Hybrid Glycophorin Research Articles

Genetic profile of RHCE, Kell, Duffy, Kidd, Diego and MNS hybrid glycophorins blood groups in ethnic northeastern Thais: Alleles, genotypes and risk of alloimmunisation.

Antibodies against blood group antigens play a key role in the pathophysiology of haemolytic transfusion reactions (HTRs) and haemolytic disease of the fetus and newborn (HDFN). This study aimed to determine the frequencies of alleles, genotypes, and risk of alloimmunisation of clinically significant blood group systems in ethnic northeastern Thais. In total, 345 unrelated, healthy, ethnic northeastern Thais were tested using the in-house PCR-sequence specific primers (PCR-SSP) method for simultaneously genotyping of RHCE, Kell, Duffy, Kidd, Diego and MNS glycophorin hybrids and results confirmed by Sanger sequencing. In this cohort, the alleles RHCE*C (81.0%) and RHCE*e (84.8%) were more prevalent than RHCE*c (19.0%) and RHCE*E (15.2%). The most common predicted haplotype combinations of the RHCE alleles were C+c-E-e+(R1R1) (59.4%) followed by the C+c+E+e+ (R1R2) (20.6%) and C+c+E-e+ (R1r) (11.3%). The KEL*01 allele was not found in this study. The frequencies of FY*01 and FY*02 were 88.3% and 11.7%, respectively. The genotype FY*02/02 was found in four samples (1.2%). The frequencies of JK*01 and JK*02 were 52.5% and 47.5%, respectively. Homozygous JK*02/02 was found in 81 samples (23.5%). The frequencies of DI*01 and DI*02 were 0.6% and 99.4%, respectively. In total, 64 samples (18.6%) were found to carry the MNS glycophorin hybrids. Our results indicated a possible high risk of c, E, Fyb, Jka, Jkb and Mia alloimmunisation in these populations. Moreover, methods established for genotyping clinically significant blood groups in this study can now be utilised in routine clinical application.

Characterization of GYP(B-A-B) hybrid glycophorins among Thai blood donors with Mia-positive phenotypes.

GYPA and GYPB genes encode the antigens of the MNS blood group system carried on glycophorin A (GPA) and glycophorin B (GPB), or on a hybrid molecule of GPA and GPB. GP hybrid variants are created through unequal crossing over and gene conversion, typically from the parent genes GYPA and GYPB. In the present study, we characterized the GYP(B-A-B) hybrid variants among Thai blood donors with Mia-positive phenotypes using PCR-based coupled to DNA sequencing techniques. Altogether, 1,020 samples from Thai blood donors were tested with anti-Mia by conventional tube technique (CTT). Polymerase chain reaction with sequence-specific primer (PCR-SSP) was initially used to differentiate normal GYPB, GYP*Vw and groups of GYP*Hut, GYP*Mur, GYP*Hop, GYP*Bun and GYP*HF alleles. Subsequently, GYP(B-A-B) hybrid variants were investigated using DNA sequencing. Among 1,020 blood donors, 127 (12.45%) were Mi(a+) phenotypes. The comparison Mia typing results between CTT and PCR-SSP were concordant. All Mi(a+) samples were positive with only group of GYP*Hut, GYP*Mur, GYP*Hop, GYP*Bun and GYP*HF alleles by PCR-SSP. Regarding the sequencing results, 115/1,020 (11.27%) donors carried the GYP*Mur, of which 111/1,020 (10.88%) were GYP*Mur/GYPB heterozygotes and the other 4/1,020 (0.39%) donors were GYP*Mur/GYP*Mur homozygotes. The remaining 12 donors included different GYP*Bun-like alleles; 11 of them (1.08%) were GYP*Thai/GYPB heterozygotes, and one (0.10%) was GYP*Thai II/GYPB heterozygotes. With 5.83% (119/2,040) of the total hybrid alleles, GYP*Mur was the predominant allele. The GYP*HF, GYP*Bun, GYP*Hop and GYP*Kip alleles were not observed in this study. Regarding the hybrid GP variants, a consensus of observed prevalent GYP*Mur and GYP*Bun-like alleles, respectively, was identified in the Thai population. The introduction of our strategy has allowed us to identify the zygosity for GYP hybrid variants, particularly GYP(B-A-B) hybrid genes, when antisera are unavailable and lacking adequate phenotypic features to determine GP variants.

