Higher Prolactin Concentrations Research Articles

Identification of Novel 58-5p and SREBF1 Interaction and Effects on Apoptosis of Ovine Ovarian Granulosa Cell.

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1.

Prolactin-secreting pituitary adenomas: male-specific differences in pathogenesis, clinical presentation and treatment.

Prolactinomas (PRLomas) constitute approximately half of all pituitary adenomas and approximately one-fifth of them are diagnosed in males. The clinical presentation of PRLomas results from direct prolactin (PRL) action, duration and severity of hyperprolactinemia, and tumor mass effect. Male PRLomas, compared to females, tend to be larger and more invasive, are associated with higher PRL concentration at diagnosis, present higher proliferative potential, are more frequently resistant to standard pharmacotherapy, and thus may require multimodal approach, including surgical resection, radiotherapy, and alternative medical agents. Therefore, the management of PRLomas in men is challenging in many cases. Additionally, hyperprolactinemia is associated with a significant negative impact on men's health, including sexual function and fertility potential, bone health, cardiovascular and metabolic complications, leading to decreased quality of life. In this review, we highlight the differences in pathogenesis, clinical presentation and treatment of PRLomas concerning the male sex.

High Prolactin Concentration Induces Ovarian Granulosa Cell Oxidative Stress, Leading to Apoptosis Mediated by L-PRLR and S-PRLR.

High prolactin (PRL) concentration has been shown to induce the apoptosis of ovine ovarian granulosa cells (GCs), but the underlying mechanisms are unclear. This study aimed to investigate the mechanism of apoptosis induced by high PRL concentration in GCs. Trial 1: The optimal concentration of glutathion was determined according to the detected cell proliferation. The results showed that the optimal glutathione concentration was 5 μmol/mL. Trial 2: 500 ng/mL PRL was chosen as the high PRL concentration. The GCs were treated with 0 ng/mL PRL (C group), 500 ng/mL PRL (P group) or 500 ng/mL PRL, and 5 μmol/mL glutathione (P-GSH group). The results indicated that the mitochondrial respiratory chain complex (MRCC) I-V, ATP production, total antioxidant capacity (T-AOC), superoxide dismutase (SOD), and thioredoxin peroxidase (TPx) in the C group were higher than those in the P group (p < 0.05), while they were lower than those in the P-GSH group (p < 0.05). Compared to the C group, the P group exhibited elevated levels of reactive oxygen species (ROS) and apoptosis (p < 0.05) and increased expression of ATG7 and ATG5 (p < 0.05). However, MRCC I-V, ATP, SOD, A-TOC, TPx, ROS, and apoptosis were decreased after the addition of glutathione (p < 0.05). The knockdown of either L-PRLR or S-PRLR in P group GCs resulted in a significant reduction (p < 0.05) in MRCC I-V, ATP, T-AOC, SOD and TPx, while the overexpression of either receptor showed an opposite trend (p < 0.05). Our findings suggest that high PRL concentrations induce apoptotic cell death in ovine ovarian GCs by downregulating L-PRLR and S-PRLR, activating oxidative stress and autophagic pathways.

Effect of prolactin on cytotoxicity and oxidative stress in ovine ovarian granulosa cells.

Prolactin (PRL) has been reported to be associated with oxidative stress, which is an important contributor leading to cell apoptosis. However, little is known about the mechanisms underlying the effects of PRL on cytotoxicity and oxidative stress in ovine ovarian granulosa cells (GCs). Ovine ovarian GCs were treated with 0, 4, 20, 100 and 500 ng/mL of PRL. Then, the cytotoxicity, cell viability, malondialdehyde (MDA), reactive oxygen species (ROS), superoxide dismutase (SOD) and total antioxidant capacity (T-AOC) of GCs were detected. Additionally, 500 ng/mL PRL was chosen as the high PRL concentration (HPC) due to its high cytotoxicity and oxidative stress. Proteomic and metabonomic were performed to examine the overall difference in proteins and metabolic pathways between C (control: 0 ng/mL PRL) and P groups (500 ng/mL PRL). The results indicated that GCs treated with 4 ng/mL PRL significantly decreased (P<0.05) the cytotoxicity, ROS and MDA, increased (P<0.05) the cell viability, SOD and T-AOC, and the GCs treated with 500 ng/mL PRL showed the opposite trend (P<0.05). Supplementation with 500 ng/mL PRL significantly increased the proteins of MT-ND1, MAPK12, UBA52 and BCL2L1, which were enriched in ROS and mitophagy pathways. Pathway enrichment analysis showed that the pentose phosphate pathway was significantly enriched in the P group. A low concentration of PRL inhibited cytotoxicity and oxidative stress. HPC induced oxidative stress in ovine ovarian GCs via the pentose phosphate pathway by modulating the associated proteins MT-ND1 in ROS pathway and UBA52, MAPK12 and BCL2L1 in mitophagy pathway, resulting in cytotoxicity.

