Host Cellular Genes Research Articles

Transcriptome analysis of Burkitt lymphoma cells treated with anti-convulsant drugs that are inhibitors of Epstein-Barr virus lytic reactivation.

Herpesviruses have two distinct life cycle stages, latency and lytic replication. Epstein-Barr virus (EBV), a gamma-herpesvirus, establishes latency in vivo and in cultured cells. Cell lines harboring latent EBV can be induced into the lytic cycle by treatment with chemical inducing agents. In the Burkitt lymphoma cell line HH514-16 the viral lytic cycle is triggered by butyrate, a histone deacetylase (HDAC) inhibitor. Butyrate also alters expression of thousands of cellular genes. However, valproic acid (VPA), another HDAC inhibitor with global effects on cellular gene expression blocks EBV lytic gene expression in Burkitt lymphoma cell lines. Valpromide (VPM), an amide derivative of VPA, is not an HDAC inhibitor, but like VPA blocks induction of the EBV lytic cycle. VPA and VPM are the first examples of inhibitors of initial stages of lytic reactivation. We compared the effects of VPA and VPM, alone and in combination with butyrate, on host cellular gene expression using whole transcriptome analysis (RNA-seq). Gene expression was analyzed 6 h after addition of the compounds, a time before the first EBV lytic transcripts are detected. The results address two alternative, yet possibly complementary, mechanisms for regulation of EBV lytic reactivation. First, cellular genes that were up- or down-regulated by butyrate, but no longer altered in the presence of VPA or VPM, represent genes that correlated with EBV lytic reactivation. Second, genes regulated similarly by VPA and VPM in the absence and presence of butyrate are candidates for suppressors of EBV reactivation. Two genes upregulated by the lytic cycle inhibitors, CHAC1 and SLC7A11, are related to redox status and the iron-dependent cell death pathway ferroptosis. This study generates new hypotheses for control of the latency to lytic cycle switch of EBV and provides the first description of effects of the anti-convulsant drug VPM on global human cellular gene expression.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E)protein-encoding sequenceand luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Transcriptional induction of TGF-β1 and endothelial-to-mesenchymal transition cell markers in human umbilical vein endothelial cells by Ebola virus infection.

Ebola virus (EBOV) causes a serious hemorrhagic disease in humans, with a mortality rate of up to 80%. Despite significant achievements in the past decades elucidating the pathogenesis of EBOV, there is still much to be elucidated about the cell type-specific host response and their functional roles during infection. This study aimed to gain insight into cell type-specific host responses to EBOV infection. Real-time RT-qPCR analysis was used to identify host transcriptional changes in epithelial Caco-2 cells and endothelial HUVECs by EBOV infection. EBOV efficiently infected to both Caco-2 cells and HUVECs, depending on the time of infection. However, changes in the transcriptional levels of several host cellular genes following viral infection showed significant differences between Caco-2 cells and HUVECs. EBOV infection increases the transcription of TGF-β1, a key factor in epithelium-to-mesenchyme transition (EMT), only in HUVECs, but not in Caco-2 cells. This upregulation in turn induces the transcription of other EMT signaling molecules such as snail, slug and MMP9, ultimately leading to endothelial-to-mesenchymal transition (EndMT). Furthermore, this EndMT process appears to be associated with increased transcription of stem-cell markers such as Klf4, Sox2 and Oct4. However, most of these transcriptional changes due to EBOV infection did not occur in Caco-2 cells, suggesting that EMT or EndMT by EBOV infection is cell type-specific. We propose that EBOV infection induces the expression of TGF-β1-mediated signals in endothelial HUVECs, resulting in EndMT. This could provide broader information to elucidate the pathogenesis of Ebola virus disease.

