different concentrations and exposure periods of tetrazolium. Regarding in vitro cultivation, the commercial medium Orchid Seed Sowing Medium, Murashige & Skoog (MS), and the MS supplemented with coconut water (MSC), pineapple juice (MSP) and gibberellic acid (MSGA3) were evaluated. The highest percentage of viability was obtained by subjecting the seeds to preconditioning with 10% sucrose and keeping them for 24 h in a 0.5% tetrazolium solution. With respect to the MS media used, those enriched with organic supplements proved to be superior to the other treatments since the highest results were achieved both in asymbiotic germination (56 ± 2.8%) and in seedlings formation (25.8 ± 0.8) with the MSP medium, followed by the MSC medium. In this way, a viable and low-cost alternative is offered for the commercial propagation of xLaeliocattleya Richard Muller.

<p><strong><em>Dimetia brevipetiolata </em></strong><strong>(Spermacoceae: Rubiaceae): A new species from Guangxi, China</strong></p>

A new species, Dimetia brevipetiolata R. J. Wang, from Guangxi Zhuang Autonomous Region, China, is described and photographed. Morphologically, it is similar to D. scandens and D. ampliflora with respect to their terete stem, lanceolate and thick papery leaves and compound-cymose inflorescences, but differs in prostrate habit, subsessile leaves, rounded leaf base, nearly glabrous corolla, and indehiscent capsules. The molecular phylogenetic analysis revealed that D. brevipetiolata was embedded in the Dimetia clade and closely related to D. auricularia. It is evaluated as Least Concern according to IUCN Red List Categories and Criteria.

Inheritance of Indehiscent Capsule Character, Heritability and Genetic Advance Analyses in the Segregation Generations of Dehiscent x Indehiscent Capsules in Sesame

The investigation was made to estimate heritability and genetic advance and thus understand the genetic behavior of indehiscent capsule character in sesame with the field experiments during three consecutive years. Muganli-57 (♀) parent with dehiscent capsule was crossed with ACS 344 (♂), an introduction material, which had indehiscent capsule character. The results in the F1 generation indicated that dehiscent capsule character was dominant over indehiscent capsule. In F2, 3:1 segregation ratio was monitored and further confirmed in F3 showing indehiscent capsule character was controlled by a single recessive gene. Heritability was estimated by parent-offspring regression and the data were collected in F1, F2 and F3 generations derived from the cross between dehiscent and indehiscent capsule types. Heritability estimates in narrow sense for number of branches, number of capsules per plant, 1000 seed weight and seed yield were low in indehiscent capsule types of F2. Genetic advance had also low values except for number of branches (30.79%). Whilst low values obtained for indehiscent capsule, dehiscent capsule types in F2 indicated high heritability for the characters studied (70.52-92.84%). Stem height to the first capsule and plant height were of high heritabilities in both capsule types of F2 and F3. Although indehiscent capsule types had low means and heritabilities due to pleiotropic effects, mutant cross had heterotic effect on dehiscent types for all the characters. This positive shift could be explained by additive gene effect and this information presented in this investigation was therefore highly beneficial for the genetic improvement of sesame and reaching to high yielding types. This research also provides an example that bad parent may have a good progeny. C

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening

BackgroundLeaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied.ResultsFor cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed.ConclusionsSiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

Spectrum and Frequency of Mutations Induced by Gamma Radiations in Three Varieties of Nigerian Sesame (Sesamum indicum L.)

