Hippocampal Membranes Research Articles

Effect of phospholipase C and protein kinase C following cholinergic denervation and hippocampal sympathetic ingrowth in rat hippocampus

Following cholinergic denervation of the hippocampus by medial septal lesions, an unusual neuronal reorganization occurs in which peripheral adrenergic fibers arising from the superior cervical ganglia grow into the hippocampus (hippocampal sympathetic ingrowth). We have reported previously that cholinergic denervation and hippocampal sympathetic ingrowth differentially affected cholinergically stimulated phosphoinositide hydrolysis, concentration and affinity of muscarinic receptors, Go-protein level and protein kinase C activity. To complete these studies, we determined whether cholinergic denervation and hippocampal sympathetic ingrowth influenced phospholipase C and protein kinase C expression in dorsal hippocampal membranes and cytosol. Using immunoblotting methods, the results showed that the 100,000 mol. wt subunit of phospholipase Cβ was increased in the membrane fraction in the hippocampal sympathetic ingrowth group by 45% compared to controls and the 150,000 mol.wt subunit was increased by 75% and 59% compared to controls and cholinergic denervation, respectively. For protein kinase C detection, immunoblots were prepared using antibodies selective for “classical” protein kinase C members (α, β, γ) and for the “novel” protein kinase C subfamily members (δ, θ). Membrane protein kinase Cβ was decreased in hippocampal sympathetic ingrowth by 35% compared to controls and by 41% compared to cytosolic hippocampal sympathetic ingrowth. Membrane protein kinase Cβ was decreased in cholinergic denervation by 28% compared to controls. When compared to membranes from controls and the cholinergic denervation group, and to cytosolic fractions from the hippocampal sympathetic ingrowth groups, respectively, the following membrane protein kinase isoforms were found to be decreased by hippocampal sympathetic ingrowth: γ by 55%, 40% and 57%; δ by 91.5%, 70% and 120%; θ by 95%, 100% and 86%. In conclusion, our results may indicate the connection between the previously reported differential influence of hippocampal sympathetic ingrowth and cholinergic denervation on cholinergically stimulated phosphoinositol hydrolysis. The “normalization” of phosphoinositol hydrolysis found in hippocampal sympathetic ingrowth may be due to the increase in phospholipase Cβ expression in hippocampal sympathetic ingrowth membrane fractions. Since the activation of protein kinase C is known to block phosphoinositol hydrolysis, hippocampal sympathetic ingrowth “normalization” of phosphoinositol hydrolysis may result from a reduction in protein kinase expression in hippocampal sympathetic ingrowth membranes.

Synthesis of novel 5-substituted 3-amino-3,4-dihydro-2H-1-benzopyran derivatives and their interactions with the 5-HT1A receptor.

A series of new enantiomerically pure 3-amino-3,4-dihydro-2H-1-benzopyrans (3-aminochromans) has been synthesized from (R)- and (S)-5-methoxy-3-amino-3,4-dihydro-2H-1-benzopyran. The absolute configuration of the respective (R)- and (S)-enantiomers was deduced from X-ray crystallography of (R)-3-(N-isopropylamino)-5-methoxy-3,4-dihydro-2H-1-benzopyran, (R)-9a. Various 5-substituents were introduced via palladium-catalyzed carbonylation of N-substituted 3-amino-5-trifluoromethanesulfonyloxy-3,4-dihydro-2H-1-benzopyran. The effect of N- and 5-substitution on affinity for the 5-HT1A receptor was evaluated in competition experiments using rat hippocampal membranes and [3H]8-OH-DPAT as radioligand. Selected compounds were also tested for their affinity to the D1 (rat striatum), D2 (rat striatum), D2A (human cloned), and 5-HT2A (rat cortex) receptors. The intrinsic activity of the compounds was evaluated by measuring their effect on VIP-stimulated cAMP production in GH4ZD10 cells stably transfected with the 5-HT1A receptor. High-affinity compounds with high selectivity for the 5-HT1A receptor were found among structures substituted with carboxylate esters, amides, and ketones in the 5-position. Primary and secondary amines bound with lower affinity than tertiary amines. Larger substituents were well-tolerated by the receptor, but the smaller N-ethyl-N-isopropyl bound with lower affinity. Generally, the (R)-enantiomers displayed higher affinity for the 5-HT1A receptor than the corresponding (S)-enantiomers. In the present series of compounds, both full and partial agonists were found.

