Host Genome Research Articles

Non-transgenic, PAMAM co-delivery DNA of interactive proteins NbCRVP and NbCalB endows Nicotiana benthamiana with a stronger antiviral effect to RNA viruses

BackgroundViral diseases continue to pose a major threat to the world’s commercial crops. The in-depth exploration and efficient utilization of resistance proteins have become crucial strategies for their control. However, current delivery methods for introducing foreign DNA suffer from host range limitations, low transformation efficiencies, tissue damage, or unavoidable DNA integration into the host genome. The nanocarriers provides a convenient channel for the DNA delivery and functional utilization of disease-resistant proteins.ResultsIn this research, we identified a cysteine-rich venom protein (NbCRVP) in Nicotiana benthamiana for the first time. Virus-induced gene silencing and transient overexpression clarified that NbCRVP could inhibit the infection of tobacco mosaic virus, potato virus Y, and cucumber mosaic virus, making it a broad-spectrum antiviral protein. Yeast two-hybrid assay, co-immunoprecipitation, and bimolecular fluorescence complementation revealed that calcium-dependent lipid-binding (CaLB domain) family protein (NbCalB) interacted with NbCRVP to assist NbCRVP playing a stronger antiviral effect. Here, we demonstrated for the first time the efficient co-delivery of DNA expressing NbCRVP and NbCalB into plants using poly(amidoamine) (PAMAM) nanocarriers, achieving stronger broad-spectrum antiviral effects.ConclusionsOur work presents a tool for species-independent transfer of two interacting protein DNA into plant cells in a specific ratio for enhanced antiviral effect without transgenic integration, which further demonstrated new strategies for nanocarrier-mediated DNA delivery of disease-resistant proteins.Graphical abstract

Direct translation of incoming retroviral genomes

Viruses that carry a positive-sense, single-stranded (+ssRNA) RNA translate their genomes soon after entering the host cell to produce viral proteins, with the exception of retroviruses. A distinguishing feature of retroviruses is reverse transcription, where the +ssRNA genome serves as a template to synthesize a double-stranded DNA copy that subsequently integrates into the host genome. As retroviral RNAs are produced by the host cell transcriptional machinery and are largely indistinguishable from cellular mRNAs, we investigated the potential of incoming retroviral genomes to directly express proteins. Here we show through multiple, complementary methods that retroviral genomes are translated after entry. Our findings challenge the notion that retroviruses require reverse transcription to produce viral proteins. Synthesis of retroviral proteins in the absence of productive infection has significant implications for basic retrovirology, immune responses and gene therapy applications.

Pseudogenes act as a neutral reference for detecting selection in prokaryotic pangenomes.

A long-standing question is to what degree genetic drift and selection drive the divergence in rare accessory gene content between closely related bacteria. Rare genes, including singletons, make up a large proportion of pangenomes (all genes in a set of genomes), but it remains unclear how many such genes are adaptive, deleterious or neutral to their host genome. Estimates of species' effective population sizes (Ne) are positively associated with pangenome size and fluidity, which has independently been interpreted as evidence for both neutral and adaptive pangenome models. We hypothesized that pseudogenes, used as a neutral reference, could be used to distinguish these models. We find that most functional categories are depleted for rare pseudogenes when a genome encodes only a single intact copy of a gene family. In contrast, transposons are enriched in pseudogenes, suggesting they are mostly neutral or deleterious to the host genome. Thus, even if individual rare accessory genes vary in their effects on host fitness, we can confidently reject a model of entirely neutral or deleterious rare genes. We also define the ratio of singleton intact genes to singleton pseudogenes (si/sp) within a pangenome, compare this measure across 668 prokaryotic species and detect a signal consistent with the adaptive value of many rare accessory genes. Taken together, our work demonstrates that comparing with pseudogenes can improve inferences of the evolutionary forces driving pangenome variation.