Insufficient genetic variability is one of the major problems of plant breeding programmes, especially in sesame. Gamma radiation has been reported to be very effective in creating genetic variability in plants. Three varieties of Nigerian sesame were assessed for spectrum and frequency of mutation induced by Gamma radiations in M1 and M2 generations. The varieties (NCRIBEN-04E, NCRIBEN-01M and NCRIBEN-03L) were treated with four different doses of gamma rays (250, 350, 450 and 550 Gy). The treated and untreated seeds (control) were sown in planting bags (under field condition) to raise M1 plants. Four treatments: V1D5, V2D3, V3D2 and V3D4 (from M1 plants) were selected and bulked to obtain M2 populations. The results of M1 revealed four mutant fruit traits: multicarpellate capsule, multiple capsule per leaf axil, indehiscent capsule and terminal capsules. The highest frequencies of the traits in M1 generation were 2.50×10-2, 9.17×10-2, 1.67×10-2and3.33×10-2 respectively. The highest branching (7) was from NCRIBEN-01M, while the least (2) was from NCRIBEN-04E. The M2 plants were grouped into eight M2 lines. The dose range (250-550 Gy) was proved to be effective in inducing viable mutations in sesame.

Phylogeny of Hedyotis L. (Rubiaceae: Spermacoceae): Redefining a complex Asian–Pacific assemblage

AbstractThe genus Hedyotis (Rubiaceae: Spermacoceae) has long served as a repository for tropical herbaceous species that do not fit readily into other genera. Circumscribed broadly the genus becomes a highly heterogeneous assembly, but relationships of Hedyotis have been difficult to resolve and it has proven very difficult to circumscribe the genus in a more narrow sense. Here we present Bayesian phylogenetic analyses of Hedyotis using plastid (rps16, petD) and nuclear (ITS, ETS) sequence data to resolve monophyletic lineages, to test former taxonomic hypotheses, and to revise the taxa within a well–supported evolutionary framework. Four hundred and sixty–seven sequences representing 129 accessions, never previously included in any phylogenetic analyses, are newly reported. Hedyotis, as previously circumscribed, is polyphyletic, but all investigated species, except for Hedyotis coronaria, are resolved in one of three well–supported monophyletic groups. The largest clade includes all investigated species of Hedyotis from the Indian subcontinent as well as three groups of species with primarily Chinese distributions. The type species of Hedyotis (H. fruticosa) is resolved with the Indian subcontinent species and following previous suggestions this group is referred to as Hedyotis s.str. Species currently recognized under the generic names Metabolos and Pleiocraterium are resolved in Hedyotis s.str. The second–largest group comprises a series of smaller, but well–supported, clades including the Leptopetalum clade, the genus Kadua, an unnamed group distributed in Asia and the Pacific, and a large Asian group referred to here as the Exallage/Dimetia clade. The third group includes a few SE Asian Hedyotis, as well as all investigated species of the genus Neanotis. Hedyotis coronaria is not closely related to other species from Asia and is resolved with Spermacoce hispida. The analyses indicate that diplophragmous capsules and “fruticosa–type” seeds occur outside of Hedyotis s.str., and several species suggested to have these features are resolved in the Exallage/Dimetia clade. Species sug gested to have indehiscent capsules, a feature used by Bremekamp to characterize the genus Exallage, are also resolved in both the Exallage/Dimetia clade and in Hedyotis s.str., but a close examination indicates that the capsules are not truly indehiscent in the Hedyotis s.str. species. One species of Metabolos and one species of Pleiocraterium are given new species names, and one species of Pleiocraterium is transferred to Hedyotis and three species of Hedyotis are transferred to Neanotis.

Taxonomic clarification in W MediterraneanAndrocymbium (Colchicaceae): A. wyssianumsunk in the synonymy ofA. gramineumandA. europaeumrestored

Hoyo A. del & Pedrola-Monfort J.: Taxonomic clarification in W Mediterranean Androcymbium (Colchicaceae): A. wyssianum sunk in the synonymy of A. gramineum and A. europaeum restored. — Willdenowia 40: 47–53. — Online ISSN 1868-6397. — © 2010 BGBM Berlin-Dahlem. doi:10.3372/wi.40.40103 (available via http//dx.doi.org/)Capsule dehiscence has been used as a diagnostic character for W Mediterranean species of Androcymbium. Depending on the state of capsule maturity, the character, however, can be ambiguous in herbarium material. Based on morphological, phenological and cpDNA characters it is shown that misinterpretation of the capsule as indehiscent in the type material of A. gramineum has led to serious taxonomic confusion. The combined analyses produced evidence that A. gramineum of the population from the type locality at Essaouira, Morocco, is conspecific with A. wyssianum. A. gramineum is therefore the correct name for the species with dehiscent capsules, whereas the populations with indehiscent capsules at the Atlantic coast north of Essaouira and in SE Spain represent a second species, which is correctly named A. europaeum.