Characterization of SB-269970-A, a selective 5-HT(7) receptor antagonist.

The novel 5-HT(7) receptor antagonist, SB-269970-A, potently displaced [(3)H]-5-CT from human 5-HT(7(a)) (pK(i) 8.9+/-0.1) and 5-HT(7) receptors in guinea-pig cortex (pK(i) 8.3+/-0.2). 5-CT stimulated adenylyl cyclase activity in 5-HT(7(a))/HEK293 membranes (pEC(50) 7.5+/-0.1) and SB-269970-A (0.03 - 1 microM) inhibited the 5-CT concentration-response with no significant alteration in the maximal response. The pA(2) (8.5+/-0.2) for SB-269970-A agreed well with the pK(i) determined from [(3)H]-5-CT binding studies. 5-CT-stimulated adenylyl cyclase activity in guinea-pig hippocampal membranes (pEC(50) of 8.4+/-0.2) was inhibited by SB-269970-A (0.3 microM) with a pK(B) (8.3+/-0.1) in good agreement with its antagonist potency at the human cloned 5-HT(7(a)) receptor and its binding affinity at guinea-pig cortical membranes. 5-HT(7) receptor mRNA was highly expressed in human hypothalamus, amygdala, thalamus, hippocampus and testis. SB-269970-A was CNS penetrant (steady-state brain : blood ratio of ca. 0.83 : 1 in rats) but was rapidly cleared from the blood (CLb=ca. 140 ml min(-1) kg(-1)). Following a single dose (3 mg kg(-1)) SB-269970 was detectable in rat brain at 30 (87 nM) and 60 min (58 nM). In guinea-pigs, brain levels averaged 31 and 51 nM respectively at 30 and 60 min after dosing, although the compound was undetectable in one of the three animals tested. 5-CT (0.3 mg kg(-1) i.p.) induced hypothermia in guinea-pigs was blocked by SB-269970-A (ED(50) 2.96 mg kg(-1) i.p.) and the non-selective 5-HT(7) receptor antagonist metergoline (0.3 - 3 mg kg(-1) s.c.), suggesting a role for 5-HT(7) receptor stimulation in 5-CT induced hypothermia in guinea-pigs. SB-269970-A (30 mg kg(-1)) administered at the start of the sleep period, significantly reduced time spent in Paradoxical Sleep (PS) during the first 3 h of EEG recording in conscious rats.

Oxidative stress and HNE conjugation of GLUT3 are increased in the hippocampus of diabetic rats subjected to stress

Recent studies demonstrate that cellular, molecular and morphological changes induced by stress in rats are accelerated when there is a pre-existing strain upon their already compromised adaptive responses to internal or external stimuli, such as may occur with uncontrolled diabetes mellitus. The deleterious actions of diabetes and stress may increase oxidative stress in the brain, leading to increases in neuronal vulnerability. In an attempt to determine if stress, diabetes or stress+diabetes increases oxidative stress in the hippocampus, radioimmunocytochemistry was performed using polyclonal antisera that recognize proteins conjugated by the lipid peroxidation product 4-hydroxy-2-nonenal (HNE). Radioimmunocytochemistry revealed that HNE protein conjugation is increased in all subregions of the hippocampus of streptozotocin (STZ) diabetic rats, rats subjected to restraint stress and STZ diabetic rats subjected to stress. Such increases were not significant in the cortex. Because increases in oxidative stress may contribute to stress- and diabetes-mediated decreases in hippocampal neuronal glucose utilization, we examined the stress/diabetes mediated HNE protein conjugation of the neuron specific glucose transporter, GLUT3. GLUT3 immunoprecipitated from hippocampal membranes of diabetic rats subjected to stress exhibited significant increases in HNE immunolabeling compared to control rats, suggesting that HNE protein conjugation of GLUT3 contributes to decreases in neuronal glucose utilization observed during diabetes and exposure to stress. Collectively, these results demonstrate that the hippocampus is vulnerable to increases in oxidative stress produced by diabetes and stress. In addition, increases in HNE protein conjugation of GLUT3 provide a potential mechanism for stress- and diabetes-mediated decreases in hippocampal neuronal glucose utilization.

