Restriction Endonucleases HindIII Research Articles

Antibiotic resistance and distribution of SodCI, sopE, sefA genes among Salmonella enteric serotype Enteritidis isolates from poultry

Present work aimed to examine the antibiotic resistance of the Salmonella enterica serotype Enteritidis (SE) isolates from poultry, to study the plasmid-mediated ampicillin resistance and to detect and determine the distribution of sodCI, sopE and sefA genes. Thirty-five SE isolates from one-day chicks, layers and broilers were studied for susceptibility/resistance to sixteen antimicrobial agents; 23 (65.7%) of them showed resistance to ampicillin, 5 (14.3%) to ampicillin and tetracycline, 4 (11.45%) to tetracycline and 1 (2.9%) isolate showed multi-drug resistance. Ampicillin (AmpR) and ampicillin/tetracycline (AmpRTeR) resistance was easily transferred by conjugation, and all isolates except two possessed a common band. The molecular mass of the plasmid carrying ampicillin resistance was approximately determined at 41kb after DNA digestion with BamHI, HindIII, EcoRI, EcoRV and PstI restriction enzymes and ligation of EcoRI fragments to pET29c. For the detection of TEM-1 or/and TEM-2 ß-lactamases, two pairs of primers were used in a polymerase chain reaction (PCR). The PCR products showed the presence of blaTEM-1 gene in all isolates. The presence of SodCI, sopE, sefA genes was also examined by PCR. Twenty-two (62,8%) isolates carried the sodCI gene, thirty-four (97,2%) isolates carried the sopE gene and all isolates carried the sefA fimbrial locus.

Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of Campylobacter jejuni and Campylobacter coli Isolated From Animal Samples

Background: Several genetic mechanisms are used by Campylobacter spp. to achieve pathogenesis. One of the involved virulence factors is lipooligosacharide-associated genes, which are related to ganglioside mimicry by Campylobacter species. Objectives: The current study was conducted to determine the genetic diversity of 3 LOS-associated genes among Campylobacter jejuni and C. coli isolated from animal fecal samples. Methods: One hundred broiler, cattle, and sheep fecal C. jejuni and C. coli isolates, which had been collected previously from Shiraz slaughterhouses and had been formerly identified by polymerase chain reaction (PCR) reactions, were used in the present study. Campylobacter species were subjected to detect wlaN, cgtB, and waaC genes. The PCR products of three LOS-genes were subjected for restriction fragment length polymorphism (RFLP) using HindIII and AluI restriction enzymes in separate reactions. The most prevalent RFLP patterns in the combination of 2 enzymes were subjected for sequencing and sequence analysis software. Results and Conclusions: Patterns of RFLP for PCR products of all 69 wlaN and 29 cgtB genes were similar yet among 86 waaC gene PCR products, 6 different RFLP patterns were obtained. In conclusion, PCR-RFLP analysis demonstrated considerable variation in gene content and overall sequence heterogeneity in the animal-associated C. jejuni and C. coli LOS biosynthesis genes.

Haplotypes and polymorphism in the CCR5 gene in sickle cell disease.

Sickle cell disease shows several clinical manifestations in distinct levels of severity. This heterogeneity is due to the haplotype variability associated with the HbS gene, levels of fetal hemoglobin and environmental conditions, which modify the disease expression. Science community believes that the presence of a polymorphism in the CCR5 gene, which is related to chronic inflammatory state, could confer a higher survival rate and a lower number of inflammatory events to these patients since the deletion in CCR5Δ32 would knock out the CCR5 gene. Therefore, this study aimed to identify the haplotypes in βS and βC genes, as well as to investigate the presence of the CCR5Δ32 deletion in patients with sickle cell disease. For this purpose, DNA was isolated with the QIAamp DNA Investigator Kit, and PCR was the method chosen to detect the mutant allele CCR5Δ32. The haplotypes in βS and βC genes were detected by RFLP with the restriction enzymes XmnI, HindIII, HincII, and HinfI analyzing six polymorphic sites on the β cluster, succeeded by electrophoresis. The atypical haplotype was the most common (54.3%), followed by Benin (28.6%), Bantu (11.5%), Senegal (2.8%), and Cameroon (2.8%). No patients presented CCR5Δ32 deletion. The increase in the frequency of atypical haplotypes suggests that these patients passed by variation in the genetic pattern from ancestral haplotypes throughout the years.