Dantu Blood Group Erythrocytes Form Large Plasmodium falciparum Rosettes Less Commonly.

Dantu erythrocytes, which express a hybrid glycophorin B/A protein, are protective against severe malaria. Recent studies have shown that Dantu impairs Plasmodium falciparum invasion by increasing erythrocyte membrane tension, but its effects on pathological host-parasite adhesion interactions such as rosetting, the binding of uninfected erythrocytes to P. falciparum-infected erythrocytes, have not been investigated previously. The expression of several putative host rosetting receptors-including glycophorin A (GYPA), glycophorin C (GYPC), complement receptor 1 (CR1), and band 3, which complexes with GYPA to form the Wrightb blood group antigen-are altered on Dantu erythrocytes. Here, we compare receptor expression, and rosetting at both 1 hour and 48 hours after mixing with mature trophozoite-stage Kenyan laboratory-adapted P. falciparum strain 11019 parasites in Dantu and non-Dantu erythrocytes. Dantu erythrocytes showed lower staining for GYPA and CR1, and greater staining for band 3, as observed previously, whereas Wrightb and GYPC staining did not vary significantly. No significant between-genotype differences in rosetting were seen after 1 hour, but the percentage of large rosettes was significantly less in both Dantu heterozygous (mean, 16.4%; standard error of the mean [SEM], 3.2) and homozygous donors (mean, 15.4%; SEM, 1.4) compared with non-Dantu erythrocytes (mean, 32.9%; SEM, 7.1; one-way analysis of variance, P = 0.025) after 48 hours. We also found positive correlations between erythrocyte mean corpuscular volume (MCV), the percentage of large rosettes (Spearman's rs = 0.5970, P = 0.0043), and mean rosette size (rs = 0.5206, P = 0.0155). Impaired rosetting resulting from altered erythrocyte membrane receptor expression and reduced MCV might add to the protective effect of Dantu against severe malaria.

Hybrid glycophorin GP (A-B) and anti-Ena antibody in a multiparous woman

Abstract The MNS system is a large, complex group of antigens, with 50 antigens at present. The major antigens of the system are carried on glycophorins A and B, which are important red cell sialoglycoproteins. Altered expression of MNS antigens is possible in cases where there is a formation of hybrid glycophorins. Some of these patients may make clinically significant antibodies which can be associated with hemolytic transfusion reactions (HTR) or hemolytic disease of the fetus and the newborn. This is a report of one such case with both these phenomena, in a multiparous woman. Incompatible cross-matches at the referral center caused the samples to be sent to this immunohematological laboratory where the serological profile was detailed. On sending the samples to a third blood group reference laboratory, gene sequencing was done and the antibody was identified. At this immunohematological laboratory, the phenotype was determined as M-N+. The patient’s sera showed panreactivity with all panel cells (3-cell and 11-cell). At blood group reference laboratory, the findings were as follows- GYP (A-B) hybrid gene consistent with hemi/homozygosity for GYP*JL was confirmed and the panreactive antibody was identified as anti - Ena. Rare, atypical phenotypes in the MNS system can result from mutations affecting the sialoglycoproteins the antigens are carried on. The subset of antigens expressed in individual phenotypes varies and these patients can develop antibodies against the antigens they lack. When they present with immunohematological challenges such as panreactivity and incompatibility, a combination of serology, molecular technologies, and family studies help solve the problem. Alternatives to transfusion are also useful options in managing such cases.

Severe hemolytic disease of a newborn due to anti-E combined with anti-Mia, anti-Mur and anti-Hil

Background: Common alloantibodies leading to severe hemolytic disease of the fetus and newborn (HDFN) could vary among different ethnic groups. The MNS blood group hybrid glycophorin GP.Mur distributes with a high frequency in the regions of Southeast Asia. Alloantibodies against GP.Mur (anti-‘Mia’) often present as mixture of antibodies against several low frequency antigens. In this study, we first described a case of severe HDFN in Guangzhou, China, which was caused by alloantibodies of anti-E in combination with specificities to the GP.Mur including Mia, Mur and Hil.