Prolactin Regulates Ovine Ovarian Granulosa Cell Apoptosis by Affecting the Expression of MAPK12 Gene.

Prolactin (PRL) has been reported to influence reproductive performance and cell apoptosis. However, its mechanism remains unclear. Hence, in the present study, ovine ovarian granulosa cells (GCs) were used as a cell model to investigate the relationship between PRL concentration and GC apoptosis, as well as its possible mechanisms. We examined the relationship between serum PRL concentration and follicle counts in sexually mature ewes. GCs were isolated from adult ewes and treated with different concentrations of PRL, while 500 ng/mL PRL was selected as the high concentration of prolactin (HPC). Then, we applied the transcriptome sequencing (RNA-Seq) combined with a gene editing approach to explore the HPC contributing to cell apoptosis and steroid hormones. The apoptosis of GCs gradually increased at PRL concentrations above 20 ng/mL, while 500 ng/mL PRL significantly decreased the secretion of steroid hormones and the expression of L-PRLR and S-PRLR. The results indicated that PRL regulates GC development and steroid hormones mainly through the target gene MAPK12. The expression of MAPK12 was increased after knocked-down L-PRLR and S-PRLR, while it decreased after overexpressed L-PRLR and S-PRLR. Cell apoptosis was inhibited and the secretion of steroid hormones increased after interfering with MAPK12, while the overexpression of MAPK12 showed the opposite trend. Overall, the number of follicles gradually decreased with increasing PRL concentration. HPCs promoted apoptosis and inhibited steroid hormone secretion in GCs by upregulating MAPK12 through reducing L-PRLR and S-PRLR.

Proinflammatory Activation of Osteoclasts Due to High Prolactin Level

High concentrations of prolactin (PRL) during the lactation period have an essential role in milk production by mammary glands stimulation. PRL may have an impact on calcium regulation and bone mineral density. We investigated if the PRL concentration during the lactation period could influence osteoclast (OC) activation and bone mineral density (BMD). In vivo, the Calcium Detection Assay, and ELISA were used to detect serum calcium, PRL, and inflammatory cytokines, respectively. BMD was evaluated by µ-CT in six months old female mice during lactation. The osteoclast (OC) activity was detected by Tartrate-resistant acid phosphatase (TRAP), Immunohistochemistry (IHC), and hematoxylin and eosin (H&amp;E). In vitro, osteoclast differentiation, resorption and their activity markers TRAP, Matrix metallopeptidase 9 (MMP-9), Cathepsin K (CTSK), C-reactive protein (CRP), Receptor activator of nuclear factor kappa-Β (RANK) and inflammatory cytokines were measured in osteoclasts stimulated with recombinant prolactin protein (rPRL) or with an anti-prolactin blocker. We found that serum calcium, PRL, and inflammatory markers were increased. BMD was significantly reduced in lactating mice; TRAP activity was increased and tubercular was reduced in lactating mice compared to normal mice. In vitro, the osteoclast number, resorption, and activation markers TRAP, MMP-9, CTSK, CRP, and RANK were significantly increased after treatment with rPRL protein, but not in osteoclasts treated with anti-prolactin receptor antibody and rPRL. The gene expression of TNF-α, IL-6, and Monocyte chemoattractant protein-1 (MCP-1) but not IL-1b were significantly increased in osteoclasts with PRL treatment compared to the untreated osteoclasts. Taken together, the high level of PRL could activate osteoclasts and proinflammatory cytokines expression which reduce BMD in the lactation period.

