Hippocampal HT22 Cells Research Articles

Mitigating effects of Jiawei Chaihu Shugan decoction on necroptosis and inflammation of hippocampal neurons in epileptic mice

Jiawei Chaihu Shugan decoction (JWCHSGD) is a traditional Chinese medicine well-known for its beneficial effects in treating epilepsy (Xianzheng in ancient Chinese), but the molecular mechanism of its action remains unclear. To investigate the molecular mechanism of JWCHSGD’s prevention of epilepsy-mediated neuron from necroptosis and inflammation via the circRNA-Csnk1g3/Csnk1g3-85aa/ CK1γ3/TNF-α signal pathway. In vitro, murine neuronal HT22 cells were treated in six groups: control, model, carbamazepine, and three JWCHSGD doses (high, medium, low). Viability and apoptosis were assessed via CCK-8 and flow cytometry. In vivo, 60 C57BL/6J mice were divided into six groups: control, model, carbamazepine, JWCHSGD, JWCHSGD + Sh Circ_Csnk1g3, and JWCHSGD + Sh NC. An epilepsy model was induced, and treatments were administered for two weeks. Outcomes included EEG, hippocampal histopathology, apoptosis (TUNEL), and mRNA/protein expression of key pathway markers. In HT22 cells, the model group showed reduced viability, increased apoptosis, and elevated mRNA/protein levels of Csnk1g3-85aa, RIP1, RIP3, MLKL, TNF-α, IL-6, and IL-1β (P < 0.05). JWCHSGD and carbamazepine increased viability and decreased apoptosis, reversing these molecular changes (P < 0.05). In mice, the model group had heightened epileptic discharges, neuronal damage, and apoptosis, along with increased expression of the same markers (P < 0.05). JWCHSGD and carbamazepine mitigated these effects (P < 0.05). JWCHSGD reduces epileptic events by regulating the circRNA-Csnk1g3/Csnk1g3-85aa/CK1γ3/TNF-α signaling pathway, impacting necroptosis and inflammation in hippocampal neurons and HT22 cells.

Research on the protective effect of Rhizoma of Anemarrhena asphodeloides on TMT induced AD mice model based on network pharmacology combined with in vitro and in vivo experimental validation.

Alzheimer's disease (AD) is a neurodegenerative disease, and neuroprotection is an important approach to improving AD outcomes. Rhizoma of Anemarrhena asphodeloides (RAA) is a commonly used Traditional Chinese Medicine (TCM) with demonstrated neuroprotective effects, but its anti-AD mechanism requires further exploration. To elucidate the neuroprotective mechanism of RAA on TMT-induced AD mice. The AD mice model was established via intraperitoneal injection of TMT. The effect of RAA on ameliorating learning and memory was assessed using the Morris Water Maze (MWM) and Y-maze tests. Haematoxylin-Eosin (HE), Nissl, and TUNEL staining were used to observe the neuroprotective effect of RAA. The components in serum containing RAA (RAA-S) were detected using UPLC-Q-Orbitrap MS. Potential targets were predicted through network pharmacology and molecular docking. Serum levels of reactive oxygen species (ROS), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione (GSH), and glutathione peroxidase (GPx) were measured with ELISA kits. The HT22 hippocampal neuronal cell line injured by l-glutamate (L-Glu) was used to further elucidate the mechanism of RAA. ROS levels in HT22cells were detected with the 2'-7'-dichlorodihydrofluorescein diacetate (DCFH-DA) fluorescent probe and flow cytometry. Apoptosis in HT22cells was measured by flow cytometry. The proteins MAP2, GAP-43, Nrf2, Keap1, HO-1, Bax, and Bcl-2 were detected by Western blotting. Immunofluorescence staining was employed to observe Nrf2 nuclear translocation. RAA significantly increased the residence time of mice in the W zone and enhanced the correct alternation rate in TMT-treated mice. RAA preserved the integrity and orderly arrangement of nerve cells. A total of 12 components were detected in RAA-S. AKT1, PPARG, CASP3, STAT3, HSP90AA1, and NFE2L2 (Nrf2) were involved in the RAA-S target pathway network. Molecular docking revealed that Nrf2 exhibited the highest average binding energy with all components in RAA-S. In vivo, RAA elevated MAP2, GAP-43, Nrf2, and HO-1 levels, along with GPx, GSH, and SOD activity, which had been reduced by TMT. Additionally, RAA reduced serum levels of MDA and ROS, which had been elevated by TMT. In vitro, RAA-S reduced HT22cell apoptosis and ROS accumulation caused by TMT. Furthermore, RAA-S promoted the expression of N-Nrf2 and HO-1 in L-Glu-injured HT22cells. RAA attenuated oxidative stress induced by TMT and L-Glu in AD model mice. The underlying mechanism was associated with the activation of the Nrf2/Keap1-HO-1 pathway.

Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

The ameliorative effects of melatonin against BDE-47-induced hippocampal neuronal ferroptosis and cognitive dysfunction through Nrf2-Chaperone-mediated autophagy of ACSL4 degradation.

Recent studies demonstrate that lipid peroxidation-induced ferroptosis participates in 2,2',4,4'-tetrabromodiphenyl ether (BDE-47)-evoked neurotoxicity and cognitive dysfunction. Melatonin has been indicated to confer neuroprotection against brain diseases via its potent anti-ferroptotic effects. Therefore, this study aims to explore whether melatonin can mitigate BDE-47-elicited cognitive impairment via suppressing ferroptosis, and further delineate the underlying mechanisms. Our results found that melatonin administration effectively inhibited BDE-47-induced ferroptosis in mice hippocampi and murine hippocampal neuronal HT-22 cells. Acyl-CoA synthetase long-chain family member 4 (ACSL4), a key lipid metabolism enzyme dictating ferroptosis sensitivity, accompanied by higher MDA and lipid reactive oxygen species (ROS), was remarkably increased under BDE-47 stress, while melatonin supplementation could suppress the elevated ACSL4 in vivo and in vitro. Furthermore, melatonin facilitated lysosomal ACSL4 degradation through enhancing lysosome-associated membrane protein type 2a (LAMP2a) expression and chaperone-mediated autophagy (CMA) activity, while LAMP2a knockdown abrogated the positive effects of melatonin on ACSL4 elimination in BDE-47-treated HT-22 cells. Moreover, nuclear factor erythroid 2-related factor 2 (Nrf2) activation by melatonin contributed to LAMP2a upregulation and CMA of ACSL4 and subsequent neuronal ferroptosis. Importantly, melatonin, CMA activator CA77.1, and ACSL4 inhibitor rosiglitazone (RSG) administration substantially attenuated neuronal/synaptic injury and cognitive deficits following BDE-47 exposure. Taken together, these findings revealed that melatonin could prevent BDE-47-provoked ferroptosis in the hippocampal neurons and mitigate cognitive dysfunction by facilitating ACSL4 degradation via Nrf2-chaperone-mediated autophagy. Therefore, melatonin might be a potential candidate for treating BDE-47-elicited neurotoxicity and neurobehavioral disorder.

CircHOMER1 Alleviates Sevoflurane-Induced Hippocampal Neuronal Injury via Targeted Negative Regulation of miR-217.

Sevoflurane (Sev) is a widely applied anesthetic in clinical practice; however, it could induce neurotoxicity and lead to postoperative cognitive dysfunction (POCD). This study aimed to investigate the role and underlying mechanism of circHOMER1 in Sev-induced neurotoxicity and POCD. Sev treated mouse hippocampal neuronal HT22 cells and SD rats. RT-qPCR was used to detect the levels of circHOMER1 and miR-217. ELISA was employed to measure the levels of inflammatory factors IL-6, IL-1β, and TNF-α. Commercially available kits assessed the concentration of MDA and measured the activities LDH and SOD. The CCK-8 assay assessed cell viability. Flow cytometry analyzed cell apoptosis. The Morris water maze test evaluated the learning and cognitive abilities of the rats. Dual luciferase reporter assays and RIP experiments validated the targeted binding of circHOMER1 to miR-217. Sev treatment significantly reduces cell viability, increases apoptosis, stimulates inflammatory responses and oxidative stress, and induces learning and memory impairments in SD rats. Following exposure to Sev, the expression of circHOMER1 is markedly decreased, while overexpression of circHOMER1 can alleviate Sev-induced neuroinflammation, oxidative stress, and learning and memory deficits in rats. CircHOMER1 targets miR-217, and transfection of miR-217 antagonizes the neuroprotective effects of circHOMER1. This study demonstrated that circHOMER1 negatively regulated miR-217, thereby inhibiting Sev-induced neurotoxicity and learning and memory disorders.