Virome analysis of Desmodus rotundus tissue samples from the Amazon region

BackgroundBats are renowned for harboring a high viral diversity, their characteristics contribute to emerging infectious diseases. However, environmental and anthropic factors also play a significant role in the emergence of zoonotic viruses. Metagenomic is an important tool for investigating the virome of bats and discovering new viruses.ResultsTwenty-four families of virus were detected in lung samples by sequencing and bioinfomatic analysis, the largest amount of reads was focused on the Retroviridae and contigs assembled to Desmodus rotundus endogenous retrovirus, which was feasible to acquire complete sequences. The reads were also abundant for phages.ConclusionThis lung virome of D. rotundus contributes valuable information regarding the viral diversity found in bats, which is useful for understanding the drivers of viral cycles and their ecology in this species. The identification and taxonomic categorization of viruses hosted by bats carry epidemiological significance due to the potential for viral adaptation to other animals and humans, which can have severe repercussions for public health. Furthermore, the characterization of endogenized viruses helps to understanding the host genome and the evolution of the species.

Mechanisms of hepatic steatosis in chickens: integrated analysis of the host genome, molecular phenomics and gut microbiome.

Hepatic steatosis is the initial manifestation of abnormal liver functions and often leads to liver diseases such as nonalcoholic fatty liver disease in humans and fatty liver syndrome in animals. In this study, we conducted a comprehensive analysis of a large chicken population consisting of 705 adult hens by combining host genome resequencing; liver transcriptome, proteome, and metabolome analysis; and microbial 16S ribosomal RNA gene sequencing of each gut segment. The results showed the heritability (h2 = 0.25) and duodenal microbiability (m2 = 0.26) of hepatic steatosis were relatively high, indicating a large effect of host genetics and duodenal microbiota on chicken hepatic steatosis. Individuals with hepatic steatosis had low microbiota diversity and a decreased genetic potential to process triglyceride output from hepatocytes, fatty acid β-oxidation activity, and resistance to fatty acid peroxidation. Furthermore, we revealed a molecular network linking host genomic variants (GGA6: 5.59-5.69 Mb), hepatic gene/protein expression (PEMT, phosphatidyl-ethanolamine N-methyltransferase), metabolite abundances (folate, S-adenosylmethionine, homocysteine, phosphatidyl-ethanolamine, and phosphatidylcholine), and duodenal microbes (genus Lactobacillus) to hepatic steatosis, which could provide new insights into the regulatory mechanism of fatty liver development.

Mapping the landscape of HPV integration and characterising virus and host genome interactions in HPV-positive oropharyngeal squamous cell carcinoma.

Human papillomavirus (HPV) integration into the host genome is an important factor in HPV(+)OPSCC carcinogenesis, in conjunction with HPV oncoproteins E6/E7. However, a well-studied investigation about virus-host interaction still needs to be completed. Our objective is to characterise HPV integration to investigate potential mechanisms of tumourigenesis independent of E6/E7 oncoproteins. High-throughput viral integration detection was performed on 109 HPV(+)OPSCC tumours with relevant clinicopathological information. Of these tumours, 38 tumours underwent targeted gene sequencing, 29 underwent whole exome sequencing and 26 underwent RNA sequencing. HPV integration was detected in 94% of tumours (with a mean integration count of 337). Tumours occurring at the tonsil/oropharyngeal wall that exhibit higher PD-L1 expression demonstrated increased integration sites (p=.024). HPV exhibited a propensity for integration at genomic sites located within specific fragile sites (FRA19A) or genes associated with functional roles such as cell proliferation and differentiation (PTEN, AR), immune evasion (CD274) and glycoprotein biosynthesis process (FUT8). The viral oncogenes E2, E4, E6 and E7 tended to remain intact. HPV fragments displayed enrichment within host copy number variation (CNV) regions. However, insertions into genes related to altered homologous recombination repair were infrequent. Genes with integration had distinct expression levels. Fifty-nine genes whose expression level was affected by viral integration were identified, for example, EPHB1, which was reported to be involved in cellular protein metabolic process. HPV can promote oncogenesis through recurrent integration into functional host genome regions, leading to subsequent genomic aberrations and gene expression disruption. This study characterises viral integrations and virus-host interactions, enhancing our understanding of HPV-related carcinogenesis mechanisms.

Combining a Base Deaminase Mutator with Phage-Assisted Evolution.

Phage-assisted evolution has emerged as a powerful technique for improving a protein's function by using mutagenesis and selective pressure. However, mutations typically occur throughout the host's genome and are not limited to the gene-of-interest (GOI): these undesirable genomic mutations can yield host cells that circumvent the system's selective pressure. Our system targets mutations specifically toward the GOI by combining T7 targeted mutagenesis and phage-assisted evolution. This system improves the structure and function of proteins by accumulating favorable mutations that can change its binding affinity, specificity, and activity.