The symbiotic relationship between Caenorhabditis elegans and members of its microbiome contributes to worm fitness and lifespan extension

BackgroundA healthy microbiome influences host physiology through a mutualistic relationship, which can be important for the host to cope with cellular stress by promoting fitness and survival. The mammalian microbiome is highly complex and attributing host phenotypes to a specific member of the microbiome can be difficult. The model organism Caenorhabditis elegans and its native microbiome, discovered recently, can serve as a more tractable, experimental model system to study host-microbiome interactions. In this study, we investigated whether certain members of C. elegans native microbiome would offer a benefit to their host and putative molecular mechanisms using a combination of phenotype screening, omics profiling and functional validation.ResultsA total of 16 members of C. elegans microbiome were screened under chemically-induced toxicity. Worms grown with Chryseobacterium sp. CHNTR56 MYb120 or Comamonas sp. 12022 MYb131, were most resistant to oxidative chemical stress (SiO2 nanoparticles and juglone), as measured by progeny output. Further investigation showed that Chryseobacterium sp. CHNTR56 positively influenced the worm’s lifespan, whereas the combination of both isolates had a synergistic effect. RNAseq analysis of young adult worms, grown with either isolate, revealed the enrichment of cellular detoxification mechanisms (glutathione metabolism, drug metabolism and metabolism of xenobiotics) and signaling pathways (TGF-beta and Wnt signaling pathways). Upregulation of cysteine synthases (cysl genes) in the worms, associated with glutathione metabolism, was also observed. Nanopore sequencing uncovered that the genomes of the two isolates have evolved to favor the specific route of the de novo synthesis pathway of vitamin B6 (cofactor of cysl enzymes) through serC or pdxA2 homologs. Finally, co-culture with vitamin B6 extended worm lifespan.ConclusionsIn summary, our study indicates that certain colonizing members of C. elegans have genomic diversity in vitamin B6 synthesis and promote host fitness and lifespan extension. The regulation of host cellular detoxification genes (i.e. gst) along with cysl genes at the transcriptome level and the bacterium-specific vitamin B6 synthesis mechanism at the genome level are in an agreement with enhanced host glutathione-based cellular detoxification due to this interspecies relationship. C. elegans is therefore a promising alternative model to study host-microbiome interactions in host fitness and lifespan.

Large-Scale Gene Expression Signatures Reveal a Microbicidal Pattern of Activation in Mycobacterium leprae-Infected Monocyte-Derived Macrophages With Low Multiplicity of Infection.

Leprosy is a disease with a clinical spectrum of presentations that is also manifested in diverse histological features. At one pole, lepromatous lesions (L-pole) have phagocytic foamy macrophages heavily parasitized with freely multiplying intracellular Mycobacterium leprae. At the other pole, the presence of epithelioid giant cells and granulomatous formation in tuberculoid lesions (T-pole) lead to the control of M. leprae replication and the containment of its spread. The mechanism that triggers this polarization is unknown, but macrophages are central in this process. Over the past few years, leprosy has been studied using large scale techniques to shed light on the basic pathways that, upon infection, rewire the host cellular metabolism and gene expression. M. leprae is particularly peculiar as it invades Schwann cells in the nerves, reprogramming their gene expression leading to a stem-like cell phenotype. This modulatory behavior exerted by M. leprae is also observed in skin macrophages. Here, we used live M. leprae to infect (10:1 multiplicity of infection) monocyte-derived macrophages (MDMs) for 48 h and analyzed the whole gene expression profile using microarrays. In this model, we observe an intense upregulation of genes consistent with a cellular immune response, with enriched pathways including peptide and protein secretion, leukocyte activation, inflammation, and cellular divalent inorganic cation homeostasis. Among the most differentially expressed genes (DEGs) are CCL5/RANTES and CYP27B1, and several members of the metallothionein and metalloproteinase families. This is consistent with a proinflammatory state that would resemble macrophage rewiring toward granulomatous formation observed at the T-pole. Furthermore, a comparison with a dataset retrieved from the Gene Expression Omnibus of M. leprae-infected Schwann cells (MOI 100:1) showed that the patterns among the DEGs are highly distinct, as the Schwann cells under these conditions had a scavenging and phagocytic gene profile similar to M2-like macrophages, with enriched pathways rearrangements in the cytoskeleton, lipid and cholesterol metabolism and upregulated genes including MVK, MSMO1, and LACC1/FAMIN. In summary, macrophages may have a central role in defining the paradigmatic cellular (T-pole) vs. humoral (L-pole) responses and it is likely that the multiplicity of infection and genetic polymorphisms in key genes are gearing this polarization.