Regulation of calcium signaling prevents neuronal death mediated by NIST DEP in xenoferroptotic cell death conditions.

Increased calcium levels are associated with the ferroptosis pathway in neurodegenerative conditions. Recent evidence showed that exposure to particulate matter (PM) could accelerate the pathology of neurodegenerative diseases. However, the molecular mechanisms of how PM could affect brain cell pathology is not fully understood. We hypothesized that diesel exhaust particles (NIST DEP) could alter the ferroptosis pathway through calcium signaling, and therefore accelerate the cell death pathway. In this study, we used mouse hippocampal neuronal-like HT22 cells to evaluate whether exposure to NIST DEP could accelerate RSL-3-induced ferroptosis by increasing calcium deregulation, mitochondrial dysfunction and reactive oxygen species (ROS). MTT assay results showed that NIST DEP (25, 50, 75, and 100 μg/mL) did not significantly reduce the survival rate of HT22 cells, while NIST DEP significantly increased RSL-3-induced ferroptotic cell death in a concentration-dependent manner. Based on fluorescence image analysis, co-exposure to NIST DEP and RSL-3 disrupted HT22 cell mitochondrial morphology, intracellular and mitochondrial calcium levels. Combined exposure resulted in an increase in ER-mitochondria contact sites measured by proximity ligation assay (PLA) compared to control solvent group. Additionally, lipid peroxidation, mitochondrial ROS and malondialdehyde content, were increased significantly by combined exposure to NIST DEP and RSL-3. Interestingly, the calcium regulators of the mitochondrial calcium uniporter MCUi4 and positive modulation of small conductance calcium-activated potassium channels by CyPPA significantly preserved cellular metabolic activity, restored calcium homeostasis, and alleviated fragmentation of mitochondria. Consequently, targeting calcium signaling may be promising therapeutic option for xenoferroptotic conditions in which PM affect cell survival.

Actl6a regulates autophagy via Sox2-dependent Atg5 and Atg7 expression to inhibit apoptosis in spinal cord injury.

Spinal cord injury (SCI) is a severe central nervous system disorder with limited treatment options. While autophagy plays a protective role in neural repair, its regulatory mechanisms in SCI remain unclear. Actin-like protein 6A (Actl6a) influences cell fate and neural development, yet its specific role in SCI repair is not well understood. This study investigates Actl6a's function in regulating autophagy and apoptosis via the transcription factor Sox2 in SCI. This study aims to determine if Actl6a promotes neural survival post-SCI by regulating autophagy-related genes Atg5 and Atg7 through Sox2. It also examines how the demethylase Fto modulates Actl6a mRNA stability via m6A methylation. In vitro experiments were conducted using primary neurons and HT-22 hippocampal cells exposed to hydrogen peroxide (H2O2)-induced oxidative stress. Actl6a expression was manipulated by knockdown or overexpression. For in vivo studies, a rat SCI model was established with AAV-Actl6a injected at the injury site to induce Actl6a overexpression. Autophagy and apoptosis markers were analyzed using immunofluorescence, Western blotting, and qPCR. Additionally, m6A dot blot and RNA immunoprecipitation (RIP) assays were performed to assess Fto's role in regulating Actl6a mRNA methylation and stability. Actl6a expression significantly decreased after SCI, resulting in increased apoptosis. Overexpressing Actl6a enhanced autophagy, reduced apoptosis, and improved neurological function in SCI models. Mechanistically, Actl6a and Sox2 collaboratively upregulated Atg5 and Atg7 expression, promoting autophagy. Fto's modulation of Actl6a mRNA stability via m6A demethylation further influenced autophagy and apoptosis. Actl6a, through interaction with Sox2, plays a critical role in modulating autophagy and reducing apoptosis in SCI, with Fto's m6A modification affecting Actl6a stability. This Fto/Actl6a/Sox2 axis is a promising therapeutic target for SCI repair.

