A novel GYP(B-A-B) hybrid in a blood donor identified by a phenotyping discrepancy with different anti-s reagents.

Abstract

MNS is a complex blood group system whose antigens are carried on glycophorin A (GPA), glycophorin B (GPB) and hybrid glycophorin molecules. These hybrid proteins are the results of gene recombination events at the GYPA/GYPB loci. One of the larger groups of hybrid proteins in this system are the GP(B-A-B) hybrid proteins, which often arise through gene recombination events in and around exon 3/intron 3 of GYPA, and pseudoexon 3 of GYPB.1 Different low-prevalence antigens are expressed on the hybrids depending on the point of crossover, and the presence of such a hybrid is often detected by aberrant expression of S and/or s antigens.2 We present the investigation of samples from a blood donor who had been genotyped on the HEA BeadChip array (Immucor, GA) as GYPB*03/03 but whose RBCs phenotyped S+ s+ . Extended phenotyping for S/s was performed by routine serological techniques with commercially available polyclonal and monoclonal reagent sera (See Figure 1A for manufacturers). Confirmatory allele-specific PCR (PCR-ASP) for the S/s polymorphism was performed as described previously on genomic DNA isolated from peripheral blood.3 GYPB exons 2–6 were specifically amplified using the primer pair GYP2-F and GYPB6-R (5′TATTGTACAGATGAGAAAACCAAGGCAC3′ and 5′GTGAGGCAGGAGAACAGGGAATTAG3′). The amplicon was purified and sequenced using the following internal GYPB-exon specific primers: exon 2: GPBX2S 5′CTATTTTATACAGAAATTGTGAG3′, GPBX2AS 5′CTAGAATTCCTCTGTAGTAAG3′; pseudoexon 3: GPBX3S 5′GGAGAATTTGTCTTTCATGATAC3′, GPB1963R 5′CAACATATGCTCTTCTGTTTTAAG3′; exon 4: GYPB42F 5′ATTTCTCATCCATGAATACG3′, GYPB43R 5′GCTTGGCCTCCCAAAATTATA3′; exon 5: GPB4/5 5′CTGTCTTATTTTTCTATTGCTATG3′, GPBIVS5 5′CTGTTTCTCTTTTGAGTTTAACTG3′ (Eurofins Genomics, Ebersberg, Germany). GYPB exon 1 was not sequenced since the peptide sequence encoded is cleaved from the mature protein. Note that exon numbering includes pseudoexon 3 for comparison with previously described hybrids.2 Phenotyping for Mit antigen was performed using anti-Mit from our rare sera collection. Extended phenotyping confirmed the RBCs as S+ (results not shown); however, s typing was inconclusive since 4/8 anti-s reagents were nonreactive (Figure 1A). Strikingly, clone P3BER reacted 4+ with the donor RBCs while clone P3YAN3 was nonreactive. The RBCs were only weakly positive with 3 polyclonal anti-s. The result of PCR-ASP genotyping was GYPB*03/*04, consistent with an S+ s+ phenotype, and which contradicted the results of the original HEA BeadChip analysis. DNA sequence analysis revealed a novel hybrid sequence (Genbank number OP263737) that was shown to be an 104-bp insertion of GYPA into GYPB exon 4 with the downstream breakpoint in intron 4 (NC_000004.12(NM_002100.4):c.155_175 +83delins[NM_002099.6:c.251_271 + 83]; Figure 1B), such that GPB amino acid sequence 52VHRFTVP58 is replaced by the GPA sequence AHHFSEP (NP_002091.4:p.52_58delins[NP_002090.4:p.84_90]; Figure 1C). The insertion of GYPA-specific nucleotides explains the failure of the HEA BeadChip assay to predict the s antigen encoded by this allele. Further, it is not unusual for hybrid proteins to carry low-prevalence antigens. Review of the inserted GPA sequence suggested that the RBCs might be Mit + since a change of p.Arg54His underlies this low-prevalence GPB antigen.2 The donor's RBCs typed Mit+ with a single example of the antibody. We report a novel and unusual GYP(B-A-B) allele (provisionally named GYP*507) in which gene recombination has occurred within GYPB exon 4. While Thr48 defining the s antigen is still present, Arg54, which is thought to be important for s expression, is substituted by His54 and thus the epitope recognized by anti-s, clone P3YAN3 can be mapped to this region of GPB. The hybrid protein carries the Mit antigen. In contrast, the monoclonal anti-s P3BER has been shown previously to require Thr44 for reactivity, since this is absent from GP.Mur and GP.Bun hybrid proteins,4 and shows that these two monoclonal anti-s recognize different epitopes on GPB. The serological results showed that the expression of s antigen in this new hybrid is both qualitatively and quantitatively perturbed.2 We thank Judith Aeschlimann for providing the GYP2-F and GYPB6-R primer sequences. This work has been supported by the ALF program from the Swedish government and regional county councils (grant no. ALFSKANE-446521 to M.L.O.) to university healthcare in Region Skåne and at Lund University. The authors have disclosed no conflicts of interest.