A novel GYP(B-A-B) hybrid in a blood donor identified by a phenotyping discrepancy with different anti-s reagents.

MNS is a complex blood group system whose antigens are carried on glycophorin A (GPA), glycophorin B (GPB) and hybrid glycophorin molecules. These hybrid proteins are the results of gene recombination events at the GYPA/GYPB loci. One of the larger groups of hybrid proteins in this system are the GP(B-A-B) hybrid proteins, which often arise through gene recombination events in and around exon 3/intron 3 of GYPA, and pseudoexon 3 of GYPB.1 Different low-prevalence antigens are expressed on the hybrids depending on the point of crossover, and the presence of such a hybrid is often detected by aberrant expression of S and/or s antigens.2 We present the investigation of samples from a blood donor who had been genotyped on the HEA BeadChip array (Immucor, GA) as GYPB*03/03 but whose RBCs phenotyped S+ s+ . Extended phenotyping for S/s was performed by routine serological techniques with commercially available polyclonal and monoclonal reagent sera (See Figure 1A for manufacturers). Confirmatory allele-specific PCR (PCR-ASP) for the S/s polymorphism was performed as described previously on genomic DNA isolated from peripheral blood.3 GYPB exons 2–6 were specifically amplified using the primer pair GYP2-F and GYPB6-R (5′TATTGTACAGATGAGAAAACCAAGGCAC3′ and 5′GTGAGGCAGGAGAACAGGGAATTAG3′). The amplicon was purified and sequenced using the following internal GYPB-exon specific primers: exon 2: GPBX2S 5′CTATTTTATACAGAAATTGTGAG3′, GPBX2AS 5′CTAGAATTCCTCTGTAGTAAG3′; pseudoexon 3: GPBX3S 5′GGAGAATTTGTCTTTCATGATAC3′, GPB1963R 5′CAACATATGCTCTTCTGTTTTAAG3′; exon 4: GYPB42F 5′ATTTCTCATCCATGAATACG3′, GYPB43R 5′GCTTGGCCTCCCAAAATTATA3′; exon 5: GPB4/5 5′CTGTCTTATTTTTCTATTGCTATG3′, GPBIVS5 5′CTGTTTCTCTTTTGAGTTTAACTG3′ (Eurofins Genomics, Ebersberg, Germany). GYPB exon 1 was not sequenced since the peptide sequence encoded is cleaved from the mature protein. Note that exon numbering includes pseudoexon 3 for comparison with previously described hybrids.2 Phenotyping for Mit antigen was performed using anti-Mit from our rare sera collection. Extended phenotyping confirmed the RBCs as S+ (results not shown); however, s typing was inconclusive since 4/8 anti-s reagents were nonreactive (Figure 1A). Strikingly, clone P3BER reacted 4+ with the donor RBCs while clone P3YAN3 was nonreactive. The RBCs were only weakly positive with 3 polyclonal anti-s. The result of PCR-ASP genotyping was GYPB*03/*04, consistent with an S+ s+ phenotype, and which contradicted the results of the original HEA BeadChip analysis. DNA sequence analysis revealed a novel hybrid sequence (Genbank number OP263737) that was shown to be an 104-bp insertion of GYPA into GYPB exon 4 with the downstream breakpoint in intron 4 (NC_000004.12(NM_002100.4):c.155_175 +83delins[NM_002099.6:c.251_271 + 83]; Figure 1B), such that GPB amino acid sequence 52VHRFTVP58 is replaced by the GPA sequence AHHFSEP (NP_002091.4:p.52_58delins[NP_002090.4:p.84_90]; Figure 1C). The insertion of GYPA-specific nucleotides explains the failure of the HEA BeadChip assay to predict the s antigen encoded by this allele. Further, it is not unusual for hybrid proteins to carry low-prevalence antigens. Review of the inserted GPA sequence suggested that the RBCs might be Mit + since a change of p.Arg54His underlies this low-prevalence GPB antigen.2 The donor's RBCs typed Mit+ with a single example of the antibody. We report a novel and unusual GYP(B-A-B) allele (provisionally named GYP*507) in which gene recombination has occurred within GYPB exon 4. While Thr48 defining the s antigen is still present, Arg54, which is thought to be important for s expression, is substituted by His54 and thus the epitope recognized by anti-s, clone P3YAN3 can be mapped to this region of GPB. The hybrid protein carries the Mit antigen. In contrast, the monoclonal anti-s P3BER has been shown previously to require Thr44 for reactivity, since this is absent from GP.Mur and GP.Bun hybrid proteins,4 and shows that these two monoclonal anti-s recognize different epitopes on GPB. The serological results showed that the expression of s antigen in this new hybrid is both qualitatively and quantitatively perturbed.2 We thank Judith Aeschlimann for providing the GYP2-F and GYPB6-R primer sequences. This work has been supported by the ALF program from the Swedish government and regional county councils (grant no. ALFSKANE-446521 to M.L.O.) to university healthcare in Region Skåne and at Lund University. The authors have disclosed no conflicts of interest.