The effects of different physiologic concentrations of prolactin in association with reproductive hormones on the incidence of type 2 diabetes mellitus in men: Tehran Lipid and Glucose Study

BackgroundData is inconsistent and, for the most part, not sufficient to demonstrate the association between serum Prolactin (PRL) concentration within the physiologic range and the incidence rate of type 2 Diabetes Mellitus (DM) among men. Moreover, since both PRL and type 2 DM are associated with reproductive hormones, investigating these hormones might improve our understanding of how PRL might impose its effect on the incidence rate of type 2 DM.MethodsFor the present study, 652 eligible men aged 29–70 with a normal baseline PRL concentration were selected from the Tehran Lipid and Glucose Study (TLGS). Participants were sub-classified into three groups (tertiles) according to the serum concentration of PRL and were followed for 15.8 years. The incidence of type 2 DM and PRL, LH, FSH, testosterone, and AMH concentrations were measured. The effect of hormonal variables on the incidence of type 2 DM was estimated using the log-binomial model, adjusted for major confounding factors. The correlations between PRL and the indicators of glucose and lipid metabolism and other hormonal variables were also explored.ResultsIn the unadjusted model, PRL was not significantly associated with the incidence rate of type 2 DM (RR = 0.98, 95% CI: 0.94 − 1.03). After adjusting for potential confounders, the inverse effect of AMH on the incidence rate of type 2 DM was the only significant association. The analyses also indicated a significant positive association between PRL and LH/FSH ratio (r = 0.1, P = 0.01).ConclusionNo significant association was found between serum PRL concentrations within the physiologic range and the incidence rate of type 2 diabetes mellitus among middle-aged men. Men with higher concentrations of PRL within the physiologic range tended to show higher levels of LH and LH/FSH. AMH was the only variable significantly linked to the incidence rate of type 2 DM in men.

Kadar Hormon Prolaktin Pada Kambing Peranakan Ettawa,Sapera dan Saanen Pada Berbagai Status Fisiologi

This study examines the prolactin hormone profile in Etaawa, Sapera and Saanen lactating goats, adult females, pregnant does, and yearlings. This study used a total of 80 randomly selected goats with details of 26 Ettawa Crossbreed goats (eight lactating, six adult females, six pregnant, and six heifers), 32 Sapera goats (eight lactating, six adult females, twelve pregnant, and six yearlings) and 22 Saanen goats (five lactating, four adult females, six pregnant and yearling). All goats were declared clinically healthy. Blood sampling was performed through the jugular vein in each animal; then, serum was analyzed with an Enzyme-linked immunosorbent assay (ELISA) to prolactin concentration. High prolactin concentrations were found in Saanen goats in pregnant physiological status compared to Sapera and Ettawa crossbreed goats.

Analysis of LH Receptor Expression in the Testes of Infertile Azoospermic Non-Obstructive (NOA) Men at High Serum Prolactin Concentrations

Analysis of LH Receptor Expression in the Testes of Infertile Azoospermic Non-Obstructive (NOA) Men at High Serum Prolactin Concentrations

Prolactin immunoassay: does the high-dose hook effect still exist?

Measurement of prolactin in clinical laboratories is an important component in the management of patients with pituitary adenoma. Prolactin measurement is known to be sensitive to the high-dose hook effect, in the presence of extremely high prolactin concentrations. This interference is referred to in most recent articles discussing prolactin assays and the management of prolactin-secreting pituitary adenomas. The objective of our study was to evaluate if the high-dose hook effect remains relevant in current practice, when using currently available assays. Serum from a patient with a giant macroprolactinoma was assayed using all of the available prolactin assays in France in 2020, using native serum and after dilution. Technical inserts from assays were reviewed to assess the information on analytical principles, numbers of steps, and any reference to high dose hook effect. Fourteen assay kits were studied by 16 laboratories; all were two-site immunometric assays, mostly using one step (11/14). Results obtained after dilution varied from 17,900µg/L to 86,900µg/L depending on the assay used. One tested assay was sensitive to the high-dose hook effect leading to a falsely lower prolactin concentration when measuring native serum (150µg/L compared to 17,900µg/L after dilution). The high-dose hook effect still exists in a very small minority of prolactin assays. The evolution of assay methods may lead to new assays that remain sensitive to this effect in the future. We therefore advise that the hook effect should still be mentioned in prolactin assay recommendations.

Resolution of Visual Field Defect in Macroprolactinoma After Treatment With Cabergoline

We report the case of a 49-year-old woman presenting with amenorrhea and progressive visual field defect for one month. Endocrinological workup revealed a high concentration of serum prolactin, and magnetic resonance imaging (MRI) showed pituitary macroadenoma with extrasellar extension as well as compression of optic nerves. Treatment with a dopamine agonist, cabergoline, for eight weeks led to the resolution of the visual field defect accompanied by a rapid decrease in the serum prolactin level. Follow-up MRI three months after the initial diagnosis revealed alleviation of visible mechanical compression of the optic chiasm by the tumor. We considered that the absence of retinal nerve damage and prompt initiation of cabergoline contributed to the rapid recovery of the visual acuity.