Outgrowth-promoting molecules in the adult hippocampus after perforant path lesion.

Lesion-induced neuronal plasticity in the adult central nervous system of higher vertebrates appears to be controlled by region- and layer-specific molecules. In this study we demonstrate that membrane-bound hippocampal outgrowth-promoting molecules, as present during the development of the entorhino-hippocampal system and absent or masked in the adult hippocampus, appear 10 days after transection of the perforant pathway. We used an outgrowth preference assay to analyse the outgrowth preference of axons from postnatal entorhinal explants on alternating membrane lanes obtained from hippocampus deafferented from its entorhinal input taken 4, 10, 20, 30 and 80 days post-lesion and from adult control hippocampus. Neurites from the entorhinal cortex preferred to extend axons on hippocampal membranes disconnected from their entorhinal input for 10 days in comparison with membranes obtained from unlesioned adult animals. Membranes obtained from hippocampi disconnected from their entorhinal input for 10 days were equally as attractive for growing entorhinal cortex (EC) axons as membranes from early postnatal hippocampi. Further analysis of membrane properties in an outgrowth length assay showed that entorhinal axons extended significantly longer on stripes of lesioned hippocampal membranes in comparison with unlesioned hippocampal membranes. This effect was most prominent 10 days after lesion, a time point at which axonal sprouting and reactive synaptogenesis are at their peak. Phospholipase treatment of membranes obtained from unlesioned hippocampi of adult animals strongly promoted the outgrowth length of entorhinal axons on these membranes but did not affect their outgrowth preference for deafferented hippocampal membranes. Our results indicate that membrane-bound outgrowth-promoting molecules are reactivated in the adult hippocampus following transection of the perforant pathway, and that neonatal entorhinal axons are able to respond to these molecules. These findings support the hypothesis of a temporal accessibility of membrane-bound factors governing the layer-specific sprouting of remaining axons following perforant path lesion in vivo.

Ibotenic acid-induced lesions of the medial septum increase hippocampal membrane associated protein kinase c activity and reduce acetylcholine synthesis: prevention by a phosphatidylcholine/vitamin b 12 diet

Ibotenic acid infusion into the medial septum (MS) results in biochemical alterations in the hippocampus. The biochemical events involved in this neuronal lesion are poorly understood. We investigated the effect of a purified diet supplemented with egg phosphatidylcholine (PC) and vitamin B 12 on ibotenic acid-medicated biochemical changes in the rat hippocampus and crude synaptosomal membranes. Male Wistar rats with this MS lesion were fed a purified diet (control diet) or a purified diet supplemented with 5.7 g PC and 125 μg vitamin B 12 per 100 g (experimental diet) for 18 days. Sham-operated rats were fed the control diet. Compared with the sham-operated rats, MS-lesioned rats fed the control diet showed increased activity of membrane-bound protein kinase C (PKC), decreased activity of choline acetyltransferase, and decreased concentrations of acetylcholine in the hippocampus. The ratio of cholesterol to phospholipid in the crude synaptic membrane was lower in the lesioned rats than in the sham-operated rats, but this was not accompanied by any alteration in membrane lipid fluidity. MS-lesioned rats fed the experimental diet showed lowered PKC activity and elevated acetylcholine concentrations than did rats fed the control diet, but there were no significant effects on choline acetyltransferase activity and the lipid ratio. The ibotenic acid-mediated elevation of PKC activity was observed as early as 2 days postinjury in the control diet-fed rats but not in the experimental diet-fed rats. We propose that ibotenic acid mediates pathophysiologic actions through the activation of PKC and that PC combined with vitamin B 12 ameliorates the second messenger-mediated injury.