Glycophorins and the MNS blood group system: a narrative review

: The MNS blood group system, International Society of Blood Transfusion (ISBT) 002, is second after the ABO system. GYPA and GYPB genes encode MNS blood group antigens carried on glycophorin A (GPA), glycophorin B (GPB), or on variant glycophorins. A third gene, GYPE, produce glycophorin E (GPE) but is not expressed. MNS antigens arise from several genetic mechanisms. Single nucleotide variants (SNVs) contribute to the diversity of the MNS system. A new antigen SUMI (MNS50), p.Thr31Pro on GPA has been described in the Japanese population. Unequal crossing-over and gene conversion are the mechanisms forming hybrid glycophorins, usually from parent genes GYPA and GYPB. GYPE also contributes to gene recombination previously only described with GYPA. Recently, however, GYPE was shown to recombine with GYPB to form a GYP(B-E-B) hybrid. A GYP(B-E-B) hybrid allele encodes a mature GP(E-B) molecule expressing a trypsin-resistant M antigen but no S/s. Another novel glycophorin GP.MOT has been described carrying Mia, Mur, MUT, and KIPP antigens. GP.MOT is encoded by a GYP(B-A) hybrid allele. Newly reported cases of haemolytic transfusion reaction (HTR) or haemolytic disease of the fetus and newborn (HDFN) due to antibodies to MNS antigens is a constant reminder of the clinical significance of the MNS system. In one HDFN case, anti-U and anti-D were detected in an Indian D–, S–s–U– mother. The S–s–U– phenotype is rare in Asians and Caucasians but it is more commonly found in the African populations. Several types of novel GYPB deletion alleles that drive the S–s–U– phenotype have been recently described. Two large GYPB deletion alleles, over 100 kb, were identified as the predominant alleles in the African population. The use of advanced DNA sequencing techniques and bioinformatic analysis has helped uncover these large gene-deletion variants. Molecular typing platforms used for MNS genotyping are also discussed in this review. In conclusion, this review considers currently recognised MNS antigens and variants, new hybrid alleles and GYPB gene deletion alleles as well as clinical case studies. These new discoveries contribute to our understanding of the complexity of the MNS system to guide decision-making in genetic analysis and transfusion medicine.

Molecular genetic analysis of Mia -positive hybrid glycophorins revealed two novel alleles of GP.Vw and multiple variant transcripts of GYPB existing in both the homozygous GP.Mur and wild-type GPB individuals.