IDENTIFIKASI KERAGAMAN GEN BMPR-1B (Bone Morphogenetic Protein Receptor IB) PADA AYAM ARAB,AYAM KAMPUNG DAN AYAM RAS PETELUR MENGGUNAKAN PCR-RFLP

BMPR-1B gene closely related to the rate of ovulation and follicular maturation. In poultry, BMPR-1B gene is located on chromosome 14th consists of 13 exons. BMPR-1B was expressed in the granulosa cells of the ovary and teca interna poultry. BMPR-1B was able to accelerate the maturation of the follicles so that the ova produced increasingly. BMPR-1B gene diversity was associated with poultry production. DNA isolation was performed using GeneJET Genomic DNA Purification Kit from blood samples derived from 28 native chickens, 20 layer chickens and 10 arab layer chickens. A total of 58 DNA were used as a template in the process of BMPR-IB gene amplification using Polymerase Chain Reaction method. Primers used in this study according to Zhang et al. (2008), Forward primer 5 'ATG GCT GGG AAG TCT GGA TG 3'dan Reverse primer 5' TGC CTT CTG TGT TAA CCG C 3 'with a length of 581 bp. This primary amplify BMPR-1B gene segment from exon 6 to exon 7 including the entire intron 6 with an annealing temperature of 58 0 C. BMPR-IB gene diversity was detected using restriction enzymes HindIII were incubated for 2 hours. The results of the study was showed that Hind III restriction enzymes do not cut the BMPR-1B gene segments in the population of native chickens, arab layer chickens and layer chickens, they were monomorphic.

Assessment of polymorphisms in mysostatin gene and their allele substitution effects showed weak association with growth traits in Iranian Markhoz goats

SUMMARYPolymorphisms in the myostatin (MSTN) gene were detected in 150 female Iranian Markhoz goats. Two 573 base pairs (bp) and 475 bp fragments of the MSTN gene, which contains a deletion 5 bp indel (206 TTTTA/), in the region of exon 1 encoding the 5′ untranslated region (UTR) of the MSTN transcript, and two single-nucleotide polymorphisms (SNPs) of substitution (339T/A, 169T/G) in exon 1 and 3 regions, respectively, were amplified. The polymerase chain reaction (PCR) products were digested separately using restriction enzyme endonuclease DraI, HinIII and HindIII. The digestion results indicated AA and AB genotypes in the region of exon 1 encoding the 5′UTR of the MSTN transcript, AA, AT and TT genotypes in exon 1 and TT, TG and GG genotypes in exon 3. The SNPs loci were in Hardy–Weinberg disequilibrium but the deletion locus showed equilibrium in the Markhoz goat population. Evaluation of associations between the polymorphisms with the studied growth traits showed that the AA and GG genotypes of exons 1 and 3 have a significant positive effect on weight at 6 months of age (W6) and average daily gain (ADG) traits, but genotypes in the region of exon 1 encoding the 5′UTR of the MSTN transcript did not have any significant effect on the studied growth traits. The statistical analyses showed a positive and significant effect of the 339A allele (exon 1) for W6 and negative and significant effect of the 169G allele (exon 3) for ADG trait. Therefore, these results suggest that the MSTN gene could be a potential candidate gene that affects ADG and W6 traits in goats. More studies are needed to simultaneously consider variants of this region in a larger population to better understand MSTN gene effects on the economic traits in goat.