Morfoanatomia e ontogênese do pericarpo de Manihot caerulescens Pohl e M. tripartita Müll. Arg. (Euphorbiaceae)

Manihot caerulescens and M. tripartita are shrub species of cerrado, known as mandioca-brava. Works on structure of pericarp of Euphorbiaceae are rare and many of the found morphologic descriptions present dubious interpretations, especially on the dehiscence. The present work aimed to describe the morphology, anatomy and ontogeny of pericarp of the two species of Manihot, comparing themselves and relating structural aspects of pericarp to the dehiscence. We verified that the pericarp follow four developmental periods, as typical of dry fruits. Two meristems are formed: a subadaxial, that produces the inner mesocarp; and another adaxial, that forms the endocarp, homogeneous and collenchymatous in M. caerulescens, and heterogeneous in M. tripartita, with outer gelatinous fiber-sclereids and an collenchymatous inner portion. We observed the formation of separation tissue, composed of loose parenchyma, in direction to the dorsal bundle of the three carpels and to the septa, which are more evident in M. tripartita. Finally, we verified variation in the sclerenchymatous stratum: in M. caerulescens, there is a layer of fiber-sclereids and one of stone cells, both of the mesocarp; in M. tripartita, these two mesocarpic layers occur, with bigger thickness, increased of the outer endocarp, also composed of fiber-sclereids. The fruits of both species are capsules which type depends on the development of separation tissue and of the dimension of sclerenchymatous stratum. Thus M. caerulescens presents indehiscent capsules, while M. tripartita forms septi-loculicidal capsules, since the dehiscence, even so passive, occurs in the dorsal regions and in the direction to septa.

Evolution and biogeography ofLyalliaandHectorella(Portulacaceae), geographically isolated sisters from the Southern Hemisphere

AbstractThe Southern Hemisphere contains many monotypic taxa, for which phylogenetic relationships are important to illuminate biogeographical history. The monotypic genusLyalliais endemic to the sub-Antarctic Iles Kerguelen. A close relationship with another monotypic taxon, the New Zealand endemicHectorella, was proposed. They share a dense cushion growth habit with small coriaceous leaves that lack stipules. The solitary flowers are bicarpellate with two sepals, 4–5 petals, 3–5 stamens and a bifid style. The fruit is an indehiscent capsule with 1–5 seeds. The flowers ofLyallia kerguelensisare hermaphroditic with four petals and three stamens whereas the flowers ofHectorella caespitosaare female, male or hermaphroditic, with five petals and five stamens.Lyallia kerguelensisis rare on Kerguelen, whereasHectorella caespitosais confined to the South Island of New Zealand. Our phylogenetic analysis oftrnK/matK intergenic spacer andrbcL sequences provides evidence supporting a close relationship betweenLyalliaandHectorella. The two species form a well-supported clade that is nested within the Portulacaceae. Divergence estimates suggest they shared a common ancestor during the late Tertiary long after the fragmentation of Gondwana. Such relationships underscore the importance of transoceanic dispersal and extinctions for plant evolution in the Southern Hemisphere.