The hybrid glycophorins of MNS blood group system express a series of low incidence antigens including Mia , which are commonly found in Southeast Asian populations. In this study, the molecular basis of Mia -positive hybrid glycophorins was firstly clarified in the Chinese Southern Han population. RNA transcripts of GYPB gene in the homozygous GP.Mur individuals were also analyzed. DNAs were extracted from the whole blood samples of 111 Mia -positive donors. Then, high-resolution melting (HRM) analysis for GYP(B-A-B) was used to analyze the genotypes. Sequencing of GYPB pseudoexon 3 was conducted in the samples with variant melting curves. TA-cloning and subsequent sequencing of GYPA exons 2-4 were performed in the Mia -positive samples with normal GYPB/GYPB genotype by HRM. The transcript analysis of GYPB was conducted in homozygous GP.Mur and wild-type glycophorin B (GPB) individuals using RNA extracted from the cultured erythroblast. The heterozygous GYP*Mur/GYPB (n= 101), homozygous GYP*Mur/GYP*Mur (n= 7) including one novel GYP*Mur allele with an extra GYPA/GYPE specific nucleotide substitution (c.229+110A>T), heterozygous GYP*Bun/GYPB (n= 1) and GYP*Vw/GYPA (n= 2) with two novel GYP*Vw alleles were identified. RNA transcript analysis revealed multiple transcripts of GYPB existing in both homozygous GP.Mur and normal GPB individuals. The results showed the genetic diversity of hybrid glycophorins in the Chinese population. Besides, the successful analysis of GYPB transcripts indicates that the cultured erythroblast is a good source for RNA transcript analysis for the protein only expressed on the red blood cells.

Successful prenatal management of two foetuses affected by antibodies against GP.Mur with prenatal genotyping analysis and a literature review.

GP.Mur belongs to the GP(B-A-B) hybrid glycophorin family, which is the most common hybrid glycophorin in Southeast Asia. Antibodies against GP.Mur may cause a clinically significant haemolytic disease of the foetus and newborn (HDFN) although, so far, not many cases have been reported in mainland China. Two Chinese women with a history of severe hydrops foetalis were seen in our centre. Alloantibody identification and GYP.Mur genotyping analysis were used for prenatal evaluation. Intrauterine transfusion was performed in two pregnancies in case 1. The features of these two women are described and literature-reported cases of HDFN related to antibodies against GP.Mur are summarised. The phenotype of both mothers was Mia- Mur-, while the fathers' was Mia+ Mur+ with a heterozygous GYP.Mur hybrid gene as determined by a high-resolution melting method of genotyping. In case 1, the antibodies against GP.Mur were detected in the mother's serum and the cord blood of two foetuses. Fortunately, the latest foetus was successfully saved after intrauterine transfusion. In case 2, hydrops foetalis occurred in the first two pregnancies, but the risk of HDFN was excluded for the third foetus because of the GP.Mur negative phenotype. The literature review showed that 68.8% (11/16) of the reported cases of HDFN related to antibodies against GP.Mur occurred in the Chinese population, and that 37.5% (6/16) of them were cases of severe HDFN. More cases of severe HDFN caused by antibodies against GP.Mur are presumably undetected as GP.Mur cells are not included in the panel of obligatory screening tests in most Southeast Asian countries including mainland China. The high-resolution melting method for GYP.Mur genotyping and zygosity detection is helpful in prenatal management.

Low prevalence red blood cell antigens: transfusions, babies, and changing demographics

See article on page 870–874, in this issue

Fetal inheritance of GP*Mur causing severe HDFN in an unrecognized case of maternal alloimmunization

The clinical and laboratory features of hemolytic disease of the newborn can be challenging to diagnose during pregnancy in the apparent absence of a blood group antibody. Low-frequency antibodies go undetected due to the lack of appropriate antigen-positive reagent red blood cells (RBCs). A pregnant woman of Southeast Asian descent was referred to a maternal-fetal medicine outpatient clinic due to a complicated obstetric history and a negative antibody screen. This initial visit at 29 weeks and 0 days' gestational age (GA) was unremarkable. A hydropic infant, born at 29 weeks and 5 days' GA, succumbed on the seventh day of life. Comprehensive laboratory testing was performed after birth. The hospital blood bank performed a maternal antibody identification. Direct antiglobulin test was performed on the cord blood. A reference laboratory confirmed an anti-Mia , performed paternal Mia phenotyping, and identified a hybrid glycophorin B-A-B GP*Mur allele. Maternal alloimmunization to low-frequency antigens remains a challenge. Southeast Asians make up a significant percentage in some US locations. Worldwide reports on the frequency of maternal alloimmunization of the MNS system can be used to guide the use of specific reagent RBCs for testing. Such strategies rely on the identification of blood donor units for reagent manufacture and use in perinatal antibody screens. The incidence of Mia and related antibodies is significant among Southeast Asians. In North America, prenatal antibody screening cells are not routinely chosen to match this population. The clinical and societal implications are discussed.