Polymorphisms of kappa-casein gene and their effects on milk production traits in Holstein, Jersey and Brown Swiss cattle

The objectives of this study were to detect kappa-casein (κ-CN, CSN3, CASK) gene polymorphisms and to investigate the association between the κ-CN gene polymorphisms and milk yield and composition in cattle. For this purpose, a total of 365 blood and milk samples were collected from Holstein, Jersey and Brown Swiss cows. Polymorphisms of κ-CN gene were detected by the PCR and restriction fragment length polymorphism. A 776-bp fragment of exon IV was amplified by PCR and digested with HindIII and HaeIII restriction endonuclease to distinguish allele A, B and E. The analysis of associations between κ-CN genotypes and milk yield and composition were conducted with the use of the general linear model procedure. As a result, allele frequencies were detected as 0.736, 0.357, 0.308 for A allele, 0.186, 0.643, 0.692 for B allele in Holstein, Brown Swiss and Jersey breeds, respectively, and 0.079 for E allele in Holstein. This study also demonstrated the presence of E allele in Turkish Holstein. Although κ-CN genotypes were associated with protein and solids-not-fat content of milk in Hostein and Brown Swiss, they were associated with milk fat content in Jerseys (P < 0.05).

Expression, purification and kinetic characterization of recombinant benzoate dioxygenase from Rhodococcus ruber UKMP-5M.

In this study, benzoate dioxygenase from Rhodococcus ruber UKMP-5M was catalyzed by oxidating the benzene ring to catechol and other derivatives. The benzoate dioxygenase (benA gene) from Rhodococcus ruber UKMP-5M was then expressed, purified, characterized, The benA gene was amplified (642 bp), and the product was cloned into a pGEM-T vector. The recombinant plasmid pGEMT-benA was digested by double restriction enzymes BamHI and HindIII to construct plasmid pET28b-benA and was then ligated into Escherichia coli BL21 (DE3). The recombinant E. coli was induced with 0.5 mM isopropyl β-D-thiogalactoside (IPTG) at 22˚C to produce benzoate dioxygenase. The enzyme was then purified by ion exchange chromatography after 8 purification folds. The resulting product was 25 kDa, determined by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting. Benzoate dioxygenase activity was found to be 6.54 U/mL and the optimal pH and temperature were 8.5 and 25°C, respectively. Maximum velocity (Vmax) and Michaelis constant (Km) were 7.36 U/mL and 5.58 µM, respectively. The end metabolite from the benzoate dioxygenase reaction was cyclohexane dione, which was determined by gas chromatography mass spectrometry (GC-MS).

Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y.enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y.enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y.enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y.enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y.enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y.enterocolitica.

Association of C677T MTHFR and G20210A FII prothrombin polymorphisms with susceptibility to myocardial infarction

Myocardial infarction (MI) is a common complex pathology, localized in the main leading causes of mortality worldwide. It is the result of the interaction of genetic and environmental factors. The aim of the present study was to investigate the potential association of C677T 5,10-methylenetetrahydrofolate reductase (MTHFR) (rs1801133) and G20210A factor II prothrombin (FII) (rs1799963) polymorphisms with the susceptibility of MI. Following extraction by the standard salting-out procedure, DNA samples of 100 MI patients and 182 apparently healthy controls were genotyped by polymerase chain reaction-restriction fragment length polymorphism using HinfI and HindIII restriction enzymes, respectively. The results show a significant association of the G20210T FII polymorphism with the MI risk. The frequencies of the heterozygote genotype GA, homozygous mutated AA and the G20210A allele was higher among patients compared to controls (GA: 59 vs. 5.5%, P<0.001; AA: 10 vs. 0%, P=0.003; and 20210A: 39.5 vs. 2.7%, P<0.003), suggesting that this polymorphism may be a potential genetic marker for MI. No significant association was observed between the C677T MTHFR and MI occurrence, and there was more heterozygote CT in the patient group compared to the controls. As a multifactorial disease, the development of MI may be the result of numerous factors that influence synergistically its occurrence. Thus, further studies are merited to try to better assess these associations (gene-gene and gene-environment interactions).