Pharmacological characterization of a novel AVP(4-9) binding site in rat hippocampus.

pGlu-Asn-Cys (Cys)-Pro-Arg-Gly-NH(2) (AVP(4-9)), a major metabolite C-terminal fragment of Arginine(8)-vasopressin (AVP), improves the disruption of the learning and memory, and is a far more potent in the mnemonic function than AVP. In this study, we pharmacologically characterized its putative binding site and mechanism of intracellular signaling. Radioligand binding assay showed that [35S]AVP(4-9) could detect specific binding sites in the rat hippocampus membrane preparations, and the binding site was specifically displaced by AVP(4-9) but not by either V(1) or V(2) antagonists. Furthermore, [35S]AVP(4-9) could not detect the cloned rat V(1a), V(1b) and V(2) vasopressin receptors. Even at a low doses (10-100 pM), AVP(4-9) caused an increase in both inositol(1,4, 5)-trisphosphate (Ins(1,4,5)P(3)) and intracellular calcium concentrations ([Ca(2+)](i)) in rat hippocampal cells. The AVP(4-9)-induced [Ca(2+)](i) increase was partially inhibited by the absence of Ca(2+) or by Ca(2+)-channel blocker, suggesting that AVP(4-9) caused the [Ca(2+)](i) increase via release from intracellular calcium store as well as influx from extracellular calcium. For the first time, this study provides evidence to show that AVP(4-9) activates Ins(1,4,5)P(3)/[Ca(2+)](i) pathway through a novel type of receptor in rat hippocampus, which might be potentially important in improving the mnemonic function.

Effect of inhibitory avoidance training on [3H]-glutamate binding in the hippocampus and parietal cortex of rats.

Glutamate receptors have been implicated in memory formation. The aim of the present study was to determine the effect of inhibitory avoidance training on specific [3H]-glutamate binding to membranes obtained from the hippocampus or parietal cortex of rats. Adult male Wistar rats were trained (0.5-mA footshock) in a step-down inhibitory avoidance task and were sacrificed 0, 5, 15 or 60 min after training. Hippocampus and parietal cortex were dissected and membranes were prepared and incubated with 350 nM [3H]-glutamate (N = 4-6 per group). Inhibitory avoidance training induced a 29% increase in glutamate binding in hippocampal membranes obtained from rats sacrificed at 5 min (P<0.01), but not at 0, 15, or 60 min after training, and did not affect glutamate binding in membranes obtained from the parietal cortex. These results are consistent with previous evidence for the involvement of glutamatergic synaptic modification in the hippocampus in the early steps of memory formation.

Effects of Pertussis Toxin and Gα-Protein-Specific Antibodies on Phosphoinositide Hydrolysis in Rat Brain Membranes after Cholinergic Denervation and Hippocampal Sympathetic Ingrowth

Cholinergic denervation of the hippocampal formation, via medial septal lesions, induces peripheral noradrenergic fibers, originating from the superior cervical ganglion, to grow into the hippocampus. We have previously reported that cholinergic denervation and hippocampal sympathetic ingrowth differentially affect guanosine-5′-O-(3-thiotriphosphate)- as well as guanosine-5′-O-(3-thiotriphosphate) + carbachol-stimulated polyphosphoinositide hydrolysis, suggesting an alteration in G proteins and/or the entire receptor complex. To examine the type of G protein which may be involved in these effects, rat dorsal hippocampal membranes were preincubated with pertussis toxin in the presence of guanosine-5′-O-(3-thiotriphosphate) and guanosine-5′-O-(3-thiotriphosphate) + carbachol. Pertussis toxin reduced guanosine-5′-O-(3-thiotriphosphate) in all groups, while guanosine-5′-O-(3-thiotriphosphate) + carbachol-stimulated phosphoinositide hydrolysis was reduced in controls and animals without sympathetic ingrowth but not in animals with hippocampal sympathetic ingrowth. This suggests that pertussis toxin-sensitive G proteins may be involved in the mediation of phosphoinositide hydrolysis. To confirm this hypothesis, membranes were preincubated with antibodies to Gαo and Gq/11. The Go antibody significantly decreased guanosine-5′-O-(3-thiotriphosphate) in all groups, while guanosine-5′-O-(3-thiotriphosphate) +carbachol-stimulated phosphoinositide hydrolysis was reduced only in hippocampal sympathetic ingrowth. Impairment of guanosine-5′-O-(3-thiotriphosphate) and carbachol-stimulated phosphoinositide hydrolysis was also decreased in all groups when preincubated with Gq/11 antibody. To determine whether hippocampal sympathetic ingrowth or cholinergic denervation altered the concentration of various G proteins, immunoblotting methodology was utilized. Gq/11 concentrations were found to be equivalent among groups. The density of Go1, Go2, and Go3 isoforms was significantly increased in the cholinergic denervation, while in the hippocampal sympathetic ingrowth only group Go3 was significantly increased. When assessed as total Go protein, density was increased significantly only in the cholinergic denervation group. Overall, these results suggest that hippocampal sympathetic ingrowth and cholinergic denervation induce alterations in phosphoinositide hydrolysis through both the Gq/11 and the Go proteins and that the coupling between muscarinic receptor and G protein is the possible site which affects changes in phosphoinositide turnover. Our results also suggest that cholinergic denervation and hippocampal sympathetic ingrowth may mediate phosphoinositide hydrolysis through an effect on different isoforms of the same G protein.