Joshua tree (Yucca brevifolia) seeds are dispersed by seed-caching rodents

:Joshua tree (Yucca brevifolia) is a distinctive and charismatic plant of the Mojave Desert. Although floral biology and seed production of Joshua tree and other yuccas are well understood, the fate of Joshua tree seeds has never been studied. We tested the hypothesis that Joshua tree seeds are dispersed by seed-caching rodents. We radioactively labelled Joshua tree seeds and followed their fates at five source plants in Potosi Wash, Clark County, Nevada, USA. Rodents made a mean of 30.6 caches, usually within 30 m of the base of source plants. Caches contained a mean of 5.2 seeds buried 3–30 mm deep. A variety of rodent species appears to have prepared the caches. Three of the 836 Joshua tree seeds (0.4%) cached germinated the following spring. Seed germination using rodent exclosures was nearly 15%. More than 82% of seeds in open plots were removed by granivores, and neither microsite nor supplemental water significantly affected germination. Joshua tree produces seeds in indehiscent pods or capsules, which rodents dismantle to harvest seeds. Because there is no other known means of seed dispersal, it is possible that the Joshua tree–rodent seed dispersal interaction is an obligate mutualism for the plant.

Differential seed ecology in the shrubs Kunzea rupestris, K. capitata and associated hybrids (Myrtaceae): the function of thin-walled fruit in a fire-prone vegetation

In fire-prone vegetation many plants bear thick woody fruits that retains seeds and insulate these seeds from heat. However, in the same vegetation, some plants retain seeds in thin indehiscent fruits that offer little protection from heat. The function of these thin indehiscent fruits is unknown. We investigated two closely related Kunzea species that occur together in fire-prone vegetation, namely eucalypt woodland. We also studied naturally occurring hybrids of these two species. K. rupestris bears indehiscent thin-walled fruit, whereas K. capitata bears fruit that dehisce to release seed on maturity. Hybrid fruits partly dehisce but retain seed. Studies of seed viability, dormancy and germination demonstrate a distinct combination of these traits for both species. Hybrid seed also has a unique combination of these traits, having some characteristics of both species. The indehiscent capsules impart dormancy to retained seed. However, K. capitata seed, which is not retained in fruit, also displays dormancy. In K. capitata, dormancy is associated with a water-impermeable seed coat. Surprisingly, seed retained in indehiscent capsules was found to have lower viability when exposed to heat than seed that had been released from capsules and exposed to heat.

Indehiscence Expression and Capsule Anatomy in Vernola

Euphorbia lagascae Spreng. is a potential new industrial crop because of the synthesis of vernolic acid in about 65% of the total fatty acids in its seed oil. Breeding research in the 1990s gave rise to the indehiscent Vernola cultivar as opposed to a complete dehiscence of the wild types. With the aim to evaluate the environmental influence in the expression of the nonshattering trait, field trials were sown in spring and autumn in Murcia, Spain, and Ancona, Italy, during 2001 and 2002. To further examine the basis of partial indehiscence, a capsule wall histological study was also performed. There was a significant decrease (P < 0.01) from 86.9 to 67.9% in the number of capsules retained per plant in the spring sowing, when mister sprinklers were used to increase relative humidity (RH) during pod formation. Overall, 37.9% indehiscent capsules per plant were retained in the autumn cycle vs. 77.4% in the spring cycle, indicating a strong influence of the growing season, which was associated to a combined effect of higher moisture and lower temperatures during capsule development. Transversal sections of carpel walls from Vernola capsules showed that the physical reason of the partial dehiscence observed in this cultivar is a small portion of the mesocarp remaining near the valve sutures, which makes the fruits susceptible to a slower opening under some environmental conditions.

A New Species of Cryptothallus from Costa Rica

Cryptothallus hirsutus is described as a new species from Costa Rica differing from C. mirabilis of oceanic northwestern Europe in its indehiscent capsules with no elaterophore and spores not coherent as tetrads. The faintly green gametophytes are particularly hairy and rhizoidal on both surfaces. The wide disjunction of these two underground species, surely disadvantaged in spore dispersal, supports recognition at a specific level. Curiously non-green, much branched thalli found underground on the Cerro de la Muerte in Costa Rica were presumed to be gametophytes of a Ly- copodium, sporophytes of which were associated with them. Joseph Beitel, who was present at the time of discovery, recognized them as a Crypto- thallus, and on closer examination, they indeed proved to be a thallose liverwort of the Metzgeri- ales similar to Aneura in having fleshy thalli and shoot calyptrae that enlarge and protect sporophytes throughout their growth and development. In sub- terranean habitat, pale, coralloid aspect, and struc- ture, the plants (Figs. 1, 3-4) greatly resemble

Genotypic effects on pollen morphology in sesame (Sesamum indicum L.)