Group I introns: Structure, splicing and their applications in medical mycology.

Group I introns are small RNAs (250-500 nt) capable of catalyzing their own splicing from the precursor RNA. They are widely distributed across the tree of life and have intricate relationships with their host genomes. In this work, we review its basic structure, self-splicing and its mechanisms of gene mobility. As they are widely found in unicellular eukaryotes, especially fungi, we gathered information regarding their possible impact on the physiology of fungal cells and the possible application of these introns in medical mycology.

Merkel cell carcinoma: A rare sarcoma

Merkel cell carcinoma (MCC) is a rare cutaneous neoplasm that accounts for less than 1% of all primary cutaneous neoplasms. The majority of MCC cases (80%) are caused by Merkel cell polyomavirus (MCPyV) clonal integration into the host genome. In the remaining 20% of cases, UV mutations are responsible, and prolonged UV exposure is a factor. Herein, we present two cases of this rare tumor: a 48-year-old female with a diagnosis of hairy cell leukemia and an elderly male previously healthy. Key words: Merkel cell carcinoma, Cutaneous neoplasm, Hospital dermatology

Characterization of Nuclear HIV-Induced Membraneless Organelles Through Fluorescence Microscopy.

The postnuclear entry steps of HIV-1 involve reverse transcription, uncoating, and integration into the host genome. The differential regulation of these steps has a significant impact on HIV overall replication, including integration site selection and viral gene expression. Recently, another important phenomenon has been uncovered as part of HIV interplay with the nuclear environment, specifically involving the cleavage and polyadenylation specific factor 6 (CPSF6) protein. This phenomenon is the formation of nuclear HIV-induced membraneless organelles (HIV-1 MLOs). In this article, we will describe the methods used to assess the composition and liquid-liquid phase separation (LLPS) properties of these organelles using fluorescence microscopy. The study of HIV-1 MLOs represents a new frontier that may reveal previously unknown key players in the fate of HIV-infected cells.

Unravelling the Impact of Human Papillomavirus (HPV): A Comprehensive Exploration of its Role in Cancer Progression and Global Health Challenges

HPV represents a large group of double stranded DNA viruses that are highly involved with different types of human cancers. This synopsis describes the complexities surrounding HPV virology, classifications, and genomic variation, especially focusing on high-risk strains such as HPV16 and HPV18, the main causative factors for cervical cancers. The International Committee on Taxonomy of Viruses specifies more than 200 HPV types each associated with a respective disease and indicated in Table 1. HPV spread is mostly due to direct skin-to-skin contact between individuals’ sex organs causing infections on the mucous membrane and keratinized epithelial cells. Although majority of the infections are asymptomatic, some chronic HRHPV infections may progress into cancers because of oncoproteins E6 and E7. The high-risk variants of HPV lead to cervical, anal, and oropharyngeal cancers whereas the low-risk types cause harmless genital warts. While integrating HPV DNA into the host genome, orchestrated by oncoproteins E6 and E7 disrupts the cell regulatory mechanism; this leads to abnormal control over cell multiplication–one of the major elements of the process that develops to HPV induced cancer. A classic case is cervical cancer that has been extensively investigated as one of the highly documented HPV associated malignancies. Pap smears and HPV DNA tests are among the screening means that lower the incidents and deaths associated with cervical cancers. HPV-associated cancers of the head and neck, anus, penis, vulva, and vagina all show a characteristic profile in terms of the pathogen aetiology and risks involved. HPV-related head and neck cancers affect non-smokers and show good response to standard therapies. HPV poses increased anal cancer risk for immunocompromised individuals highlighting the complexity of interdependence of immunity and cancer development. Penile cancer results from poor hygiene and non-circumcision. Vulvar and virginal cancer mostly affects women, and the risk factors involve HPV infection and smoking. Therefore, various types of multidisciplinary approach that may include surgeries, radiotherapy, and chemotherapy are necessary to ensure proper treatment. Certain cancers are strongly associated with some high-risk HPV genotypes, such as HPV-16 and HPV-18; thus, vaccination is important. HPV infection outcomes are determined by the immune response as well as clearance of HPV infection. Screening and immunological understanding for early detection of HPV related health risks is fundamental. However, this encompassing review highlights the multi-dimensional impact of HPV encompassing virology of HPV, cancer specific presentation of HPV and control including prevention of HPV infection, screening, and research on cancer attributable by HPV and strategies towards mitigation of this global health problem.