Expression of Recombinant Sugarcane Streak Mosaic Virus Coat Protein Gene in Escherichia coli

Sugarcane streak mosaic virus (SCSMV) is an important virus causing mosaic disease in sugarcane and transmitted through the cutting cane. Commercial antiserum to detect SCSMV and to monitor the disease development is not available. The research was conducted to produce antigen of SCSMV coat protein (SCSMV-CP) through overexpressing it on bacterial expression which will be used for antiserum production. SCSMV-CP was amplified using specific primers for CP gene containing BamHI and HindIII restriction enzyme sites and cloned into pTZ57R/T. Subsequently, the SCSMV-CP was subcloned into pET28a and transformed on Escherichia coli BL21(DE3) and Rosetta-gami(DE3)pLysS. The concentration of isopropyl β-d-thiogalactopyranoside (IPTG), incubation temperature, and bacterial harvesting time after IPTG induction were optimized. SCSMV-CP gene was successfully amplified with size ±855 bp, subcloned into vector expression, and expressed in insoluble fraction either in both bacterial host. Optimal protein expression of SCSMV-CP recombinant was obtained at 25°C with IPTG concentration 0.25–1.00 mM and harvested at 9–12 hours after IPTG induction in E. coli BL21(DE3), and at 30°C with IPTG concentration 0.25–1.00 mM and harvested 3–12 hours after IPTG induction in E. coli Rosetta(DE3)pLysS. SDS-PAGE analysis showed that protein size of SCSMV-CP recombinant was ±35.4 kDa.

Sin Nombre hantavirus nucleocapsid protein exhibits a metal-dependent DNA-specific endonucleolytic activity

We demonstrate that the nucleocapsid protein of Sin Nombre hantavirus (SNV-N) has a DNA-specific endonuclease activity. Upon incubation of SNV-N with DNA in the presence of magnesium or manganese, we observed DNA digestion in sequence-unspecific manner. In contrast, RNA was not affected under the same conditions. Moreover, pre-treatment of SNV-N with RNase before DNA cleavage increased the endonucleolytic activity. Structure-based protein fold prediction using known structures from the PDB database revealed that Asp residues in positions 88 and 103 of SNV-N show sequence similarity with the active site of the restriction endonuclease HindIII. Crystal structure of HindIII predicts that residues Asp93 and Asp108 are essential for coordination of the metal ions required for HindIII DNA cleavage. Therefore, we hypothesized that homologous residues in SNV-N, Asp88 and Asp103, may have a similar function. Replacing Asp88 and Asp103 by alanine led to an SNV-N protein almost completely abrogated for endonuclease activity.

PCR-RFLP and Sequencing of trnS/trnfM Fragment of Enhalus acoriodes from Sanur Coastal Waters, Bali, Indonesia: A Preliminary Study

This study aimed to evaluate the resolution of PCR-RFLP and sequencing of trnS/trnfM in detecting genetic diversity of seagrass Enhalus acoroides at Sanur Beach, Sindhu Beach and Semawang Beach. This research used six samples E. acoroides from each location. DNA extraction method followed Doyle and Doyle. PCR amplifications were done using primers P672/P673, P674/P675 and ITS4/ITS5 followed by digestion using restriction enzymes EcoRI, PstI, HindIII, BamHI, Rsa, Mva and HinfI. Sequencing analysis used PCR products of primers trnS/trnfM. Testing of DNA sequences of E. acoroides were conducted using BLAST (Basic Local Alignment Search Tool). DNA sequences were further analyzed using MEGA 5.2 software (Molecular Evolutionary Genetic Analysis) to evaluate variations of DNA. The sequence alignments were done using ClustalW software to determine the homology between the DNA sequences. The results showed that 18 samples of E. acoroides from Sanur, Sindhu and Semawang Beach have no polymorphism based on restriction enzyme analyses. Furthermore, sequencing of trnS/trnfM region of 18 samples E. acoroides showed that the sequences were identical.

Plasmid Profiles of Virulent Rhodococcus equi Strains Isolated from Infected Foals in Poland.