Chlorinated Phenolic, Benzenoid, and Phenylethanoid Glucosides From the Mangrove Endophytic Fungus Fuscoporia sp. A2A6.

A total of 12 new compounds, named fuscoposides A-L (1-12), including 2 phenolic, 9 benzenoid, and 1 phenylethanoid glucosides, were isolated from the mangrove endophytic fungus Fuscoporia sp. A2A6. The structures of these compounds were established by HRESIMS, NMR spectroscopic data, single-crystal x-ray diffraction analysis, and chemical methods. Most notably, 10 compounds, namely, fuscoposides A-I (1-9) and fuscoposide L (12), are mono- or di-chlorinated. Fuscoposide C (3) exhibited moderate neuroprotective effects against H2O2-induced oxidative damage in mouse hippocampal neuron HT-22 cells in a dose-dependent manner at the concentration range of 2.0-6.0µM, whereas fuscoposide G (7) decreased the expression of COX2 in lipopolysaccharide-stimulated mouse microglia BV2 cells at the concentration of 5.0µM, thereby displaying anti-inflammatory activity.

Inflammatory Signaling Induces Mitochondrial Dysfunction and Neuronal Death in Traumatic Brain Injury via Downregulation of OXPHOS Genes.

Traumatic brain injury (TBI) is a major cause of neurological dysfunction and disability. This study aimed to investigate the transcriptomic changes and the functional consequences in TBI, focusing on the interplay between inflammation and mitochondrial impairment. Brain tissue samples from TBI patients and healthy controls were subjected to RNA-sequencing analysis. Mouse hippocampal HT-22 cells were treated with inflammatory cytokine and the PGC-1α activator ZLN005. Mitochondrial function, oxidative stress, and apoptosis were assessed using Seahorse respirometry, electron microscopy, flow cytometry, and molecular assays. A TBI mouse model was established to evaluate the therapeutic effects of ZLN005. Transcriptome profiling revealed downregulation of mitochondrial oxidative phosphorylation (OXPHOS) genes, particularly those encoded by the mitochondrial genome, along with enrichment of neurodegenerative pathways in TBI patients. Concomitantly, pro-inflammatory signaling pathways showed upregulation. In vitro studies demonstrated that inflammatory cytokine TNF-α treatment impaired mitochondrial respiration, induced oxidative stress and apoptosis in HT-22 cells, which could be rescued by ZLN005-mediated PGC-1α activation and restoration of OXPHOS gene expression. Administration of ZLN005 in the TBI mouse model alleviated neuronal cell death, preserved mitochondrial integrity, normalized OXPHOS gene levels in brain tissues, and improved cognitive function. This study uncovers a mechanistic link between inflammation-induced downregulation of mitochondrial OXPHOS genes and neuronal damage in TBI. Targeting this pathway by activating PGC-1α represents a potential therapeutic strategy for TBI.

Attenuating Oxidative Damage with Macelignan in Glutamate-Induced HT22 Hippocampal Cells

Macelignan, from Myristica fragrans (nutmeg), is a bioactive compound with various pharmacological properties, including anti-inflammatory and neuroprotective activities. The purpose of this work was to investigate the antioxidant and anti-apoptotic effects of macelignan in glutamate-treated HT22 mouse hippocampal neurons. Macelignan was extracted and identified in a methanol extract of M. fragrans seeds. The DPPH was used to assess the antioxidative activity of macelignan. Glutamate (5 mM) was used to induce neurotoxicity in the HT22 cells. Neuroprotective effects were measured using relevant biochemical and imaging assays, including cell viability, ROS production, nuclear staining, apoptotic cell death, and protein expression. Macelignan markedly and concentration-dependently enhanced DPPH radical scavenging activity. In the HT22 cell model, glutamate induced cell damage by decreasing cell viability, promoting ROS generation, and increasing apoptotic cell death according to cell morphological changes. However, macelignan treatment restored cell viability, inhibited ROS generation concentration-dependently, and reduced apoptosis. Moreover, glutamate significantly up-regulated the phosphorylation of MAPK-pathway-related proteins, which was reversed by macelignan treatment. In conclusion, macelignan shows notable neuroprotective effects on oxidative stress and apoptotic cell death in glutamate-induced cells, and this study provides useful information on its potential therapeutic implications in neurological disorders.