Genomic Insights of a Methicillin-Resistant Biofilm-Producing Staphylococcus aureus Strain Isolated From Food Handlers.

Methicillin-resistant Staphylococcus aureus (MRSA) is an important zoonotic pathogen associated with a wide range of infections in humans and animals. Thus, the emergence of MRSA clones poses an important threat to human and animal health. This study is aimed at elucidating the genomics insights of a strong biofilm-producing and multidrug-resistant (MDR) S. aureus MTR_BAU_H1 strain through whole-genome sequencing (WGS). The S. aureus MTR_BAU_H1 strain was isolated from food handlers' hand swabs in Bangladesh and phenotypically assessed for antimicrobial susceptibility and biofilm production assays. The isolate was further undergone to high throughput WGS and analysed using different bioinformatics tools to elucidate the genetic diversity, molecular epidemiology, sequence type (ST), antimicrobial resistance, and virulence gene distribution. Phenotypic analyses revealed that the S. aureus MTR_BAU_H1 strain is a strong biofilm-former and carries both antimicrobial resistance (e.g., methicillin resistance; mecA, beta-lactam resistance; blaZ and tetracycline resistance; tetC) and virulence (e.g., sea, tsst, and PVL) genes. The genome of the S. aureus MTR_BAU_H1 belonged to ST1930 that possessed three plasmid replicons (e.g., rep16, rep7c, and rep19), seven prophages, and two clustered regularly interspaced short palindromic repeat (CRISPR) arrays of varying sizes. Phylogenetic analysis showed a close evolutionary relationship between the MTR_BAU_H1 genome and other MRSA clones of diverse hosts and demographics. The MTR_BAU_H1 genome harbours 42 antimicrobial resistance genes (ARGs), 128 virulence genes, and 273 SEED subsystems coding for the metabolism of amino acids, carbohydrates, proteins, cofactors, vitamins, minerals, and lipids. This is the first-ever WGS-based study of a strong biofilm-producing and MDR S. aureus strain isolated from human hand swabs in Bangladesh that unveils new information on the resistomes (ARGs and correlated mechanisms) and virulence potentials that might be linked to staphylococcal pathogenesis in both humans and animals.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Comprehensive Review of Hepatocellular Carcinoma: Epidemiological Trends, Risk Factors, and Mechanisms of Carcinogenesis

Background: Hepatocellular carcinoma (HCC) is a leading cause of cancer-related deaths worldwide, often arising in the context of chronic liver diseases like cirrhosis, with significant contributions from hepatitis B virus (HBV), hepatitis C virus (HCV), and metabolic dysfunction-associated fatty liver disease (MAFLD). The disease’s high mortality rate and complex etiology underscore the need for improved diagnostic and therapeutic strategies. Methods: This review synthesizes current epidemiological data and research on HCC. We analyzed global and regional incidence and mortality rates, assessed the role of major risk factors, including HBV, HCV, and MAFLD, and evaluated recent advancements in diagnostic and therapeutic approaches. Data were sourced from recent literature, including epidemiological studies and clinical trials. Results: The incidence of HCC continues to rise globally, with significant regional variations. HBV and HCV infections remain major contributors to HCC, with HBV's integration into the host genome playing a critical role in carcinogenesis. MAFLD, now a prominent risk factor in high-income countries, is expected to impact global HCC rates increasingly. Despite advances in diagnostic techniques such as precision medicine and liquid biopsies, early detection remains challenging, and recurrence rates after treatment are high. Conclusion: The growing burden of HCC highlights the urgent need for enhanced screening methods and novel treatments. Continued research into the disease’s etiology and improved therapeutic approaches are essential to reducing incidence and improving patient outcomes. Enhanced early detection and personalized treatment strategies are critical to addressing the ongoing challenges in HCC management.

SARS-CoV-2 NSP12 utilizes various host splicing factors for replication and splicing regulation.

