High-throughput Small RNA Sequencing Research Articles

MicroRNAs as Biomarkers for Uveitis in Juvenile Idiopathic Arthritis

ABSTRACT Purpose Uveitis associated with juvenile idiopathic arthritis (JIA-U) is a clinically silent vision-impairing disease. Early detection and aggressive treatment are crucial for optimal visual outcome. Alterations in levels of microRNAs (miRNAs) are characteristic of autoimmune diseases. The present clinical study sought to explore the expression of miRNAs in JIA-U and their potential role as a predictive biomarker. Methods MiRNA expression profiling was performed on peripheral blood mononuclear cells derived from pediatric patients with JIA, JIA-U, or other types of uveitis using the high-throughput small-RNA sequencing (on Next Generation Sequencing (NGS)). Patient- and disease-related data were retrieved from the medical files. Main outcome measure was the differential expression of miRNAs among the groups. Results The cohort included 35 patients; 20 children with JIA-U (8 with active disease), 10 with JIA without ocular involvement, and 5 with other types of uveitis (4 with active disease). Mean age was 8.6 years; 83% were female. Nineteen patients (54%) received immunomodulatory treatment. The expression of miR-4485-3p was significantly increased in patients with JIA-U compared to patients with JIA alone (p < 0.05), with no difference between patients with active or inactive uveitis. The expression in patients with uveitis of other etiologies was similar to the expression in JIA-U patients. Conclusions This study demonstrates a differential expression profile of a specific miRNA in JIA patients with and without uveitis. If verified in larger studies, the findings may assist to identify JIA patients at risk to develop uveitis and to improve early detection of disease activity.

Sweet and sour cherry trees growing at new cultivar testing orchard and certified stock collection in Hungary are highly infected with CVA and PrVF

Hungary has a long tradition of sour cherry breeding. Clone selection for new cultivars with desirable traits recently replaced by classical breeding, and new cultivar candidates waiting for evaluations of their phenotypes are maintained at a testing orchard. The viral status of these new sour cherry cultivar candidates was tested using small-RNA high-throughput sequencing (HTS) as an unbiased diagnostic method. Moreover, the viromes of certified stock collections of sour cherry and sweet cherry growing in the vicinity of the testing orchard were also determined. Bioinformatic analysis of the sRNA HTS was validated using unbiased methods, revealing that the trees had very high rates of cherry virus A (CVA) and Prunus virus F (PrVF) infections. The latter virus was described in Hungary for the first time. While the stock collection was free from Prunus necrotic ringspot virus (PNRSV), this regulated virus was present at the testing orchard. As a follow-up study, the survey of the testing orchard was repeated after two years using RT-PCR with a detailed survey of the stock collection. The infection pattern of the viruses suggests the spread of PNRSV via pollen at the testing orchard, where the trees can bloom. Notably, the strains of both CVA and PrVF varied to a large extent. A low concentration of virus-derived small RNAs suggests that they do not induce strong antiviral RNAi, which could explain why their infections can be latent, without visible symptoms. However, to determine the impacts of frequent coinfections on fruit yield and tree health, which could be further altered by the changing climate, further investigations will be needed in the future.

Abstract B021: tRNA fragments extracted from patient plasma extra cellular vesicles display potential as biomarkers for high-grade glioma