High Prolactin Concentration Promote Apoptosis of Ovine Ovarian Gcs by Upregulating Mapk12 Expression Through L-Prlr and S-Prlr

High Prolactin Concentration Promote Apoptosis of Ovine Ovarian Gcs by Upregulating Mapk12 Expression Through L-Prlr and S-Prlr

Baseline and stress-induced prolactin and corticosterone concentrations in a species with female offspring desertion – The case of Whiskered Tern Chlidonias hybrida

To understand the proximate mechanisms regulating brood desertion, we studied hormonal and behavioural stress responses during the chick-rearing period in adult Whiskered Terns (Chlidonias hybrida), a socially monogamous, semi-precocial species with prolonged post-fledging parental care. In contrast to males, almost all females of this species desert during the chick-rearing and post-fledging periods. Because of the expected link between corticosterone, prolactin and parental investment, we hypothesized that males and females should differ in circulating prolactin and corticosterone concentrations. Baseline hormone concentrations did not differ between males and females. In both sexes, prolactin and corticosterone concentrations decreased and increased in response to acute stress (30 min after capture), respectively. Baseline and stress-induced prolactin concentrations decreased significantly in both sexes with advancing brood age. As expected, males had significantly higher stress-induced prolactin concentrations than females. None of the nine males released after being held in captivity for 24 h deserted, whereas four (29%) of the 14 females kept in captivity for 24 h did so. Altogether, these results suggest that higher prolactin concentrations may be involved in the maintenance of parental care under stress. However, there was no statistically significant difference in stress-induced hormone levels between males, females that deserted and those that returned to the nest after prolonged stress (24 h). Our data indicate that males are probably more resistant to stress as regards the continuation of parental care. The pattern of male and female behavioural and hormonal responses to stress partially predicts their behaviour in terms of natural desertion.

Peripheral Modulators of the Central Fatigue Development and Their Relationship with Athletic Performance in Jumper Horses.

Simple SummaryPhysical exercise induces various stress responses leading to a disturbance of homeostasis and a number of regulatory systems are called upon to return the body to a new level of equilibrium. The aim of this study was to evaluate the peripheral modulators of serotoninergic function and neurohumoral factors’ changes in athletic horses during an official jumping competition, and to evaluate their relationship with the physical performance of competing horses. The findings obtained in the current survey showed that jumping exercise influenced the levels of tryptophan, leucine, valine, non-esterified fatty acids (NEFAs), dopamine, and prolactin and that these changes are related to the physical performance of competing horses. These findings suggest that the serotoninergic system may be involved in fatigue during jumping exercise.The current study aimed to investigate whether peripheral modulators of serotoninergic function and neurohumoral factors’ changes in athletic horses during an official jumping competition, and to evaluate their relationship with the physical performance of competing horses. From 7 Italian Saddle mares (6–9 years; mean body weight 440 ± 15 kg), performing the same standardized warm-up and jumping course during an official class, heart rate (HR) was monitored throughout the competition. Rectal temperature (RT) measurement, blood lactate and glucose concentration, serum tryptophan, leucine, valine, the tryptophan/branched-chain amino-acids ratio (Try/BCAAs), dopamine, prolactin, and non-esterified fatty acids (NEFAs) were assessed before the exercise event (T0), at the end of the competition stage (5 min ± 10 s following the cessation of the exercise, TPOST5), and 30 min after the end of competition (TPOST30). Highest HR values were recorded during the course and at the outbound (p < 0.0001); blood lactate concentration and RT increased after exercise with respect to the rest condition (p < 0.0001). Lower leucine and valine levels (p < 0.01), and higher tryptophan, Try/BCAAs ratio, and NEFAs values were found at TPOST5 and TPOST30 with respect to T0 (p < 0.0001). A higher prolactin concentration was found at TPOST5 and TPOST30 compared to T0 (p < 0.0001), whereas dopamine showed decreased values after exercise compared to rest (p < 0.0001). Statistically significant correlations among the peripheral indices of serotoninergic function, neurohumoral factors, and athletic performance parameters were found throughout the monitoring period. The findings provide indirect evidence that the serotoninergic system may be involved in fatigue during jumper exercise under a stressful situation, such as competition, in which, in addition to physical effort, athletic horses exhibit more passive behavior.