Inactivation of 5-HT 1A receptors in hippocampal and cortical homogenates

5-HT 1A receptor function can be assessed in rat hippocampal and cortical membrane preparations as agonist-stimulated [ 35S]GTPγS binding. Membranes were preincubated in vitro with N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ). R(+)-8-hydroxy-2-(di- n-propylamino)tetralin [ R(+)-8-OH-DPAT]-stimulated [ 35S]GTPγS binding and [ 3H]8-OH-DPAT binding assays were used to assess 5-HT 1A receptor function and density, respectively. EEDQ decreased both R(+)-8-OH-DPAT-stimulated [ 35S]GTPγS and [ 3H]8-OH-DPAT binding in hippocampal and cortical membranes. The E max but not the EC 50 of R(+)-8-OH-DPAT to stimulate [ 35S]GTPγS binding was decreased by EEDQ in both preparations. Additionally, the IC 50 for EEDQ to reduce R(+)-8-OH-DPAT-stimulated [ 35S]GTPγS and [ 3H]8-OH-DPAT binding was the same for both brain regions in both assays. In contrast to EEDQ alone, agonist-stimulated [ 35S]GTPγS binding was not reduced in hippocampal membranes preincubated with EEDQ and the 5-HT 1A receptor antagonist N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]- N-2-pyridinyl-cyclohexanecarboxamide maleate (WAY 100,635), suggesting that EEDQ acts directly on the receptor. Due to parallel reductions in receptor density and maximal functional response, it is concluded that there is little or no reserve for 5-HT 1A receptor coupling to G α in these preparations. In addition, the sensitivity of hippocampal and cortical 5-HT 1A receptors to inactivation by EEDQ in vitro is the same.

Densitometric analysis of Galphao protein subunit levels from postmortem Alzheimer disease hippocampal and prefrontal cortical membranes.

An immunoblotting method using prefrontal cortical and hippocampal membranes from control and Alzheimer disease postmortem brains was employed to detect three subtypes of Galphao protein. In the membranes from control subjects, the density of Galphao1 in hippocampus and cortex was the highest, whereas the density of Galphao2 was the lowest and that of Galphao3 was intermediate. In the Alzheimer disease membranes from hippocampus, the density of total Galphao and all three subtype forms was not changed significantly when compared with control values. There were statistically significant alterations in Galphao in cortical membranes from Alzheimer disease when compared with controls. The density of Galphao1 was decreased by approximately 85%, density of Galphao3 was decreased by approximately 95%, and total Galphao density was decreased by approximately 84% of control value. However, Galphao2 density was decreased by approximately 44% but was found not to be statistically different from controls.

Interaction of adenosine and guanine derivatives in the rat hippocampus: effects on cyclic AMP levels and on the binding of adenosine analogues and GMP.