Abstract Transfer RNA (tRNA) are non-coding RNAs that bring amino acids to ribosomes during translation. Recent studies have shown that cleaved fragments derived from tRNA (tRFs) serve regulatory roles in epigenetics, signaling, transcription, and translation. tRFs can be released from cells and can be found in extracellular vesicles to perform some aspects of paracrine signaling. Utilizing high throughput small RNA sequencing, we have identified over 750 uniquely or multi-mapped (6.9% of total sRNA mapped reads) tRFs in extracellular vesicles of high-grade glioma (IDH-WT) patient plasma. By performing differential expression analysis, we identified 6 upregulated tRFs and 36 downregulated tRFs between high-grade glioma plasma EVs and non-cancer controls (n = 14, FDR&amp;lt;0.05). Differentially expressed tRFs (all 42) were further analyzed using bioinformatic techniques (RNAhybrid and IntaRNA) to predict potential gene targets. By performing gene ontology analysis (ShinyGO) we found that 70 of 75 genes related to glioma formation were identified as potential gene targets, indicating a possible role of tRFs in the regulation and formation of gliomas. A number of differentially expressed tRFs were predicted to target cancer-related genes including Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT-1). This analysis demonstrates that tRFs may serve as important biomarkers and regulators with therapeutic potential in the future Citation Format: Thomson R Phinney, Ali Alwadei, Gabriel Gabriel Wajnberg, Jae Han, Simi Chacko, Kathleen Attwood, Jeremy Roy, Adriennne Weeks. tRNA fragments extracted from patient plasma extra cellular vesicles display potential as biomarkers for high-grade glioma [abstract]. In: Proceedings of the AACR Special Conference: Liquid Biopsy: From Discovery to Clinical Implementation; 2024 Nov 13-16; San Diego, CA. Philadelphia (PA): AACR; Clin Cancer Res 2024;30(21_Suppl):Abstract nr B021.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Characterization of small RNAs in the spleen of MASH in a non-human primate model

Metabolic dysfunction-associated steatotic liver disease (MASLD) and its advanced stage, metabolic dysfunction-associated steatohepatitis (MASH), are increasingly recognized as a global health issue. This study examines the role of small RNAs in the spleen of MASH using a non-human primate model. We performed high-throughput small RNA sequencing on spleen tissues from MASH-primates, revealing significant alterations in the expression of small non-coding RNAs, especially miRNAs. Notably, miR-96, miR-182, miR-183, and miR-122 showed differential expression in MASH spleens. Predictive and validation studies have identified potential target genes, such as PTX3 and NFIX, that were significantly dysregulated in spleens of MASH. These findings characterized small RNAs in spleen of MASH and offer a novel insight for further research for MASH.

Viromes of Monocotyledonous Weeds Growing in Crop Fields Reveal Infection by Several Viruses Suggesting Their Virus Reservoir Role.

In 2019, random samples of Panicum miliaceum growing as a weed were surveyed to uncover their virus infections at two locations in Hungary. This pilot study revealed infection with three viruses, two appearing for the first time in the country. As follow-up research, in the summer of 2021, we collected symptomatic leaves of several monocotyledonous plants in the same locations and determined their viromes using small RNA high-throughput sequencing (HTS). As a result, we have identified the presence of wheat streak mosaic virus (WSMV), barley yellow striate mosaic virus (BYSMV), barley virus G (BVG), and two additional viruses, namely Aphis glycines virus 1 (ApGlV1) and Ljubljana dicistrovirus 1 (LDV1), which are described for the first time in Hungary. New hosts of the viruses were identified: Cynodon dactylon is a new host of BYSMV and LDV1, Echinocloa crus-galli is a new host of BVG, ApGlV1 and LDV1, Sorghum halepense is a new host of ApGlV1, and Panicum miliaceum is a new host of LDV1. At the same time, Zea mays is a new host of ApGlV1 and LDV1. Small RNA HTS diagnosed acute infections but failed to detect persistent ones, which could be revealed using RT-PCR. The infection rates at the different locations and plant species were different. The phylogenetic analyses of the sequenced virus variants suggest that the tested monocotyledonous weeds can host different viruses and play a virus reservoir role. Viral spread from the reservoir species relies on the activity of insect vectors, which is why their management requires an active role in plant protection strategies, which need careful planning in the changing environment.

FlaHMM: unistrand flamenco-like piRNA cluster prediction in Drosophila species using hidden Markov models.