Frequency of Mia (MNS7) and Classification of Mia-Positive Hybrid Glycophorins in an Australian Blood Donor Population

Background: MNS blood group system genes GYPA and GYPB share a high degree of sequence homology and gene structure. Homologous exchanges between GYPA and GYPB form hybrid genes encoding hybrid glycophorins GP(A-B-A) and GP(B-A-B). Over 20 hybrid glycophorins have been characterised. Each has a distinct phenotype defined by the profile of antigens expressed including Mi^a. Seven hybrid glycophorins carry Mi^a and have been reported in Caucasian and Asian population groups. In Australia, the population is diverse; however, the prevalence of hybrid glycophorins in the population has never been determined. The aims of this study were to determine the frequency of Mi^a and to classify Mi^a-positive hybrid glycophorins in an Australian blood donor population. Method: Blood samples from 5,098 Australian blood donors were randomly selected and screened for Mi^a using anti-Mi^a monoclonal antibody (CBC-172) by standard haemagglutination technique. Mi^a-positive red blood cells (RBCs) were further characterised using a panel of phenotyping reagents. Genotyping by high-resolution melting analysis and DNA sequencing were used to confirm serology. Result: RBCs from 11/5,098 samples were Mi^a-positive, representing a frequency of 0.22%. Serological and molecular typing identified four types of Mi^a-positive hybrid glycophorins: GP.Hut (n = 2), GP.Vw (n = 3), GP.Mur (n = 5), and 1 GP.Bun (n = 1). GP.Mur was the most common. Conclusion: This is the first comprehensive study on the frequency of Mi^a and types of hybrid glycophorins present in an Australian blood donor population. The demographics of Australia are diverse and ever-changing. Knowing the blood group profile in a population is essential to manage transfusion needs.

Molecular Detection of Glycophorins A and B Variant Phenotypes and their Clinical Relevance.

Crossover or conversion between the homologous regions of glycophorin A (GYPA) and glycophorin B (GYPB) gives rise to several different hybrid glycophorin genes encoding a number of different glycophorin variant phenotypes which bear low prevalence antigens in the MNS blood group system. GP.Mur is the main glycophorin variant phenotype which causes hemolytic transfusion reaction (HTR) and hemolytic disease of the fetus and newborn (HDFN) in East and Southeast Asians. The detection of glycophorin variant phenotypes using serological methods is limited to phenotyping reagents that are not commercially available. Moreover, the red blood cells used for antibody identification are usually of the GP.Mur phenotype. The current Polymerase Chain Reaction (PCR)-based methods and loop-mediated isothermal amplification (LAMP) are available alternatives to phenotyping that allow for the specific detection of glycophorin variant phenotypes. This review highlights the molecular detection method for glycophorins A and B variant phenotypes and their clinical relevance.

Genotyping analysis of MNS blood group GP(B-A-B) hybrid glycophorins in the Chinese Southern Han population using a high-resolution melting assay.

MNS hybrid GP(B-A-B) glycophorins are more commonly found in Southeast Asians and alloantibodies to antigens they carry are clinically significant. Detection of hybrid glycophorins by serologic techniques is limited due to lack of commercial reagents. In this study, a genotyping method for GP(B-A-B) hybrid glycophorins based on high-resolution melting (HRM) analysis was applied for genotyping analysis in the Chinese Southern Han population. DNA samples from 3104 Chinese Southern Han blood donors were collected. GYP(B-A-B) genotypes were analyzed by HRM assay. Parts of samples (n=106) were also tested by multiplex ligation-dependent probe amplification (MLPA) assay. Direct sequencing was conducted in samples with variant melting curve profiles. A total of five GYP(B-A-B) genotypes (201/3104, 6.5%) were identified, which were GYP*Mur heterozygote (n=194), GYP*Mur homozygote (n=3), GYP*Bun heterozygote (n=2), GYP*HF heterozygote (n=1), and a novel GYP(B-A-B) hybrid allele (n=1). Genotyping results for GYP*Mur and wild-type GYPB samples obtained by HRM were consistent with MLPA, while GYP*Bun and GYP*HF heterozygote identified by HRM could only be identified to have one copy of 5' inactive splice site of GYPB Pseudoexon 3 by MLPA. In addition, 10 single-nucleotide polymorphisms (SNPs) including four known and six novel SNPs were identified in 31 samples. One sample was identified carrying both GYP*Mur and GYP*Sch alleles. The HRM assay could distinguish the GYP(B-A-B) hybrid alleles successfully. Polymorphisms identified within the GYPB gene should be taken into consideration when developing GYP(B-A-B) genotyping kits for the Chinese population.