Guanine nucleotides (GN) have been implicated in many intracellular mechanisms. Extracellular actions, probably as glutamate receptor antagonists, have also been recently attributed to these compounds. GN may have a neuroprotective role by inhibiting excitotoxic events evoked by glutamate. Effects of extracellular GN on adenosine-evoked cellular responses have also been reported. However, the exact mechanism of such interaction is not known. In the present study, we showed that GN potentiated adenosine-induced cAMP accumulation in slices of hippocampus from young rats. However, neither GMP nor the metabotropic glutamate receptor agonist, 1S,3R-ACPD, inhibited the binding of the adenosine receptor agonist [3H]NECA (when binding to adenosine A2 receptors), or the binding of the adenosine A2a receptor agonist [3H]CGS 21680 in hippocampal membrane preparations. GppNHp, probably by interacting with G-proteins, decreased [3H]CGS 21680 binding. [3H]GMP binding was assayed in order to evaluate the GN sites which are not G-proteins. [3H]GMP binding was inhibited by GMP and GppNHp, but not by IS,3R-ACPD. The interaction of endogenous adenosine with the GMP-binding sites was determined by incubating membranes in the presence or absence of adenosine deaminase (ADA). NECA, CADO, CGS 21680 and CPA (only at the highest concentration used) increased GMP binding in the presence of ADA. However, in the absence of ADA, the control levels of GMP binding were as high as in the presence of added ADA plus adenosine agonists, indicating that endogenous adenosine modulates the binding of GMP. If this site has a neuroprotective role, adenosine may be increasing its neuromodulator and proposed protective action.

Structure-affinity relationships of C-terminal cyclic analogue of neuropeptide Y for the Y1-receptor.

We previously reported that a cyclic octapeptide amide, c[D-Cys29, Cys-34]NPY Ac-29-36 (YM-42454) showed a high affinity for Y1-receptors in SK-N-MC cells (Ki=0.047,microM) but not for Y2-receptors in the porcine hippocampus membranes (Ki>10microM). To explore the critical residues of this unique cyclic peptide for Y1-binding activity, the structure-affinity relationships were investigated by means of amino acid replacement. The results indicated that the hydrophobic side-chains of Leu30 and Ile31, the guanidinium groups of Arg33 and Arg33, and the C-terminal amide are critical for the binding affinity of YM-42454 to the Y1-receptor. On the other hand, Thr32 in YM-42454 might not be critical for the Y1-binding affinity. 1H-NMR studies for YM-42454 and its derivatives have suggested that the critical residues are involved in the direct interaction with a Y1-receptor rather than in maintaining the bioactive conformation.

Correlation between low/high affinity ratios for 5-HT 1A receptors and intrinsic activity

G protein-coupled receptors exist in G protein-coupled and -uncoupled forms that exhibit high and low affinity for agonists, respectively. Consequently, affinity differences of a compound for the high vs. the low affinity state of a receptor have been used to estimate its intrinsic activity at that receptor. We examined the affinity of a series of compounds for 5-hydroxytryptamine 1A (5-HT 1A) receptor sites labeled with 0.2 nM [ 3H](±)-8-hydroxy-2-(di- n-propylamino)tetralin ([ 3H]8-OH-DPAT) (high affinity), or with 0.25 nM [ 3H]4-(2′-methoxy-)-phenyl-1-[2′-( N-2″-pyridyl)- p-fluorobenzamido]ethyl-piperazine ([ 3H] p-MPPF) in the presence of 100 μM guanylylimidodiphosphate (Gpp(NH)p) (low affinity) in rat hippocampal membranes. For a variety of 5-HT 1A receptor ligands, the low/high affinity ratio (ranging from 110 for 5-HT to 0.12 for spiperone) was in good agreement with their reported intrinsic activity. Positive rank correlations were found between low/high affinity ratios and intrinsic activities ( E max values) reported in the literature. The high efficacy 5-HT 1A receptor agonists, 1[2-(4-fluorobenzoylamino)ethyl]-4-(7-methoxynaphtyl)piperazine (S-14506) and dihydroergotamine, however, had similar, high affinity for both G protein-coupled and -uncoupled forms of the receptor. The Hill coefficients for both compounds were markedly higher than 1.0, suggesting that positive cooperativity could be responsible for the unexpected results. The 5-HT 1A receptor agonist activity of dihydroergotamine and S-14506, assessed by measuring the inhibition of forskolin-stimulated cAMP accumulation, was blocked completely by pertussis toxin, reinforcing the suggested involvement of an inhibitory G protein in their effects. Taken together, the results suggest that, although the low/high affinity ratio of a ligand for 5-HT 1A receptors generally covaries with its intrinsic activity, dihydroergotamine and S-14506 may interact with 5-HT 1A receptors in a manner different from that of other 5-HT 1A receptor agonists. Their effects, however, appear to be G i protein-dependent.