CRISPR/Cas9 ablating viral microRNA promotes lytic reactivation of Kaposi’s sarcoma-associated herpesvirus

The CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated gene 9) system is an RNA-guided, DNA editing method that has been widely used for gene editing, including human viruses. Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV8), following latent infection in human cells, can cause a variety of malignancies, such as Kaposi’s sarcoma (KS), primary effusion lymphoma (PEL), and multicentric Castleman disease (MCD), with a high prevalence in immunocompromised patients. Of significant concern, the latent infection with KSHV has been shown to lead to increased resistance to antiviral therapies. MicroRNAs (miRNAs) are a set of non-coding, small RNA molecules that regulate protein-coding genes at the post-transcriptional and translational levels. KSHV has its miRNAs, most of which are expressed in latently infected cells and play a crucial role in maintaining KSHV latency. Notably, by regulating the expression of the downstream target genes in host cells, KSHV miRNAs can interact with the host environment to promote the development of KSHV-related diseases. Although CRISPR/Cas9 has been reported to edit KSHV protein-coding genes, there is no published literature on whether the CRISPR/Cas9 system can regulate the expression of KSHV miRNAs. In this study, we used CRISPR/Cas9 to inhibit the expression of KSHV miRNAs by directly editing the DNA sequences of individual KSHV miRNAs, or the promoter of clustered KHSV miRNAs, in latent KSHV-infected PEL cells. Our results show that CRISPR/Cas9 can ablate KSHV miRNAs expression, which in turn leads to the upregulation of viral lytic genes and alteration of host cellular gene expression. To the best of our knowledge, our study is the first reported demonstration of the CRISPR/Cas9 system editing KSHV miRNAs, further expanding the application of CRISPR/Cas9 as a novel antiviral strategy targeting KSHV latency.

Gene Expression Profiling of Different Huh7 Variants Reveals Novel Hepatitis C Virus Host Factors

Chronic Hepatitis C virus (HCV) infection still constitutes a major global health problem with almost half a million deaths per year. To date, the human hepatoma cell line Huh7 and its derivatives is the only cell line that robustly replicates HCV. However, even different subclones and passages of this single cell line exhibit tremendous differences in HCV replication efficiency. By comparative gene expression profiling using a multi-pronged correlation analysis across eight different Huh7 variants, we identified 34 candidate host factors possibly affecting HCV permissiveness. For seven of the candidates, we could show by knock-down studies their implication in HCV replication. Notably, for at least four of them, we furthermore found that overexpression boosted HCV replication in lowly permissive Huh7 cells, most prominently for the histone-binding transcriptional repressor THAP7 and the nuclear receptor NR0B2. For NR0B2, our results suggest a finely balanced expression optimum reached in highly permissive Huh7 cells, with even higher levels leading to a nearly complete breakdown of HCV replication, likely due to a dysregulation of bile acid and cholesterol metabolism. Our unbiased expression-profiling approach, hence, led to the identification of four host cellular genes that contribute to HCV permissiveness in Huh7 cells. These findings add to an improved understanding of the molecular underpinnings of the strict host cell tropism of HCV.