The RNA-dependent RNA polymerase (RdRp) is a crucial element in the replication and transcription of RNA viruses. Although the RdRps of lethal human coronaviruses severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-CoV, and Middle East respiratory syndrome coronavirus (MERS-CoV) have been extensively studied, the molecular mechanism of the catalytic subunit NSP12, which is involved in pathogenesis, remains unclear. In this study, the biochemical and cell biological results demonstrate the interactions between SARS-CoV-2 NSP12 and seven host proteins, including three splicing factors (SLU7, PPIL3, and AKAP8). The entry efficacy of SARS-CoV-2 considerably decreased when SLU7 or PPIL3 was knocked out, indicating that abnormal splicing of the host genome was responsible for this occurrence. Furthermore, the polymerase activity and stability of SARS-CoV-2 RdRp were affected by the three splicing factors to varying degrees. In addition, NSP12 and its homologues from SARS-CoV and MERS-CoV suppressed the alternative splicing of cellular genes, which were influenced by the three splicing factors. Overall, our research illustrates that SARS-CoV-2 NSP12 can engage with various splicing factors, thereby impacting virus entry, replication, and gene splicing. This not only improves our understanding of how viruses cause diseases but also lays the foundation for the development of antiviral therapies.

Application of HPV-16 in Liquid-Based thin Layer Cytology of Host Genetic Lesions Based on AI Diagnostic Technology Presentation of Liquid

Nowadays, with the continuous improvement of people's health awareness and the increasing incidence of cancer year by year, the screening work of various clinical diseases, especially cancer, is also widely promoted. Cervical lesion screening is a common type. Cervical lesion screening is used to judge whether women have cervical lesions and increase attention to cervical lesions[1]. Proper prevention, diagnosis and treatment play an important role in ensuring women's health and life safety, and have been widely promoted in many places in our country. At the same time, in the screening of cervical lesions, how to adopt a more efficient and accurate diagnosis is very important to improve the screening effect of cervical lesions. With the rapid development of science and technology, AI and other advanced technologies have been gradually introduced in clinical disease diagnosis, especially in the liquid-based thin-layer cytology examination[2]. To further analyze the application effect of liquid based thin layer cytology AI diagnostic technology in the pathological diagnosis of cervical lesions. In this paper, we investigate the occurrence of HPV-16 integrated human host genome in cervical cancer and precancerous lesions and its application in cervical cancer screening. 50 cases of cervical cancer, 127 cases of LSIL, 83 cases of HSIL were collected, in addition, 22 cases of normal cervical epithelial tissues extracted by total hysterectomy were collected. The integration status of HPV-16 infection was detected by overlapping PCR.

A tale of caution: How endogenous viral elements affect virus discovery in transcriptomic data.

Large-scale metagenomic and -transcriptomic studies have revolutionized our understanding of viral diversity and abundance. In contrast, endogenous viral elements (EVEs), remnants of viral sequences integrated into host genomes, have received limited attention in the context of virus discovery, especially in RNA-Seq data. EVEs resemble their original viruses, a challenge that makes distinguishing between active infections and integrated remnants difficult, affecting virus classification and biases downstream analyses. Here, we systematically assess the effects of EVEs on a prototypical virus discovery pipeline, evaluate their impact on data integrity and classification accuracy, and provide some recommendations for better practices. We examined EVEs and exogenous viral sequences linked to Orthomyxoviridae, a diverse family of negative-sense segmented RNA viruses, in 13 genomic and 538 transcriptomic datasets of Culicinae mosquitoes. Our analysis revealed a substantial number of viral sequences in transcriptomic datasets. However, a significant portion appeared not to be exogenous viruses but transcripts derived from EVEs. Distinguishing between transcribed EVEs and exogenous virus sequences was especially difficult in samples with low viral abundance. For example, three transcribed EVEs showed full-length segments, devoid of frameshift and nonsense mutations, exhibiting sufficient mean read depths that qualify them as exogenous virus hits. Mapping reads on a host genome containing EVEs before assembly somewhat alleviated the EVE burden, but it led to a drastic reduction of viral hits and reduced quality of assemblies, especially in regions of the viral genome relatively similar to EVEs. Our study highlights that our knowledge of the genetic diversity of viruses can be altered by the underestimated presence of EVEs in transcriptomic datasets, leading to false positives and altered or missing sequence information. Thus, recognizing and addressing the influence of EVEs in virus discovery pipelines will be key in enhancing our ability to capture the full spectrum of viral diversity.

Precise genetic engineering with piggyBac transposon in plants.