Major applications and limitations of blood group genotyping in China

Molecular immunohematological techniques have been well applied in the transfusion medicine. Here, we review the major applications for blood group genotyping in China. Its application mainly focuses on the typing of blood group antigens in complex cases, such as ABO subgroups, D variants or the Asian specific and common antigens typing (such as the antigens expressed by the MNS hybrid glycophorins), also because of lacking of the corresponding commercial antibodies. The comprehensive antigens profile in some specific samples could be obtained using medium‐ or high‐throughput genotyping platforms. Although, foetal RHD genotyping in D– pregnant women in Europe is highly relevant to avoid unnecessary antenatal RhIg, it is of comparatively less importance in the Chinese D– pregnant women because of the low probability (3–4%) to have a D– baby. In contrast, the application of routine molecular testing for the ‘Asia type’ DEL, which having a frequency up to 30% in East Asian people serologically typed as D‐negative, is more necessary to avoid unnecessary administration of antenatal RhIg, because there is increasing evidence that individuals carrying the ‘Asia type’ DEL allele (c.1227G>A, p.Lys409Lys) do not produce alloanti‐D after exposure to D+ red blood cells. The molecular methods to detect the RHD*1227A are more accurate and applicable for routine testing of ‘Asia type’ DEL.

Comparison of two monoclonal antibodies for the detection of MIa (MNS7) in mns hybrid glycophorins

Comparison of two monoclonal antibodies for the detection of MIa (MNS7) in mns hybrid glycophorins

Genotyping for Glycophorin GYP(B-A-B) Hybrid Genes Using a Single Nucleotide Polymorphism-Based Algorithm by Matrix-Assisted Laser Desorption/Ionisation, Time-of-Flight Mass Spectrometry.

The genetic basis for five GP(B-A-B) MNS system hybrid glycophorin blood group antigens results from rearrangement between the homologous GYPA and GYPB genes. Each hybrid glycophorin displays a characteristic profile of antigens. Currently, no commercial serological reagents are currently available to serologically type for these antigens. The aim of this study was to develop a single nucleotide polymorphism (SNP) mapping genotyping technique to allow characterisation of various GYP(B-A-B) hybrid alleles. Matrix-assisted laser desorption/ionisation time-of-flight (MALDI-TOF) mass spectrometry (MS) assays were designed to genotype five GYP(B-A-B) hybrid alleles. Eight nucleotide positions were targeted and incorporated into the SNP mapping protocol. The allelic frequencies were calculated using peak areas. Sanger sequencing was performed to resolve a GYP*Hop 3' breakpoint. Observed allelic peak area ratios either coincided with the expected ratio or were skewed (above or below) from the expected ratio with switching occurring at and after the expected break point to generate characteristic mass spectral plots for each hybrid. Sequencing showed that the GYP*Hop crossover in the intron 3 region, for this example, was identical to that for GYP*Bun reference sequence. An analytical algorithm using MALDI-TOF MS genotyping platform defined GYPA inserts for five GYP(B-A-B) hybrids. The SNP mapping technique described here demonstrates proof of concept that this technology is viable for genotyping hybrid glycophorins, GYP(A-B-A), GYP(A-B) and GYP(B-A), and addresses the gap in current typing technologies.

The distribution of MNS hybrid glycophorins with Mur antigen expression in Chinese donors including identification of a novel GYP.Bun allele.