Advances in the role of HCV nonstructural protein 5a (NS5A) of 3a genotype in inducing insulin resistance by possible phosphorylation of AKT/PKB

HCV genes interfere with host cellular genes and play crucial role in pathogenesis. The mechanism under which HCV genes induce insulin resistance is not much clear. This study is aimed to examine the role of HCV NS5A in inducing insulin resistance by examining its affect in the phosphorylation level of AKT/PKB. In the present study, HepG2 cells were transfected with HCV NS5A and after 24 hours of transfection, protein was extracted from cells that were pre induced with insulin at three different time intervals i.e. 1hour, 2 hours and 3hours. Dot Blot analysis was performed to study the phosphorylation level of AKT. Results showed that there is clear upregulation of serine 473 phosphorylation level of AKT in NS5A transfected cells as compared with control (without NS5A). In conclusion, upregulation of serine 473 phosphorylation by NS5A of HCV genotype 3a suggests that this gene impairs the normal insulin AKT/PKB signaling pathway that leads towards insulin resistance and Type 2 diabetes mellitus. Therefore, HCV non-structural protein NS5A should be considered as promising candidate to be studied in detail for HCV induced insulin resistance and should be regarded as a therapeutically important target for the prevention of chronic liver diseases.

HSV-2-encoded miRNA-H4 Regulates Cell Cycle Progression and Act-D-induced Apoptosis in HeLa Cells by Targeting CDKL2 and CDKN2A.

MicroRNAs (miRNAs) encoded by latency-associated transcript are associated with both latent and acute stages of herpes simplex virus 2 (HSV-2) infection. In this study, miRNA-H4-5p and miRNA-H4-3p were ectopically expressed in HeLa cells to explore potential cellular targets of viral miRNAs and demonstrate their potential biological functions. The results showed that miRNA-H4-5p could reverse apoptosis induced by actinomycin D (Act-D) and promote cell cycle progression, but miRNA-H4-3p had no such obvious functions. Bioinformatics analysis, luciferase report assay, quantitative reverse transcription polymerase chain reaction (qRT-PCR), and Western blotting demonstrated that miRNA-H4-5p could bind to the 3'-untranslated region (UTR) of cyclin-dependent kinase inhibitor 2A (CDKN2A) and cyclin-dependent kinase-like 2 (CDKL2) to negatively regulate their expression. We verified that these two targeted genes were associated with cell apoptosis and cell cycle. Furthermore, in HeLa cells infected with HSV-2, we detected significantly reduced expression of CDKN2A and CDKL2 and demonstrated the negative regulation effect of miRNA-H4-5p on these two target genes. Our findings show that viral miRNAs play a vital role in regulating the expression of the host's cellular genes that participate in cell apoptosis and progression to reshape the cellular environment in response to HSV-2 infection, providing further information on the roles of encoded herpesvirus miRNAs in pathogen-host interaction.

Comprehensive innate immune profiling of chikungunya virus infection in pediatric cases

Chikungunya virus (CHIKV) is a mosquito‐borne alphavirus that causes global epidemics of debilitating disease worldwide. To gain functional insight into the host cellular genes required for virus infection, we performed whole‐blood RNA‐seq, 37‐plex mass cytometry of peripheral blood mononuclear cells (PBMCs), and serum cytokine measurements of acute‐ and convalescent‐phase samples obtained from 42 children naturally infected with CHIKV. Semi‐supervised classification and clustering of single‐cell events into 57 sub‐communities of canonical leukocyte phenotypes revealed a monocyte‐driven response to acute infection, with the greatest expansions in “intermediate” CD14++CD16+ monocytes and an activated subpopulation of CD14+ monocytes. Increases in acute‐phase CHIKV envelope protein E2 expression were highest for monocytes and dendritic cells. Serum cytokine measurements confirmed significant acute‐phase upregulation of monocyte chemoattractants. Distinct transcriptomic signatures were associated with infection timepoint, as well as convalescent‐phase anti‐CHIKV antibody titer, acute‐phase viremia, and symptom severity. We present a multiscale network that summarizes all observed modulations across cellular and transcriptomic levels and their interactions with clinical outcomes, providing a uniquely global view of the biomolecular landscape of human CHIKV infection.