PIWI-interacting RNAs (piRNAs) are a class of small non-coding RNAs that are essential for transposon control in animal gonads. In Drosophila ovarian somatic cells, piRNAs are transcribed from large genomic regions called piRNA clusters, which are enriched for transposon fragments and act as a memory of past invasions. Despite being widely present across Drosophila species, somatic piRNA clusters are difficult to identify and study due to their lack of sequence conservation and limited synteny. Current identification methods rely on either extensive manual curation or availability of high-throughput small RNA sequencing data, limiting large-scale comparative studies. We now present FlaHMM, a hidden Markov model developed to automate genomic annotation of flamenco-like unistrand piRNA clusters in Drosophila species, requiring only a genome assembly and transposon annotations. FlaHMM uses transposable element content across 5- or 10-kb bins, which can be calculated from genome sequence alone, and is thus able to detect candidate piRNA clusters without the need to obtain flies and experimentally perform small RNA sequencing. We show that FlaHMM performs on par with piRNA-guided or manual methods, and thus provides a scalable and efficient approach to piRNA cluster annotation in new genome assemblies. FlaHMM is freely available at https://github.com/Hannon-lab/FlaHMM under an MIT licence.

Genome-Wide Identification of microRNAs Associated with Starch Biosynthesis and Endosperm Development in Foxtail Millet.

Foxtail millet is one of the oldest crops, and its endosperm contains up to 70% of starch. Grain filling is an important starch accumulation process associated with foxtail millet yield and quality. However, the molecular mechanisms of grain filling in foxtail millet are relatively unclear. Here, we investigate the genes and regulated miRNAs associated with starch synthesis and metabolism in foxtail millet using high-throughput small RNA, mRNA and degradome sequencing. The regulation of starch synthesis and quality is carried out mainly at the 15 DAA to 35 DAA stage during grain filling. The DEGs between waxy and non-waxy foxtail millet were significant, especially for GBSS. Additionally, ptc-miR169i_R+2_1ss21GA, fve-miR396e_L-1R+1, mtr-miR162 and PC-5p-221_23413 regulate the expression of genes associated with the starch synthesis pathway in foxtail millet. This study provides new insights into the molecular mechanisms of starch synthesis and quality formation in foxtail millet.

Longitudinal observation of tRNA-derived fragments profiles in gestational diabetes mellitus and its diagnostic value.

Gestational Diabetes Mellitus (GDM) poses significant risks to maternal and fetal health. Current diagnostic methods based on glucose tolerance tests have limitations for early detection. tRNA-derived small RNAs (tsRNAs) have emerged as potential molecular regulators in various diseases, including metabolic disorders. However, the diagnostic value of tsRNAs in plasma for early GDM or postpartum remains unclear. This longitudinal study profiled the expression of tsRNAs across different gestational stages and postpartum in women with GDM (n = 40) and healthy control gestational women (HCs, n = 40). High-throughput small RNA sequencing identified candidate tsRNAs, which were then validated and correlated with clinical biochemical markers such as fasting blood glucose (FBG), HOMA-IR, and GHbA1c. tRF-1:32-Val-AAC-1-M6, tRF-1:31-Glu-CTC-1-M2, and tRF-1:30-Gly-CCC-1-M4 were consistently upregulated in the GDM group compared to HCs during the second trimester (p < 0.05). Only tRF-1:31-Glu-CTC-1-M2 was highly expressed during the first trimester, and tRF-1:30-Gly-CCC-1-M4 increased during postpartum. tRF-1:31-Glu-CTC-1-M2 showed a significant correlation with FBG levels in the first trimester (R = 0.317, p = 0.047). The expression of tRF-1:30-Gly-CCC-1-M4 was significantly correlated with HOMA-IR (r = 0.65, p < 0.001) and GHBA1c (r = 0.33, p = 0.037) during postpartum. A joint diagnostic model incorporating tsRNAs expression and clinical markers demonstrated enhanced predictive power for GDM (ROC AUC = 0.768). Our results revealed distinct expression patterns of specific tsRNAs in GDM, showcasing their correlation with key metabolic parameters. This underscores their promising role as biomarkers for early prediction and diagnosis of GDM. The integration of tRFs into a composite biomarker panel holds the potential to improve clinical outcomes by enabling personalized risk assessment and targeted interventions.