Rhodococcus equi is an important bacterial pathogen in foals up to 6 months old, widespread in horse farms all over the world. It was found that only virulent R. equi strains expressing 15–17 kDa virulence-associated protein (VapA) and having large virulence plasmid of 85–90 kb containing vapA gene are pathogenic for horses. To date, 12 plasmid types have been reported in VapA positive strains from horses. There are no data concerning plasmid types of Polish field R. equi strains isolated from horses and horse farm environment. The aim of the study is to determine plasmid profiles of virulent R. equi strains isolated in Poland from dead foals as well as from soil samples taken from horse breeding farms. Plasmid profiles of 10 clinical strains derived from 8 farms and 11 environmental strains from 3 farms, confirmed as virulent by PCR, were compared with 12 reference strains containing the known plasmid size and type. Plasmid DNAs were analysed by digestion with the restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII for detailed comparison and estimation of plasmid sizes. The results of RFLP analysis revealed that all except one isolates used in the study are classified as VapA 85 kb type I plasmid. One strain harboured VapA 87 kb type I plasmid. This is the first report of plasmid types of Polish field R. equi strains. The results of our preliminary investigations on horse farms located in central and eastern Poland indicate that the virulent R. equi strains thus far isolated from diseased foals and horse farms environment represent a highly uniform plasmid pattern.

Selection of polyvalent bacteriophages infecting Salmonella enterica serovar Choleraesuis

Background: Ideally, bacteriophages of pathogenic bacterial hosts should be polyvalent to be able to replicate in an alternative nonpathogenic bacterium. Thus, accidental infection by the original host can be avoided when bacteriophage lysates are used in biocontrol protocols. Results: From 15 wastewater samples, collected at different sites in the V Region in Chile, we selected three bacteriophages (FC, FP, and FQ) capable of productively infecting Salmonella enterica serovar Choleraesuis. By transmission electron microscopy (TEM) observation, the bacteriophages were found to belong to the order Caudoviridae. Molecular analyses indicated that FC, FP, and FQ contained double-stranded DNA genomes, of sizes similar to bacteriophage P22, and distinct recognition sites for the restriction endonucleases HaeIII and HindIII. Assays of host range revealed that the bacteriophages were polyvalent and thus capable of infecting different strains of Escherichia coli and other serovars of Salmonella . Conclusion: We have isolated new bacteriophages of the serovar Choleraesuis with various potential applications in relation to this pathogenic bacterium.

Description of Pseudomonas gregormendelii sp. nov., a Novel Psychrotrophic Bacterium from James Ross Island, Antarctica.

During the microbiological research performed within the scope of activities of Czech expeditions based at the Johann Gregor Mendel Station at James Ross Island, Antarctica, two psychrotrophic gram-stain negative non-fluorescent strains CCM 8506T and CCM 8507 from soil were extensively characterized using genotypic and phenotypic methods. Initial characterization using ribotyping with HindIII restriction endonuclease and phenotyping implies that both isolates belong to a single Pseudomonas species. Sequencing of rrs, rpoB, rpoD and glnA genes of strain CCM 8506(T) confirmed affiliation of investigated strains within the genus Pseudomonas. Further investigation using automated ribotyping with EcoRI (RiboPrinter(®) Microbial Characterisation System), whole-cell protein profiling using the Agilent 2100 Bioanalyzer system, extensive biochemical testing and DNA-DNA hybridization experiments confirmed that both investigated strains are members of a single taxon which is clearly separated from all hitherto described Pseudomonas spp. Based on all findings, we describe a novel species Pseudomonas gregormendelii sp. nov. with the type strain CCM 8506(T) (=LMG 28632T).