Gene Profile Expression Related to Type I Interferons in HT-29 Cells Exposed to Cryptosporidium parvum

Background: Cryptosporidium parvum may contribute to upregulation or downregulation of host cellular genes among which type I (α, β) and type II (γ) interferons play key roles to eliminate infectious agents. Objectives: The current study aimed at evaluating the expressed genes related to human type I interferon response in HT-29 cell line after exposure to C. parvum for six and 24 hours. Methods: Subsequently, the overexpression and under expression of 84 human genes related to type I interferons were investigated using RT2Profiler™ PCR (polymerase chain reaction) Array. Results: Four top overexpressed genes including IL10, SH2D1A, MX1, and HLA-A after six hours exposure, and 10 top overexpressed genes as IL15, DDX58, CXCL10, NMI, MYD88, STAT3, IFNAR2, IFIH1, CASP1, and TLR3 were observed after 24 hours exposure. Five underexpressed genes such as TIMP1, TYK2, IRF2, PML and IRF5 were monitored for six hours. Conclusions: The current study findings revealed that the overexpressed genes IL15, TIMP1, and SH2D1A may have an important role to inhibit the invasion of C. parvum. Also, the overexpressed genes, namely SH2D1A, MX1, and NMI, may have antiviral properties while TIMP1 may have anticancer properties. Further, the pertinent results demonstrated that the type I interferons and the relevant genes had significant effects on stimulating innate immune system against C. parvum.

Expression and replication of virus-like circular DNA in human cells

The consumption of bovine milk and meat is considered a risk factor for colon- and breast cancer formation, and milk consumption has also been implicated in an increased risk for developing Multiple Sclerosis (MS). A number of highly related virus-like DNAs have been recently isolated from bovine milk and sera and from a brain sample of a MS patient. As a genetic activity of these Acinetobacter-related bovine milk and meat factors (BMMFs) is unknown in eukaryotes, we analyzed their expression and replication potential in human HEK293TT cells. While all analyzed BMMFs show transcriptional activity, the MS brain isolate MSBI1.176, sharing homology with a transmissible spongiform encephalopathy-associated DNA molecule, is transcribed at highest levels. We show expression of a replication-associated protein (Rep), which is highly conserved among all BMMFs, and serological tests indicate a human anti-Rep immune response. While the cow milk isolate CMI1.252 is replication-competent in HEK293TT cells, replication of MSBI1.176 is complemented by CMI1.252, pointing at an interplay during the establishment of persistence in human cells. Transcriptome profiling upon BMMF expression identified host cellular gene expression changes related to cell cycle progression and cell viability control, indicating potential pathways for a pathogenic involvement of BMMFs.

Transcription: Insights From the HIV-1 Promoter.

In this review, we cover transcription regulation of human immunodeficiency virus type 1 (HIV-1) gene expression, focusing on the invaluable contributions, made by HIV research over the years, toward the field of transcription. In this context, the HIV promoter can be considered to be a well-studied model promoter, which although a viral promoter, is subject to the same cellular regulatory mechanisms that modulate the transcriptional control of endogenous host cellular genes. The molecular control of HIV-1 transcription has been well studied and considerable knowledge toward development of alternative strategies for therapies aimed at eradicating both active but also latent HIV-1 has been obtained. Additionally, HIV-1 studies have provided insight into fundamental aspects of transcriptional regulation including transcriptional stochasticity, RNA polymerase II pausing, chromatin regulation of transcription, the role of the +1 nucleosome, the use of an RNA enhancer element, i.e., TAR, the discovery, and essential function of P-TEFb, and the super elongation complex in transcription elongation. These findings have been important not only in deciphering the mechanisms used by HIV-1 to regulate its gene expression and to establish and maintain HIV latency for therapeutic advancement, but were at the same time seminal in pushing the transcription field forward.