Downregulation of circTLK1 improves the impairments in learning and memory induced by anesthetics via regulating miR-374b-5p expression and reducing neuroinflammation.

Sevoflurane (Sev) is a common anesthetic used during surgery, but research on its induction of neurotoxicity and learning memory impairment is insufficient. This study aimed to explore the role of Circular RNA tousled like kinase 1 (circTLK1) and its target microRNA (miR)-374b-5p in Sev-induced neurotoxicity and learning memory impairment. Mouse hippocampal neuronal HT22 cells and SD rats were treated with Sev. Levels of circTLK1 and miR-374b-5p were detected using RT-qPCR. The concentration of inflammatory factors was determined using ELISA. Cell viability and apoptosis were analyzed using CCK-8 and flow cytometry. Targeting relationship between circTLK1 and miR-374b-5p was validated using dual-luciferase reporter assays and RIP experiments. The Morris water maze test was used to assess the learning and spatial memory abilities of rats. The results indicated that Sev treatment stimulated neuroinflammation and oxidative stress while increasing circTLK1 levels and decreasing miR-374b-5p levels in both rats and HT22 cells. Silencing circTLK1 alleviated the decrease in cell viability, increased apoptosis rates, and raised concentrations of inflammatory factors caused by Sev treatment. In in vivo experiments, silencing circTLK1 was also found to counteract the oxidative stress, neuroinflammation, and learning and memory impairment induced by Sev treatment in rats. Additionally, circTLK1 was shown to interact with miR-374b-5p, and inhibiting miR-374b-5p could counteract the neuroprotective effects of si-circTLK1. This research suggested that silencing circTLK1 can mitigate Sev-induced neurotoxicity and learning memory impairment by modulating miR-374b-5p.

Melatonin Reduces Mito-Inflammation in Ischaemic Hippocampal HT22 Cells and Modulates the cGAS-STING Cytosolic DNA Sensing Pathway and FGF21 Release.

Mitochondrial dysfunction is a key event in many pathological conditions, including neurodegenerative processes. When mitochondria are damaged, they release damage-associated molecular patterns (DAMPs) that activate mito-inflammation. The present study assessed mito-inflammation after invitro oxygen-glucose deprivation as a representation of ischaemia, followed by reoxygenation (OGD/R) of HT22 cells and modulation of the inflammatory response by melatonin. We observed that melatonin prevented mitochondrial structural damage and dysfunction caused by OGD/R. Melatonin reduced oxidative damage and preserved the enzymatic activity for complexes I, III and IV, encoded by mitochondrial DNA, which were reduced by OGD/R. No effect was observed on complex II activity encoded by nuclear DNA. The release of mtDNA into the cytosol was also prevented with a consequent reduction of the cGAS-STING pathway and IFNβ and IL-6 production. Interestingly, melatonin also increased the early release of the fibroblast growth factor-21 (FGF-21), a mitokine secreted in response to mitochondrial stress. These data indicate that melatonin reduces mito-inflammation and modulates FGF-21 release, further highlighting the key role of this molecule in preserving mitochondrial integrity in OGD/R deprivation-type ischaemic brain injury.

The role of FAM171A2-GRN-NF-κB pathway in TBBPA induced oxidative stress and inflammatory response in mouse-derived hippocampal neuronal HT22 cells

Tetrabromobisphenol A (TBBPA) is one of the brominated flame retardants (BFRs) widely used in industry, which has a broad toxic effect on organisms. However, there is still limited research on the neurotoxic mechanism of TBBPA. Using mouse hippocampal neurons (HT22) cells, the toxicity of TBBPA was evaluated, especially focusing on its alteration on the key molecules in FAM171A2-GRN-NF-κB signaling pathway. The results showed that TBBPA exposure could lead to an increase in the production of inflammation-related genes IL-6, iNOS, TGF-β1, COX2, and TNF-α in both HT22 cells and HT22-AD-model, intensifying the inflammatory response; it inhibits the mRNA expression of antioxidative enzymes genes Sod1, Cat, Gpx1, and Gsta1, resulting in reduced antioxidant enzyme activities of SOD, CAT, and GSH-Px/GPX. Mechanistically, TBBPA caused the upregulation of FAM171A2 expression level, alongside increased GRN, IκBα and p65 levels; whereas the expression of GRN, IκBα and p65 was decreased after FAM171A2 knockdown, demonstrating TBBPA-induced upregulation of FAM171A2 should be responsible for the increased GRN, IκBα and p65 expression. Therefore, for the first time, our data indicate that TBBPA-induced oxidative stress and inflammatory response is closely related to the FAM171A2-GRN-NF-κB pathway.