Transposons are mobile genetic elements that can move to a different position within a genome or between genomes. They have long been used as a tool for genetic engineering, including transgenesis, insertional mutagenesis, and marker excision, in a variety of organisms. The piggyBac transposon derived from the cabbage looper moth is one of the most promising transposon tools ever identified because piggyBac has the advantage that it can transpose without leaving a footprint at the excised site. Applying the piggyBac transposon to precise genome editing in plants, we have demonstrated efficient and precise piggyBac transposon excision from a transgene locus integrated into the rice genome. Furthermore, introduction of only desired point mutations into the target gene can be achieved by a combination of precise gene modification via homologous recombination-mediated gene targeting with subsequent marker excision from target loci using piggyBac transposition in rice. In addition, we have designed a piggyBac-mediated transgenesis system for the temporary expression of sequence-specific nucleases to eliminate the transgene from the host genome without leaving unnecessary sequences after the successful induction of targeted mutagenesis via sequence-specific nucleases for use in vegetatively propagated plants. In this review, we summarize our previous works and the future prospects of genetic engineering with piggyBac transposon.

Gut microbiome and metabolic profiles of mouse model for MeCP2 duplication syndrome

The extra copy of the methyl-CpG-binding protein 2 (MeCp2) gene causes MeCP2 duplication syndrome (MDS), a neurodevelopmental disorder characterized by intellectual disability and autistic phenotypes. However, the disturbed microbiome and metabolic profiling underlying the autistic-like behavioral deficits of MDS are rarely investigated. Here we aimed to understand the contributions of microbiome disruption and associated metabolic alterations, especially the disturbed neurotransmitters in MDS employing a transgenic mouse model with MeCP2 overexpression. We analyzed metabolic profiles of plasma, urine, and cecum content and microbiome profiles by both 16 s RNA and shotgun metagenomics sequence technology. We found the decreased levels of Firmicutes and increased levels of Bacteroides in the single MeCP2 gene mutation autism-like mouse model, demonstrating the importance of the host genome in a selection of microbiome, leading to the heterogeneity characteristics of microbiome in MDS. Furthermore, the changed levels of several neurotransmitters (such as dopamine, taurine, and glutamate) implied the excitatory-inhibitory imbalance caused by the single gene mutation. Concurrently, a range of microbial metabolisms of aromatic amino acids (such as tryptophan and phenylalanine) were identified in different biological matrices obtained from MeCP2 transgenic mice. Our investigation revealed the importance of genetic variation in accounting for the differences in microbiomes and confirmed the bidirectional regulatory axis of microbiota-gut-brain in studying the role of microbiome on MDS, which could be useful in deeply understanding the microbiome-based treatment in this autistic-like disease.

Uncovering differences in the composition and function of phage communities and phage-bacterium interactions in raw soy sauce.

Although the composition and succession of microbial communities in soy sauce fermentation have been well-characterized, the understanding of phage communities in soy sauce remains limited. This study determined the diversity, taxonomic composition, and predicted function of phage communities and the phage-host interactions in two types of raw soy sauce (Cantonese-type fermentation, NJ; Japanese-type fermentation, PJ) using shotgun metagenomics. These two raw soy sauces showed differences in phage composition (121 viral operational taxonomic units (vOTUs) in NJ and 387 vOTUs in PJ), with a higher abundance of the family Siphoviridae (58.50%) in the NJ phage community and a higher abundance of Myoviridae (33.01%) in PJ. Auxiliary metabolic functional annotation analyses showed that phages in the raw soy sauces mostly encoded genes with unknown functions (accounting for 66.33% of COG profiles), but the NJ sample contained genes mostly annotated to conventional functions related to carbohydrate metabolism (0.74%) and lipid metabolism (0.84%), while the PJ sample presented a higher level of amino acid metabolism functions (0.12%). Thirty auxiliary metabolism genes (AMGs) were identified in phage genomes, which were associated with carbohydrate utilization, cysteine and methionine metabolism, and aspartic acid biosynthesis for the host. To identify phage-host interactions, 30 host genomes (affiliated with 22 genera) were also recruited from the metagenomic dataset. The phage-host interaction analysis revealed a wide range of phage hosts, for which a total of 57 phage contigs were associated with 17 host genomes, with Shewanella fodinae and Weissella cibaria infected by the most phages. This study provides a comprehensive understanding of the phage community composition, auxiliary metabolic functions, and interactions with hosts in two different types of raw soy sauce.