Latent HIV-1 TAR Regulates 7SK-responsive P-TEFb Target Genes and Targets Cellular Immune Responses in the Absence of Tat

The transactivating response element (TAR) structure of the nascent HIV-1 transcript is critically involved in the recruitment of inactive positive transcription elongation factor b (P-TEFb) to the promoter proximal paused RNA polymerase II. The viral transactivator Tat is responsible for subsequent P-TEFb activation in order to start efficient viral transcription elongation. In the absence of the viral transactivator of transcription (Tat), e.g., during latency or in early stages of HIV transcription, TAR mediates an interaction of P-TEFb with its inhibitor hexamethylene bis-acetamide-inducible protein 1 (HEXIM1), keeping P-TEFb in its inactive form. In this study, we address the function of HIV-1 TAR in the absence of Tat by analyzing consequences of HIV-1 TAR overexpression on host cellular gene expression. An RNA chimera consisting of Epstein-Barr virus-expressed RNA 2 (EBER2) and HIV-1 TAR was developed to assure robust overexpression of TAR in HEK293 cells. The overexpression results in differential expression of more than 800 human genes. A significant proportion of these genes is involved in the suppression of cellular immune responses, including a significant set of 7SK-responsive P-TEFb target genes. Our findings identify a novel role for HIV-1 TAR in the absence of Tat, involving the interference with host cellular immune responses by targeting 7SK RNA-mediated gene expression and P-TEFb inactivation.

Clonal Expansion of Human Immunodeficiency Virus-Infected Cells and Human Immunodeficiency Virus Persistence During Antiretroviral Therapy.

The latent HIV-1 reservoir in blood decays very slowly, even during prolonged suppression of viral replication by antiretroviral therapy (ART). Mechanisms for reservoir persistence include replenishment through low-level viral replication, longevity and homeostatic proliferation of memory T cells, and most recently appreciated, clonal expansion of HIV-infected cells. Clonally expanded cells make up a large and increasing fraction of the residual infected cell population on ART, and insertion of HIV proviruses into certain host cellular genes has been associated with this proliferation. That the vast majority of proviruses are defective clouds our assessment of the degree to which clonally expanded cells harbor infectious viruses, and thus the extent to which they contribute to reservoirs relevant to curing infection. This review summarizes past studies that have defined our current understanding and the gaps in our knowledge of the mechanisms by which proviral integration and clonal expansion sustain the HIV reservoir.

Methylation analysis and HPV genotyping of self-collected cervical samples from women not responding to screening invitation and review of the literature.

Aim of the studyTo assess the feasibility of partial HPV genotyping and methylation analysis of CADM1, MAL, and miR124-2 genes as triage tests in assaying self-collected cervical samples positive for high-risk HPV on primary screening, and to review the literature regarding host cellular gene methylation analysis of self-collected cervical samples.Material and methodsWomen residing in North-East Italy who had failed to respond to the invitation to participate in an organized population-based program were invited to provide a self-sample. Their stored baseline (self-collected) and follow-up (clinician-collected) cervical samples were included in the study. DNA was extracted from HPV-positive (Qiagen’s Hybrid Capture 2, HC2) samples. Partial genotyping with separate detection of HPV types 16 and 18 was performed with a hybrid capture-based method and a quantitative PCR assay. Methylation was assayed with a quantitative methylation-specific PCR.ResultsHigh-risk HPV infection was detected in 48% of baseline and 71% of follow-up HC2-positive samples. Methylation was demonstrated respectively in 15% and 23.5% of baseline and follow-up samples and chiefly involved a single gene (miR124-2). Invalid quantitative PCR results were recorded in 5% of self-collected samples. The specificity of miR124-1, MAL, and CADM1 methylation was 84%, 94%, and 98%, respectively, and the specificity of the three markers combined was 84%. Sensitivity was not estimated due to the lack of CIN2+ samples. The systematic review showed that different methylation assays yield different accuracy values.ConclusionSelf-collected samples are suitable for methylation assays included in reflex triage testing. The reproducibility and accuracy of the methylation tests described in the literature should be improved.

Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.

HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.