Antiferroptotic properties of allicin and related organosulfur compounds—diallyl disulfide and diallyl trisulfide—from Garlic

Allicin (diallyl thiosulfinate) is an abundant bioactive compound in garlic (Allium sativum L.) with broad-spectrum antiinflammatory, antifungal, antioxidant, and antitumor properties. The bioactive compounds of garlic including allicin may also help reduce the incidence of various diseases, although the individual contributions and precise mechanisms are still largely unknown. In this study, we reveal that allicin and the closely related compounds diallyl disulfide and diallyl trisulfide (all containing more than one disulfide bond) protect mouse hippocampal HT22 cells against chemically induced ferroptosis, a newly defined form of cell death characterized by iron-dependent lipid peroxidation. In contrast, these organosulfur compounds did not prevent chemically induced apoptosis. The antiferroptotic efficacies of these compounds were strongly associated with prevention of lipid peroxidation and reactive oxygen species production but independent of glutathione upregulation, ferrous iron chelation, and modulation of the nuclear factor erythroid 2 (NF-E2)-related factor-2-antioxidant element response pathway. Additional studies are warranted on the therapeutic potential of allicin and related compounds in garlic for neurodegenerative diseases associated with ferroptosis.

Vitamin D can mitigate sepsis-associated neurodegeneration by inhibiting exogenous histone-induced pyroptosis and ferroptosis: Implications for brain protection and cognitive preservation

BackgroundSepsis-induced neurodegeneration and cognitive dysfunction remain critical challenges worldwide. Vitamin D was reported to reduce neuronal injury and neurotoxicity and its deficiency was associated with neurocognitive disorders. This study investigates the mechanisms by which vitamin D exerts neuroprotective potential against damage-associated molecular patterns (DAMPs), specifically extracellular histones, in sepsis-related brain dysfunction. MethodsThe cultured mouse hippocampal neuronal HT22 cells were exposed to 20 µg/ml exogenous histone for 24 h to induce pyroptosis and ferroptosis in the presence or absence of the active form of vitamin D, calcitriol (1 nM). A cecal ligation and puncture mouse sepsis model was used to evaluate histone release and pyroptosis/ferroptosis biomarkers in the brain together with neurobehavioral performance with or without calcitriol treatment (1 µg/kg, i.p. injection) at 24 h or 1 week after sepsis onset. ResultsIn vitro, histone exposure triggered both pyroptosis and ferroptosis in neuronal cells, which was significantly suppressed by calcitriol treatment with the reduced expression of caspase-1 by 38 %, GSDMD by 30 %, ACSL4 by 33 %, and the increased expression of GPX4 by 35 % (n = 6, P < 0.05). Similarly, in vivo, calcitriol treatment inhibited both neuronal pyroptosis and ferroptosis by reducing expression of pyroptosis marker, GSDMD/NeuN (11.6 ± 1.2 % vs. 19.4 ± 1.1 %) and increasing expression of ferroptosis marker, GPX4/NeuN (21.4 ± 1.7 % vs. 13.5 ± 1.1 %), in the brain of septic mice (n = 6, P < 0.01). In addition, calcitriol increased survival rate (72 % vs. 41 %) and ameliorated cognitive dysfunction of septic mice (n = 8–13, P < 0.05). ConclusionsThis study demonstrates that vitamin D exerts a neuroprotective effect against sepsis by attenuating histone-induced pyroptosis and ferroptosis. These findings highlight the potential therapeutic role of vitamin D supplementation in mitigating brain dysfunction associated with sepsis which needs for further investigation.