BIOM-11. TUMOUR SUPPRESSIVE ROLES OF MIR-206 AND MIR-383 VIACORO1C ANDSV2B IN AGGRESSIVE PAEDIATRIC AND ADULT BRAIN MALIGNANCIES

Abstract Medulloblastoma (MB), the most prevalent brain malignancy in children, poses challenges in paediatric oncology due to its aggressiveness and potential for metastasis. Tailored treatment strategies are essential due to the impact of treatment-related toxicities and long-term side effects on children’s developing brains. This study aimed to identify therapeutic targets for paediatric MB and explore common biosignatures with glioblastoma multiforme (GBM), the most aggressive adult brain tumour. Total RNA and microRNAs (miRNAs) were extracted from eleven paediatric brain tissues (normal brain tissues, n=2; MB tumour tissue, n=8; pilocytic astrocytoma, n=1). High-throughput small-RNA sequencing (sRNA-seq) and transcriptomics were performed to identify the most deregulated miRNAs in paediatric MB tissue samples. Selected miRNAs, gene targets and encoded proteins were evaluated in vitro and ex vivo via real-time polymerase chain reaction (RT-qPCR), western blotting and immunohistochemistry (IHC). The sRNA-seq demonstrated that miR-383 and miR-206 were highly down regulated in MB samples suggesting their tumour suppressor properties. Bioinformatics analysis using miRSystem and TargetScan identified SV2B and CORO1C as their direct targets, respectively. Transcriptomics showed significant upregulation of SV2B and CORO1C in MB tissue samples. RT-qPCR analysis confirmed overexpression of SV2B and CORO1C within GBM cell lines and IHC depicted significant overexpression of SV2B and CORO1C proteins in paediatric MB and GBM patient cohorts (n=28) compared to their normal brain counterparts (n=32). Elevated CORO1C expression was also detected in adult MB (n=23) and GBM (n=73) tissue samples, when compared to normal brain tissue. Western blotting further verified the significant overexpression of CORO1C and SV2B within GBM cells, suggesting their role as potential oncoproteins. Collectively, our preliminary study proposes the clinical significance of miR-206 and miR-383 when overexpressed in the therapy of aggressive paediatric and adult brain malignancies.

Exploring miRNA-target modules in Paeonia lactiflora stamen petalization through integrated miRNAome, transcriptome, and degradome analysis

Variation in floral organ number in plants is triggered by extremely complex transcriptional and post-transcriptional regulatory processes. MicroRNAs (miRNAs) play a pivotal role in the post-transcriptional regulation of floral organs. Paeonia lactiflora Pall., originating from China, is a precious herbaceous plant with ornamental, medicinal, and oil properties. Building on previous transcriptional studies, this work examined post-transcriptional regulation of peony stamen petalization using critical-stage flower buds. Using high-throughput small RNA sequencing, a miRNA expression profile was constructed. This was used to identify 10 known, 334 conserved, and 255 novel miRNAs, 155, 151, and 44 of which were differentially expressed at three developmental stages (stamen primordium, stamen primordium partly petaloid, and stamen primordium completely petaloid). Degradome analysis identified 55 miRNAs and 127 potential target genes. A miRNA-target network suggested that miR172-PlRAP2, miR160-PlARF, miR396-PlGRF, miR319-PlTCP4, and miR384\\394-PlFBOX modules are key regulators of peony stamen petalization. The regulation of miR319 and PlTCP4 during peony flower development was validated through transient expression in tobacco. This study provides insight into miRNA-mediated regulation of petalized stamen formation in herbaceous peony and refines the post-transcriptional network at critical stages of this process.