EVALUATION OF HORMONAL FUNCTION IN WOMEN WITH CERVICAL INSUFFICIENCY AND INFERTILITY IN THE HISTORY

The aim: To assess the levels of hormones in women with cervical insufficiency and infertility in the history in the II trimester of gestation. Materials and methods: 120 pregnant women with cervical insufficiency and anovulatory infertility in the history were examined in the II trimester of gestation: in the I group (60 persons) pregnancy occurred after hormonal treatment of infertility, in the II group (60 individuals) – after in vitro fertilization. 30 pregnant women without cervical insufficiency and a history of infertility were controls. The levels of estradiol, progesterone, placental lactogen, prolactin and cortisol were determined in the blood serum. Results: The concentration of maternal progesterone was lower in the persons in the I group on 12.36 %, in the II group – on the 15.37 % (p=0.03) compared to the healthy women. Cortisol and prolactin amounts were statistically higher in I and II groups (p&lt;0.001) than in controls. While the levels of estradiol and placental lactogen were slightly less in the subjects with cervical insufficiency and a history of anovulatory infertility compared to the healthy women. Conclusions: In pregnant women with cervical insufficiency and a history of anovulatory infertility in the II trimester of gestation there are decrease progesterone level and high prolactin and cortisol concentrations in blood serum. The changes in estradiol and placental lactogen amounts are not significant compared to healthy women.

The association between prolactin concentration and aggression in female patients with schizophrenia

Objectives This study assessed the association between serum prolactin (PRL) concentration and aggression in female patients with schizophrenia. Methods Female patients with schizophrenia (N = 120) were diagnosed using SCID-5 based on the DSM-5 criteria. They were sampled at the University Psychiatric Hospital Vrapce during the period from March 2017 to March 2019. Aggression was evaluated using the Positive and Negative Syndrome Scale (PANSS), and Overt Aggression Scale (OAS). Patients were subdivided into aggressive and non-aggressive groups. PRL was determined in serum using electrochemiluminescence (ECLIA) method. Results Aggressive patients with schizophrenia had significantly (p < 0.0001) increased PRL concentration compared to non-aggressive patients. Higher PRL concentration was significantly (p < 0.0001) associated with pronounced aggressive symptoms determined by the OAS scores. When patients were subdivided into those who were treated with risperidone, haloperidol, paliperidone, amisulpride, and a group that was not treated with these antipsychotics, aggressive patients in both groups had significantly higher PRL concentrations than non-aggressive patients. Higher antipsychotic dose was related to increased PRL concentration (p = 0.004). Conclusions Our findings suggest that higher PRL is significantly associated with aggression, irrespective of the antipsychotic medication, in female patients with schizophrenia.

Lactation Versus Formula Feeding: Insulin, Glucose, and Fatty Acid Metabolism During the Postpartum Period.

Milk production may involve a transient development of insulin resistance in nonmammary tissues to support redistribution of maternal macronutrients to match the requirements of the lactating mammary gland. In the current study, adipose and liver metabolic responses were measured in the fasting state and during a two-step (10 and 20 mU/m2/min) hyperinsulinemic-euglycemic clamp with stable isotopes, in 6-week postpartum women who were lactating (n = 12) or formula-feeding (n = 6) their infants and who were closely matched for baseline characteristics (e.g., parity, body composition, and intrahepatic lipid). When controlling for the low insulin concentrations of both groups, the lactating women exhibited a fasting rate of endogenous glucose production (EGP) that was 2.6-fold greater and a lipolysis rate that was 2.3-fold greater than the formula-feeding group. During the clamp, the groups exhibited similar suppression rates of EGP and lipolysis. In the lactating women only, higher prolactin concentrations were associated with greater suppression rates of lipolysis and lower intrahepatic lipid and plasma triacylglycerol concentrations. These data suggest that whole-body alterations in glucose transport may be organ specific and facilitate nutrient partitioning during lactation. Recapitulating a shift toward noninsulin-mediated glucose uptake could be an early postpartum strategy to enhance lactation success in women at risk for delayed onset of milk production.