Protective Effects of Ambroxol on Aβ and α-Synuclein-Induced Neurotoxicity Through Glucocerebrosidase Activation in HT-22 Hippocampal Neuronal Cells.

Dementia with Lewy bodies (DLB) is a progressive neurodegenerative disorder marked by the accumulation of α-synuclein (αSyn), often co-existing with amyloid β (Aβ) pathology. Current treatments are largely symptomatic, highlighting a critical need for disease-modifying therapies. Evidence suggests that αSyn aggregates contribute to neuronal death in DLB, particularly when exacerbated by Aβ. Given the role of autophagy in clearing misfolded proteins, exploring agents that promote this pathway is essential for developing effective treatments. Ambroxol (AMBX), a mucolytic drug, has demonstrated potential in activating glucocerebrosidase (GCase), an enzyme that enhances lysosomal function and facilitates the autophagic clearance of toxic protein aggregates, including αSyn. This study aims to evaluate AMBX's neuroprotective effects in a cellular model of DLB, with the goal of identifying new therapeutic agents that target the underlying pathology of DLB. In this study, HT-22 hippocampal neuronal cells were exposed to αSyn and Aβ, followed by AMBX treatment. Our results showed that AMBX significantly improved cell viability and reduced apoptosis in cells co-treated with αSyn and Aβ. Additionally, AMBX restored GCase activity, promoted autophagy, and reduced oxidative stress, which in turn mitigated αSyn aggregation and phosphorylation. These findings suggest that by activating GCase and enhancing autophagy, AMBX may help alleviate DLB-associated neurodegeneration. This study underscores the potential of AMBX as a therapeutic agent for DLB and supports further investigation in animal models and clinical trials to validate its efficacy in neurodegenerative disease contexts.

Low-Molecular Neurotrophin-3 Mimetics with Different Patterns of Postreceptor Signaling Activation Attenuate Differentially Morphine Withdrawal in Rats

The accumulated evidence suggests that varying levels of tyrosine kinase receptor signaling pathway activity may regulate opiate-associated neuroadaptation of noradrenergic system. Neurotrophin-3 (NT-3) interacts with tropomyosin receptor kinases (TRKs), binding mainly to TRKC receptors, which are expressed within noradrenergic neurons in the blue spot (locus coeruleus, LC). Considering the difficulties in delivering full-length neurotrophins to the CNS after systemic administration, low-molecular mimetics of loop 4 in NT-3, hexamethylenediamide bis-(N-monosuccinyl-L-asparaginyl-L-asparagine) (GTS-301), and hexamethylenediamide bis-(N-γ-oxybutyryl-L-glutamyl-L-asparagine) (GTS-302), activating TRKC and TRKB receptors, were synthesized. The aim of the study is comparative examination of the effects of NT-3 dipeptide mimetics on the signs of morphine withdrawal in outbred white rats with opiate dependence, as well as investigation of activation of postreceptor signaling pathways by the mimetics. Dipeptides GTS-301 and GTS-302 after acute administration at doses of 0.1, 1.0, and 10.0 mg/kg (i.p., intraperitoneal) had a dose-dependent effect on the specific morphine withdrawal symptoms with the most effective dose being 1.0 mg/kg. Maximum decrease in the total index of morphine withdrawal syndrome for GTS-301 was 31.3% and for GTS-302 – 41.4%. Unlike GTS-301, GTS-302 weakened mechanical allodynia induced by morphine withdrawal, reducing tactile sensitivity. When studying activation of the postreceptor signaling pathways by the NT-3 mimetics in the HT-22 hippocampal cell culture, a different pattern of postreceptor signaling was shown: GTS-302 (10−6 M), similar to NT-3, activates all three MAPK/ERK, PI3K/AKT/mTOR, and PLCγ1 pathways, while GTS-301 (10−6 M) triggers only MAPK/ERK and PLCγ1 pathways. Thus, the identified features of attenuation of the morphine withdrawal syndrome in the rats under GTS-301 and GTS-302 effects could be associated with different activation pattern of the postreceptor pathways.