Marek’s disease virus immunosuppression alters host cellular responses and immune gene expression in the skin of infected chickens

Marek’s disease virus (MDV), a highly cell-associated lymphotropic α-herpesvirus, is the causative agent of Marek’s disease (MD) in domestic chickens. MDV replicates in chicken lymphocytes and establishes a latent infection within CD4+ T cells. The latently infected CD4+ T cells carry the virus to visceral organs, peripheral nerves, and feather follicle epithelium (FFE). FFE is the only anatomical site where infectious enveloped cell-free virus particles are produced and disseminated into the environment. This study investigated the immunological responses and mechanism of viral-induced immunosuppression and immune evasion in the FFE. Strong viral replication and lack of a significant number of cytotoxic T lymphocytes (CTL) in the infected tissues was prominent. Although the overall gene expression pattern was suggestive of a Th1 type immune response, the expression levels of several key immune genes were down regulated in the infected tissues. The mechanism of MDV-induced immunosuppression appears to be through inhibition of CTL function due to down regulation of CD8 glycoprotein and/or blocking of CTL migration due to decrease expression of cell adhesion molecules.

Making Bunyaviruses Talk: Interrogation Tactics to Identify Host Factors Required for Infection.

The identification of host cellular genes that act as either proviral or antiviral factors has been aided by the development of an increasingly large number of high-throughput screening approaches. Here, we review recent advances in which these new technologies have been used to interrogate host genes for the ability to impact bunyavirus infection, both in terms of technical advances as well as a summary of biological insights gained from these studies.

539. Screening for Recombinant Adeno-Associated Viral Vectors That Selectively Transduce Hepatitis B Virus Infected Cells

Hepatitis B is a disease caused by infection with the hepatitis B virus (HBV), a small enveloped DNA virus which belongs to the Hepadnaviridae family. Even though a safe and effective vaccine is available, HBV represents the ninth most common cause of death worldwide with an estimated 350 million chronically infected individuals. HBV infection can cause cirrhosis and hepatocellular carcinoma and currently there are 7 approved drugs for the treatment of HBV infection in the USA. These drugs decrease the risk of liver damage from HBV by slowing but not eliminating viral replication in most patients, possibly related to the persistence of integrated HBV genomes. Gene therapy using recombinant adeno-associated viral (rAAV) vectors constitute a promising tool to combat HBV infection as rAAV vectors have the ability to transduce and establish long-term and stable transgene expression in liver cells. Preclinical studies have successfully utilized rAAV vectors to combat viral infections after delivering short-hairpin RNA (shRNA) expression cassettes for knocking down viral coding or host genes required for viral replication and spread. Because promiscuous targeting of host cellular genes in the majority of non-infected cells may be detrimental, specific targeting of HBV-infected cells adds a new layer of potential therapeutic targets and safety. Thus we set out to identify new AAV capsids that selectively transduce HBV-infected cells. To do this, we created new AAV shuffled capsid libraries and used these for multiple rounds of infection in HBV-infected hepatoma cells. Each library is co-infected with wild-type Adenovirus-5 (helper virus) allowing the rAAV genomes to replicate in the HBV-infected cells. Isolation of replicating rAAV over successive passages in cultured cells allows for a more stringent selection as all steps in AAV transduction must occur. We have varied the screens using various multiplicity of infections (MOIs) of the library and/or utilized a pre-clearing step using a HBV negative hepatoma cell line. Several selected capsids derived from multiple parental capsids were vectorized. One capsid (AAV-GK4) was found to transduce the infected cells approximately 6 times more robustly than uninfected cells (using an MOI of 100 and 1,000). Interestingly, the same result was observed with AAV-DJ, a variant previously selected on human hepatoma cells. Additional screens and candidates are pending further evaluation. The possibility of finding new rAAV capsids with an increased transduction efficiency and selective tropism for HBV-infected cells will provide a reagent or therapeutic that can deliver a transgene that will allow one to selectively modify or potentially kill infected but not the uninfected cells contained within the liver.