Prolactin concentrations predict parental investment and nest survival in a free-living shorebird

The hormonal milieu that exists during reproduction is one of the key factors influencing the trade-off between reproductive investment and self-maintenance. Much previous work in birds has focused on prolactin as a physiological mediator since prolactin is involved in the onset and maintenance of parental care. However, how prolactin relates to reproductive success in terms of altering parental behavior in wild bird populations is not fully understood. Here, we report prolactin concentrations in breeding Kentish plovers (Charadrius alexandrinus), a small shorebird with variable mating systems and parental care, as an ecological model of mating system evolution. Throughout the breeding season, we estimated the circulating prolactin concentrations in male and female plovers during incubation. In addition, we monitored parental behavior and determined the fate of nests. We found that prolactin concentrations decreased during incubation but increased with clutch completion date. In addition, males and females with high prolactin concentrations spent more time on incubation than those with low prolactin concentrations. Importantly, higher prolactin concentrations in either males or females predict higher nest survival. Our results suggest that prolactin is an indicator of parental behavior in a wild shorebird population, although additional studies including experimental manipulation of prolactin concentrations are necessary to verify this relationship.

1414-P: Prolactin as a Potential Modulator for the Adaption to Insulin Resistance in Pregnancy

Aims: Plasma prolactin levels are associated with insulin sensitivity and diabetes in an age dependent manner. Pregnancy is a state of physiologically high prolactin concentrations and insulin resistance. Only when beta cells fail to compensate by producing sufficient amounts of insulin, gestational diabetes mellitus (GDM) develops. We aimed to elucidate the relationship of prolactin levels, insulin sensitivity, and the incidence of GDM in pregnancy. Material and Methods: 321 women from the German Gestational Diabetes study were phenotyped with 5-point 75 g oral glucose tolerance tests during gestational weeks 27.1 ± 2.1 and repeatedly 1 to 10 years after delivery. Prolactin was measured in fasting state. Results: GDM was diagnosed in 29%. During pregnancy, physiologically high prolactin levels associated negatively with insulin sensitivity. By contrast, prolactin was positively associated with insulin sensitivity after delivery (pinteraction &amp;lt; 0.0001). Despite prolactin’s association with impaired insulin sensitivity in pregnancy, higher prolactin levels were neither associated with AUC-glucose0-120 nor GDM incidence (p&amp;gt;0.14). Prolactin interacted with AUC-glucose0-120 on insulin secretion (disposition index, p=0.01) with higher prolactin levels associating with improved insulin secretion in case of AUC-glucose0-120 above median (p=0.04). Conclusion: Our findings on countercurrent changes in insulin sensitivity and secretion with higher prolactin levels could indicate a role for this hormone in mounting and compensating for physiologic insulin resistance in pregnant women. Disclosure L. Fritsche: None. M. Heni: Research Support; Self; Boehringer Ingelheim International GmbH, Sanofi. Speaker's Bureau; Self; Lilly Diabetes, Merck Sharp &amp; Dohme Corp., Sanofi. H. Haering: None. A. Fritsche: None. R. Wagner: Other Relationship; Self; Lilly Diabetes, Novo Nordisk A/S. Funding German Federal Ministry of Education and Research (01GI0925)

Cellular and molecular mechanisms of low dose prolactin potentiation of testicular development in cockerels

The aim of this study was to determine the cellular and molecular mechanisms of prolactin (PRL) in testicular development of prepubertal cockerels. In an in vivo animal experiment, active immunization against PRL severely depressed prepubertal testicular development by significantly reducing testicular weights at both 122 and 164 d of age. The number of elongated spermatids in the seminiferous tubules was also significantly decreased by immunization with 199-residue chicken PRL (cPRL) at age 122 d. Inhibition of testicular development by cPRL immunization was associated with decreases in LH receptor (LHR), FSH receptor (FSHR), Stat5b, P450scc, steroidogenic acute regulatory (StAR) protein, and 3β-hydroxysteroid dehydrogenase (3β-HSD) mRNA expression levels in testicular tissue. In in vitro experiments, testosterone production by cultured Leydig cells isolated from prepubertal cockerel testes was dose-dependently enhanced by treatment with bioactive recombinant PRL, but a lesser response was seen with high concentrations of PRL. The distinct changes in testosterone production in response to high and low concentrations of added PRL were paralleled by similar patterns of change in the mRNA levels of Stat5b, LHR, P450scc, StAR, 3β-HSD, and CYP17A1 in cultured Leydig cells, as well as protein amounts of phosphorylated Jak2 and Stat5a/b. In conclusion, low to medium doses of PRL potentiate testis development in prepubertal cockerels by enhancing testosterone secretion from Leydig cells via activation of PRLR/Stat5b signal transduction, which upregulates mRNA expression of LHR and testosterone synthesizing enzymes. However, this positive regulation was weaker in response to a high dose of PRL, which reduced PRLR/Stat5b signal transduction and the expression of genes involved in LH signaling and testosterone synthesis.