Regulation of GTPase and adenylate cyclase activity by amyloid β-peptide and its fragments in rat brain tissue

Modulation of GTPase and adenylate cyclase (ATP pyrophosphate-lyase, EC 4.6.1.1) activity by Alzheimer's disease related amyloid β-peptide, Aβ(1–42), and its shorter fragments, Aβ(12–28), Aβ(25–35), were studied in isolated membranes from rat ventral hippocampus and frontal cortex. In both tissues, the activity of GTPase and adenylate cyclase was upregulated by Aβ(25–35), whereas Aβ(12–28) did not have any significant effect on the GTPase activity and only weakly influenced adenylate cyclase. Aβ(1–42), similar to Aβ(25–35), stimulated the GTPase activity in both tissues and adenylate cyclase activity in ventral hippocampal membranes. Surprisingly, Aβ(1–42) did not have a significant effect on adenylate cyclase activity in the cortical membranes. At high concentrations of Aβ(25–35) and Aβ(1–42), decreased or no activation of adenylate cyclase was observed. The activation of GTPase at high concentrations of Aβ(25–35) was pertussis toxin sensitive, suggesting that this effect is mediated by G i/G o proteins. Addition of glutathione and N-acetyl- l-cysteine, two well-known antioxidants, at 1.5 and 0.5 mM, respectively, decreased Aβ(25–35) stimulated adenylate cyclase activity in both tissues. Lys-Aβ(16–20), a hexapeptide shown previously to bind to the same sequence in Aβ-peptide, and prevent fibril formation, decreased stimulation of adenylate cyclase activity by Aβ(25–35), however, NMR diffusion measurements with the two peptides showed that this effect was not due to interactions between the two and that Aβ(25–35) was active in a monomeric form. Our data strongly suggest that Aβ and its fragments may affect G-protein coupled signal transduction systems, although the mechanism of this interaction is not fully understood.

ZM 241385, an adenosine A 2A receptor antagonist, inhibits hippocampal A 1 receptor responses

4-(2-[7-amino-2-(2-furyl{1,2,4}-triazolo{2,3 a}-{1,3,5}triazin-5-yl-amino]ethyl)phenol (ZM 241385) has been used as an antagonist of adenosine A 2A receptors, exhibiting high selectivity over adenosine A 1 receptors. We now report that ZM 241385 (10–50 nM) attenuated the inhibitory action of N 6-cyclopentyladenosine (10 nM) and R(−)- N 6-phenylisopropyladenosine (R-PIA, 20 nM), two selective adenosine A 1 receptor agonists, on hippocampal population spike amplitude. This effect is unlikely to be a direct antagonism of adenosine A 1 receptor since the K i of ZM 241385 to displace [ 3H]PIA (2 nM) binding, from hippocampal membranes ranged from 0.8 to 1.9 μM. These results question the usefulness of ZM 241385 to define adenosine A 2A receptors actions in functional studies.

CB1 receptor density and CB1 receptor-mediated functional effects in rat hippocampus are decreased by an intracerebroventricularly administered antisense oligodeoxynucleotide.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

5-CT stimulation of adenylyl cyclase activity in guinea-pig hippocampus: evidence for involvement of 5-HT7 and 5-HT1A receptors.