First Report of Macroptilium yellow spot virus in Desmodium glabrum in Brazil

HomePlant DiseaseVol. 100, No. 3First Report of Macroptilium yellow spot virus in Desmodium glabrum in Brazil Previous DISEASE NOTES OPENOpen Access licenseFirst Report of Macroptilium yellow spot virus in Desmodium glabrum in BrazilR. S. Fontenele, R. Poppiel, V. O. R. L. Matos, F. Costa, J. C. Faria, and S. G. RibeiroR. S. FonteneleSearch for more papers by this author, R. PoppielSearch for more papers by this author, V. O. R. L. MatosSearch for more papers by this author, F. CostaSearch for more papers by this author, J. C. Fariahttp://orcid.org/0000-0002-8125-7654Search for more papers by this author, and S. G. RibeiroSearch for more papers by this authorAffiliationsAuthors and Affiliations R. S. Fontenele R. Poppiel V. O. R. L. Matos , Embrapa Recursos Genéticos e Biotecnologia, Brasília, Brazil F. Costa , Instituto Agronômico de Pernambuco, Recife, Brazil J. C. Faria , Embrapa Arroz e Feijão, Goiânia, Brazil S. G. Ribeiro , Embrapa Recursos Genéticos e Biotecnologia, Brasília, Brazil. Published Online:29 Jan 2016https://doi.org/10.1094/PDIS-09-15-1086-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Macroptilium yellow spot virus (MaYSV) is a begomovirus (family Geminiviridae) described infecting common beans (Phaseolus vulgaris) and other leguminous noncultivated hosts in northeastern Brazil (Ramos-Sobrinho et al. 2014; Silva et al. 2012). In a recent virus survey in common beans and associated noncultivated plants in the state of Pernambuco, four Desmodium glabrum plants presenting yellow mosaic, leaf curling, rugosity, and leaf deformation symptoms were collected at the periphery of a bean field in Caruaru, in August 2013. Total DNA was extracted and a PCR reaction using universal degenerate begomovirus primers pAL1v1978 and pAR1c496 (Rojas et al. 1993) amplified fragments of the expected size of ∼1.2 kb. The sequences of the amplicons were nearly identical, and BLASTn comparisons suggested the infection of the four plants by MaYSV. To obtain full-length viral DNA components, genomic DNA from two samples was amplified by rolling-circle amplification (RCA) (Inoue-Nagata et al. 2004) and concatemer products were digested with HindIII and KpnI restriction enzymes rendering ∼2.6-kb fragments which were cloned into pBluescript II KS(+). Four independent DNA-A clones obtained from the two samples were sequenced using primer walking and had identities higher than 99% among them (GenBank Accession Nos. KT779561, KT779562, KT779564, and KT779565). Species Demarcation Tool (SDT) (v.1.0) (Muhire et al. 2014) analysis resulted in identities varying from 87 to 99% with DNA-A from different MaYSV isolates from common bean, lima bean, Macroptilium lathyroides, Calopogonium mucunoides, and Canavalia spp. collected in the states of Alagoas, Paraíba, and Sergipe (Silva et al. 2012), confirming that the D. glabrum plants were infected by MaYSV. DNA-B was amplified by PCR from total plant DNA using primers MaYSV-B-F (5′ACATACGTAATTGAAGACTGTTGGT3′) and MaYSV-B-R (5′ACGTACGTAGAGTCTCAGCGTGATG3′) overlapping in a SnabI restriction site present in most MaYSV DNA-B cloned in our laboratory. The resulting ∼2.6-kb PCR fragments were cloned into pTOPO2.1. Four DNA-B clones (KT779558, KT779559, KT779560, and KT779563) retrieved from the same plants from which DNA-A clones were obtained were completely sequenced. The DNA-B clones had identities ranging from 92 to 100% among them and shared 92 to 99% identity with genomic MaYSV DNA-B isolates from common bean and Macroptilium spp. Desmodium glabrum is a widely distributed neotropical plant occurring from Mexico to Argentina. In Brazil, D. glabrum can be found as invasive plants in northeastern, central, and southeastern regions in open fields, pasture areas, riparian forests, and also in anthropized and degraded areas. To date, MaYSV has been described only in Brazilian northeastern states; however, pervasive plants such as D. glabrum as well as other reported leguminous noncultivated MaYSV hosts may facilitate the spread of MaYSV to cultivated legume crops such as common bean and soybean in the main cultivated areas.

Functional screening for cellulolytic activity in a metagenomic fosmid library of microorganisms associated with coral.