Taxifolin ameliorates the D-galactose-induced aging of mouse hippocampal neurons HT-22 cells through modulating SIRT1/p53 and PI3K/AKT signaling pathways

By establishing an in vitro model of D-Gal-induced brain neuronal cell (HT-22) senescence, it was found that TAX treatment significantly increased the activities of SOD and GSH, while decreasing MDA levels in aging HT-22 cells, indicating that TAX effectively restored the total antioxidant capacity and antioxidant enzyme activity of aging HT-22 cells induced by D-Gal, and attenuated cellular oxidative stress injury. In addition, taxifolin could also protect HT-22 cells from aging by up-regulating SIRT1 while reducing the expression of Ac-p53, indicating that TAX may be an active substance that can effectively delay cell aging.

Protective effect of water-soluble nervonic acid micro-powder coated with chitosan oligosaccharide and silk fibroin on hippocampal neuronal HT22 cells

Nervonic acid (NA) is an extremely long chain monounsaturated fatty acid that plays a crucial biological role in brain development and repair. However, its low solubility reduced bioavailability and limited its applications. In this study, spherical water-soluble nervonic acid composite micro-powder (NA-WM) was constructed by layer-by-layer self-assembly technology under electrostatic interaction and hydrogen bond, in which electronegative NA was used as the core material, and electropositive COS (Chitosan oligosaccharide) with neuroprotective properties and electronegative SF (Silk fibroin) with biocompatibility and anti-inflammatory synergism were used as the wall material. In the preparation process, the electronegative NA was first combined with electropositive COS by antisolvent method, and then the electropositive COS-NA complex was encapsulated with electronegative SF to form NA-WM. The optimal preparation conditions were screened and optimized via single-factor and BBD method. Under the optimum conditions, the average particle size of NA-WM was 420 ± 35 nm. The results of TGA (Thermogravimetric), SEM (Scanning electron microscopy), and FTIR (Fourier transform infrared spectroscopy) confirmed that NA-WM had good thermal stability and spherical-defined layer-to-layer structure. Additionally, at pH 1.5, the NA release rate of NA-WM was as high as 89.54 % within 2.5 h. Through measuring the levels of MDA (Malondialdehyde), CAT (Catalase), SOD (Superoxide dismutase), GSH-Px (Glutathione peroxidase), and LDH (Lactate dehydrogenase), as well as flow cytometry and SEM analysis, it was confirmed that NA-WM could protect Aβ1–42-induced HT22 by inhibiting oxidative stress and reducing mitochondrial membrane potential. This study provided data support for the development and application of NA.

Bifidobacterium lactis-Derived Vesicles Attenuate Hippocampal Neuroinflammation by Targeting IL-33 to Regulate FoxO6/P53 Signaling.

Hippocampal Neuroinflammation (HNF) is a critical driver of cognitive impairment. The lipopolysaccharide (LPS) accumulate amyloid beta (Aβ) and lead to HNF. The Bifidobacterium lactis (BL) 99 have anti-inflammatory ability. However, whether BL99-derived microbiota-derived vesicles (MV) could alleviate LPS-induced HNF remains unclear. To investigate, we used ultrafiltration with ultracentrifuge to extract BL99-derived-MV (BL99-MV). We used hippocampal neuronal HT22 cells (HT22) to establish the LPS-induced HNF model, and explored whether BL99-MV alleviate LPS-induced HNF. The confocal microscopy showed that BL99-MV were taken up by HT22 and reduced the oxidative stress (ROS) level. The PCR showed that BL99-MV up-regulate IL-10 level, and down-regulate TNF-α, IL-1β, and IL-6. Transcriptomic analysis revealed 4127 differentially expressed genes, with 2549 genes upregulated and 1578 genes downregulated in the BL99-MV group compared to the LPS group. Compared to the LPS group, BL99-MV decreased FoxO6, IL-33, P53, and NFκB expression, but increased FoxO1 and Bcl2 expression. The WB showed that BL99-MV modulated NFκB, FoxO6, P53, Caspase9, and Caspase3 protein expression by reducing IL-33 expression in HT22. The findings demonstrated IL-33 as a regulator for FoxO6/P53 signaling. Here, we hypothesized that BL99-MV alleviated LPS-induced HNF to promote HT22 survival and synaptic development by regulating FoxO6/P53 signaling by targeting IL-33.