1. A number of compounds, including the selective 5-HT7 receptor antagonist SB-258719, were investigated for their effect on [3H]-5-carboxamidotryptamine (5-CT) radioligand binding and 5-CT-stimulated adenylyl cyclase activity in guinea-pig hippocampal membranes, in order to confirm the presence of functionally coupled 5-HT7 receptors in this tissue. 2. The [3H]-5-CT radioligand binding profile was consistent with binding predominantly to 5-HT7 receptors. The affinity of SB-258719 (pKi 7.2+/-0.1) was similar to its reported human 5-HT7 receptor affinity. 3. In the adenylyl cyclase functional assay, 5-CT was a potent and full agonist compared to 5-HT, whereas 8-hydroxy-dipropylaminotetralin (8-OH-DPAT) was a partial agonist (intrinsic activity 0.4+/-0.1). The rank order of potency for agonists (5-CT>5-HT approximately 8-OH-DPAT) was consistent with activation of 5-HT7 receptors. SB-258719 (5 microM) and methiothepin (1 microM) surmountably antagonized the response to 5-CT, consistent with competitive antagonism. The pKB for SB-258719 (7.2+/-0.1) was in good agreement with its reported antagonist potency at the human cloned 5-HT7 receptor. 4. In the functional assay, WAY-100635 (100 nM) and cyanopindolol (1 microM) induced a biphasic 5-CT response curve, consistent with selective antagonism of a component of the response to 5-CT. The estimated pKB values for WAY-100635 and cyanopindolol (9.6 and 8.4 respectively) were in good agreement with their reported 5-HT1A receptor affinities. 5. The data are consistent with the presence of 5-HT7 receptors in guinea-pig hippocampus which are positively coupled to adenylyl cyclase. In addition, 5-HT7 receptor-mediated stimulation of adenylyl cyclase activity in this tissue appears to be augmented by a mechanism involving 5-HT1A receptor activation.

Piracetam reverses hippocampal membrane alterations in Alzheimer's disease.

The in vitro effects of piracetam treatment on the fluidity of membranes from the hippocampus of Alzheimer's Disease patients (AD) and non-demented controls were studied. Hippocampal membranes of AD patients showed a significant lower hydrocarbon core fluidity compared with membranes from elderly non-demented controls. Preincubation with piracetam enhanced the hydrocarbon core fluidity of hippocampal membranes from AD-patients as well as elderly controls in a concentration depending fashion, although the effect was more pronounced for the AD membranes. In the presence of piracetam, the difference of the membrane fluidity between AD and control membranes was not longer apparent.

Kainate receptors coupled to G(i)/G(o) proteins in the rat hippocampus.

Kainate receptors are a subtype of ionotropic glutamate receptors, permeable to cations and thus expected to have an excitatory depolarizing action on neurons. However, kainate receptor activation inhibits gamma-aminobutyric acid release in the hippocampus through activation of protein kinase C in a pertussis toxin-dependent manner, suggesting a coupling of kainate receptors to G proteins. Thus, we directly investigated the G protein coupling of kainate receptors in the rat hippocampus by using a selective kainate receptor agonist, [(3)H](2S,4R)-4-methylglutamate ([(3)H]MGA). [(3)H]MGA bound to a single site to hippocampal membranes with a K(D) value of 32 nM and a B(max) value of 1024 fmol/mg protein. This binding likely represents kainate receptors because it was displaced by domoate (K(i) = 4 nM), kainate (K(i) = 11 nM), and 6-cyano-7-nitroquinoxaline-2,3-dione (K(i) = 1.4 microM), but not by alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionate (K(i) > 10 microM), (RS)-alpha-methyl-4-phosphonophenylglycine (K(i) > 10 microM), or (+/-)-1-aminocyclopentane-trans-1,3-dicarboxylic acid (K(i) > 10 microM). Guanylylimidodiphosphate (30 microM), which uncouples all G protein-coupled receptors, shifted to the right the saturation curve of [(3)H]MGA (K(D) = 133 nM). This effect was mimicked by pretreatment of hippocampal membranes with modifiers of G(i)/G(o) proteins [30 microM N-ethylmaleimide (K(D) = 98 nM) or 25 microgram/ml pertussis toxin (K(D) = 95 nM)] but not by a modifier of G(s) proteins [50 microgram/ml cholera toxin (K(D) = 32 nM)]. Treatment of solubilized hippocampal membranes with pertussis toxin (25 microgram/ml) decreased [(3)H]MGA affinity (K(D) = 105-113 nM), which was recovered by reconstitution of these pretreated solubilized hippocampal membranes with G(i)/G(o) proteins (K(D) = 41-76 nM). These results indicate that hippocampal kainate receptors are coupled to G(i)/G(o) proteins.