MNS hybrid glycophorins are identified by characteristic antigen profiles. One of these is the Mur antigen, which is expressed on red cell hybrid glycophorins of several phenotypes of the 'Miltenberger' series found predominantly in East Asian population. The aim of this study was to investigate the distribution of Mur-positive hybrid glycophorins and clarify the genetic basis in the donors from southern China. Blood samples from 528 donors were collected for Mur antigen serological typing. Sequencing of GYPB pseudoexon 3 and MNS phenotyping were conducted in Mur-positive samples. The multiplex ligation-dependent probe amplification (MLPA) was used to confirm the zygosity of the GYP.Mur allele and determine the MNSs genotype. The expression of Mur antigen was evaluated by flow cytometry. Fifty-one Mur-positive samples were identified by serological testing. Sequencing analysis showed 50 donors (50/528, 9.5%) with the GYP.Mur allele (48 heterozygotes and two homozygotes), which were confirmed by the MLPA genotyping analysis, and one donor (1/528, 0.19%) with a novel GYP.Bun allele. Flow cytometry analysis revealed higher Mur antigen expression on GP.Mur (Mi.III) homozygotes than heterozygotes. For the GYP.Mur homozygotes, an incorrect 'N' positive typing with anti-N lectin was obtained. GP.Mur (Mi.III) is the main Mur-positive hybrid glycophorin in Guangzhou donors. The dosage effect of Mur antigen observed provides a basis for selecting the homozygous GP.Mur RBCs as the reagent cells to avoid neglecting weak antibodies. A separate GYP.Bun lineage found in the southern China provides evidence for further complexity in the MNS system.

Designing peptide‐based FSL constructs to create Miltenberger kodecytes

Background KODE technology involves the synthesis of function‐spacer‐lipid (FSL) constructs and their insertion into cell membranes to create kodecytes. The functional group in FSLs includes blood group antigens and can be used to create synthetic antigen‐modified red cells.Aims To review the issues in constructing peptide‐based FSLs, with an emphasis on MNS system hybrid glycophorins and the resultant Miltenberger kodecytes.Materials and Methods Peptides suitable for synthesis into FSL constructs are ligated to a carboxymethylated oligoglycine spacer attached to a lipid tail. Simple contact of these FSL constructs with red cells allows for their spontaneous insertion into the cell membrane, creating kodecytes.Results Once optimized peptide sequences are identified, FSL constructs are simple and easy to build. Field trials established Miltenberger kodecytes were functional and able to identify clinically significant IgG antibodies.Discussion This review explores the issues with creating peptide‐based FSL constructs, with an emphasis on the relatively simple MUT/Mur FSLs. With the recent development of easy‐to‐use construct‐your‐own FSL‐peptide kits, researchers can now produce their own extended range of peptide‐based blood group kodecytes.Conclusion: Provided possible complications/issues have been taken into account, FSL‐peptides can be easily synthesized and used to make kodecytes representative of selected protein blood antigens/epitopes.

Sixty Years of Antibodies to MNS System Hybrid Glycophorins: What Have We Learned?

The MNS system was the second blood group system discovered and at least 16 of the 46 antigens in the MNS system result from genetic recombination, producing a hybrid glycophorin. The incidence of these hybrid glycophorins is highest in East Asian populations. MNS system antigens defined by hybrid glycophorins are immunogenic with alloimmune IgG responses developing after transfusion or pregnancy; with reports originating from Asia, Europe, the Americas, and Australia. This demonstrates the global nature of problems associated with these antibodies. Since the initial report that production of anti-Mi(a) was a cause of hemolytic disease of the fetus and newborn (HDFN), antibodies to antigens defined by hybrid glycophorins have been reported in 27 cases of HDFN (1 fatal) and 8 cases of hemolytic transfusion reaction (HTR) (1 fatal). In at least 40% of these clinical cases, the disease was reported as severe. Hyporegenerative fetal anemia is a common feature of the reported HDFN cases. In all published cases, the causative antibodies were identified by reference laboratory investigative tests following clinical presentation. The failure to detect these antibodies by routine testing highlights the need for consideration of the medical importance of these antibodies when defining antibody screening practices and reagents. The aim of this review is to raise awareness of severe disease caused by antibodies to MNS antigens defined by hybrid glycophorins and, thus, to improve diagnosis and patient management.