The morphology (shape, exine wall pattern, diameter, volume, surface area) of mature pollen grains from eight genotypes, four within each of two capsule types (dehiscent, indehiscent) was studied. The shape was a flattened sphere (oblate) with a P (polar axis diameter): E (equatorial axis diameter) ratio = 0.69. The exine wall pattern consisted of a series of furrows passing through the poles and intersecting the equatorial plane at right (90°) angles. In cross section, the furrows appeared to be associated with shallow U-shaped structures with the intine protruding between these structures. Over the eight genotypes, the diameter, volume, and surface area were 65 μm, 147300 μm3, and 13444 μm2, respectively. For all three related characters, highly significant differences between capsule type and genotypes within capsule type were obtained. For each character, the dehiscent capsule type mean was larger than the indehiscent capsule type mean with minimum overlap among the four genotype means within each capsule type. Possibly, the numerous and diverse pleiotropic effects associated with this simply-inherited recessive indehiscent capsule type character includes pollen dimensions.

A CLADISTIC ANALYSIS OF CIRCAEA (ONAGRACEAE)

Abstract- Circaea (Onagraceae), a genus of seven species from the northern hemisphere, forms a monophylctic group defined by the following synapomorphies: two stamens (opposite the sepals), fruits indehiscent capsules, hooked hairs on the fruits, and perianth parts reduced to two. A cladistic analysis of the genus was performed using 22 characters from morphology, anatomy and palynology. The seven species and seven additional subspecies were considered the terminal taxa. Polarity of the characters is based on the outgroup comparison method. Eighteen equally parsimonious cladograms were produced, each with 32 steps and a consistency index of 0.75. A successive weighting procedure was applied, resulting in six cladograms with a consistency index of 0.95. All 24 cladograms share the following seven monophylctic groups: (1) all species except C. cordala and C. glabrescens (stipules deciduous); (2) the group of C. mollis, the three subspecies of C. lutetiana and C. erubescens (exsertcd nectary); (3) C. repens and all six subspecies of C. alpina (single-seeded fruits, stolons terminated by tubers, and viscin threads reduced or absent); (4) the six subspecies of C. alpina (unilocular ovaries with no trace of a second loculc and tardily opening perianth); (5) C. alpina subspecies alpina, micrantha, pacifica, and imaicola (flowers opening on ascending to erect pedicels); (6) C. alpina subspecies alpina, micrantha, and pacifica (translucent leaves); (7) C. alpina subspecies alpina and murantha (glabrous stems). Results of the cladistic analysis support most of the current systematic classification of the genus, except for the relationships among the three subspecies of C. lutetiana.

Melhoramento da mamoneira transferência do caráter indeiscência para o cultivar 'IAC-38' de mamoneira

No Estado de São Paulo cultiva-se quase que exclusivamente o cultivar de mamoeira 'IAC-38', que possui porte pequeno, grande vigor, chegando a dar 2000 kg de sementes por hectare e 41% de óleo. Tem, porém, o inconveniente de apresentar frutos deiscentes, resultando na necessidade de várias colheitas por ano, o que encarece o produto. Em 1957 realizaram-se hibridações visando transferir o caráter indeiscência do cultivar 'Cimarron' para o 'IAC-38'. Das numerosas progênies estudadas até F5, duas se destacaram e deram origem a promissoras linhagens de frutos indeiscentes. Após a análise destas duas seleções em ensaios comparativos de produção, aproveitou-se a melhor delas para multiplicação. Essa linhagem constituiu o cultivar 'Campinas'. Além de ter produção comparável à do 'IAC-38' e de apresentar frutos in-deiscentes, tem ainda a vantagem do porte médio e de possuir o teor de 46% de óleo nas sementes.