Cellulases are enzymes that degrade cellulosic materials. Cellulose is the most abundant renewable carbon resource on Earth, and cellulases are used in various industrial sectors. Although cellulases are obtained from a variety of sources, this is the first description of cellulolytic activity isolated from a coral metagenomic library. A metagenomic fosmid library of microorganisms associated with the coral Siderastrea stellata, comprising 3552 clones, was screened for cellulolytic activity; this allows access to non-cultivable microorganisms by exploiting the full biotechnological potential. Clones were grown on LB agar plates supplemented with 0.5% carboxymethylcellulose and cellulase positive clones revealed by staining with Congo red. Using this approach, six positive clones with cellulolytic activity were identified. The enzymatic index (EI) of the positive clones was calculated by the ratio between the hydrolysis zone diameter and colony diameter. All positive clones had an EI greater than 1.5. Digestion of the DNA isolated from the six positive clones, using the HindIII restriction endonuclease, revealed different restriction patterns in each clone, indicating that the DNA of each clone is different. There is a growing interest for new cellulolytic enzymes in various industry sectors. Here, we present the initial selection of potential clones for cellulose degradation that could be targets for future studies of enzymatic characterization.

Overexpression of Salmonella enterica serovar Typhi recA gene confers fluoroquinolone resistance in Escherichia coli DH5α

A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α.

Cloning Gene Encoding Micronema 3 (Mic3) Protein of Tachyzoite Toxoplasma Gondii Local Isolate

Microneme 3 (MIC3) protein tachyzoites Toxoplasma gondii is one of protein which plays an important roleduring cell host invasion. Gene encoding MIC3 protein has been studied and it was suggested a potent vaccinecandidate against Toxoplasma gondii infection. The aim of this research is to clone and sequence the gene encodingMIC3 protein of tachyzoites Toxoplasma gondii local isolate by amplification using polymerase chain reaction withspecific primers. The amplified DNA fragment was cloned into pGEM-T and transformed into E. coli XL-1 Blue byheat shock method. Recombinant plasmids were isolated using alkali lysis method and analyzed by digestionusing restriction endonuclease enzymes PstI, HindIII, NcoI and EcoRV. The recombinant plasmids then sequencedto find out the nucleotide sequence of insert gene by ABIPRISM 377 DNA Sequencer. The DNA sequence thenwere analyzed by computer software for alignment. The result showed that transformation in E. coli XL-1 Blue bypGEM-T produced one clone that was encoding MIC3 protein. Analysis of 489 bp from 5’ and 447 from 3’ of genesequence showed 97-98% homology with gene encoding for MIC3 protein of RH isolate.Keywords: MIC3 protein, Toxoplasma gondii, tachyzoite, recombinant DNA

Molecular cloning and expression of MPT63 gene of Mycobacterium tuberculosis

The present investigation was undertaken to amplify, clone and express MPT63 gene of Mycobacterium tuberculosis to discern this secretary protein as a potent diagnostic and immunogenic antigen. Primer specific for MPT63 gene with restriction enzyme sites, viz BamHI and HindIII were designed. MPT63 gene was amplified using DNA from M. tuberculosis 198/94 (IVRI) strain, with designed primers by polymerase chain reaction (PCR). The 412 bp amplicon was purified and first cloned into pGEM-T vector. Positive clone was confirmed by colony PCR and restriction enzyme digestion. The pGEM-T released insert was ligated with BamHI and HindIII digested pET32b expression vector using T4 DNA ligase and transformed into Escherchia coli. Recombinant clones were selected by colony PCR and restriction enzyme digestion and induced with 1mM final concentration of Isopropylß- D-thiogalactopyranosidase (IPTG) for expression of the recombinant MPT63 protein. The expressed protein of 33 kDa was obtained during 2 h post induction. Western blot with Ni- NTA anti-histidine HRP conjugate and hyperimmune serum raised in rabbits confirmed the presence and purity of recombinant MPT63 protein by immuno reactivity at the unique 33 kDa region. Further confirmation of recombinant protein was done by dot blot and indirect ELISA using rabbit hyperimmune serum. The recombinant MPT63 protein was evaluated as a skin test antigen to produce delayed type hypersensitivity reaction in guinea pigs. Recombinant MPT63 protein produced skin erythema of 3 to 4 mm diameter in guinea pigs sensitized with killed M. tuberculosis and M. bovis culture. From the present study, it may be concluded that understanding of the immunogenic components of an infectious agent is essential through molecular characterization, in regard to the serological diagnosis, and the development of strategies for efficient immune protection and eradication of the disease.