Exosomal non-coding RNA exhibit sex-specific profiles in salt sensitive hypertension

Exosomes are secreted by various living cells and can be found in all body fluids, especially in cerebrospinal fluid (CSF) and plasma, thereby providing a source of biomarkers for cardiovascular diseases that can be used for patients’ diagnostic. Using high-throughput sequencing technologies, exosomes have been found to contain different RNA populations particularly non-coding RNA. Recently, many non-coding RNA have been recognized as key regulators in the progression of hypertension. In this study we hypothesized that female and male C57BI/6J mice exhibit different microRNA (miR) profiles after deoxycorticosterone acetate (DOCA)+salt hypertension treatment. CSF (10 μl) and plasma (100 μl) were collected from 3-month-old mice and again after 3 weeks of DOCA-salt treatment before exosomes isolation and processing for high throughput small RNA sequencing (Creative Biolabs). Analysis was performed using R language and RStudio ( https://rstudio.com/ ) as an integrated development environment. Global miRNA analysis of CSF exosomes shows different expression miRNA profiles in DOCA+salt male mice compared with their own baseline values. In addition, we observed a remarkable difference in global miRNA expression profile between DOCA+salt male mice and DOCA+salt females (p-value &lt; 2.2e-16), while no significant difference was detected between DOCA+salt females and their baseline values (p-value = 0.6679). Moreover, we observed that there are three clusters of around 200 miR that have different expression levels in DOCA+salt males. Our analysis identified around 74 upregulated miRNA in DOCA+salt males compared to DOCA+salt females. The maximum level of expression belonged to the muscle-specific miRNA (myomiR) miR-1a-3p, miR-206-3p and miR-26a-5p which were highly accumulated in CSF derived exosomes. These top three upregulated miRNA were associated with 282 validated target genes among which, two pivotal genes, ACE2 and ADAM17, were identified in the PPI network, miRTargetLink, and by KEGG analysis. miR-26a-5p was mostly associated with ACE2 and ADAM17 and the mRNA expression of ADAM17 was associated with reduced miR-206-3p. In conclusion, our bioinformatic analysis identified three miRNA and associated them with two key molecules involved in salt sensitive hypertension. Further analysis is likely to highlight more diagnostic biomarkers and potential candidates for the development of new therapeutic approaches. This work was supported in part by a research grant from the National Institutes of Health (HL163588). This is the full abstract presented at the American Physiology Summit 2024 meeting and is only available in HTML format. There are no additional versions or additional content available for this abstract. Physiology was not involved in the peer review process.

Identification of an active RNAi pathway in Candida albicans

RNA interference (RNAi) is a fundamental regulatory pathway with a wide range of functions, including regulation of gene expression and maintenance of genome stability. Although RNAi is widespread in the fungal kingdom, well-known species, such as the model yeast Saccharomyces cerevisiae, have lost the RNAi pathway. Until now evidence has been lacking for a fully functional RNAi pathway in Candida albicans, a human fungal pathogen considered critically important by the World Health Organization. Here, we demonstrated that the widely used C. albicans reference strain (SC5314) contains an inactivating missense mutation in the gene encoding for the central RNAi component Argonaute. In contrast, most other C. albicans isolates contain a canonical Argonaute protein predicted to be functional and RNAi-active. Indeed, using high-throughput small and long RNA sequencing combined with seamless CRISPR/Cas9-based gene editing, we demonstrate that an active C. albicans RNAi machinery represses expression of subtelomeric gene families. Thus, an intact and functional RNAi pathway exists in C. albicans, highlighting the importance of using multiple reference strains when studying this dangerous pathogen.

Extracellular vesicles involved in growth regulation and metabolic modulation in Haematococcus pluvialis

BackgroundMicroalgae-derived extracellular vesicles (EVs), which transfer their cargos to the extracellular environment to affect recipient cells, play important roles in microalgal growth and environmental adaptation. And, they are also considered as sustainable and renewable bioresources of delivery nanocarrier for bioactive molecules and/or artificial drug molecules. However, their molecular composition and functions remain poorly understood.ResultsIn this study, isolation, characterization, and functional verification of Haematococcus pluvialis-derived EVs (HpEVs) were performed. The results indicated that HpEVs with typical EV morphology and size were secreted by H. pluvialis cells during the whole period of growth and accumulated in the culture medium. Cellular uptake of HpEVs by H. pluvialis was confirmed, and their roles in regulation of growth and various physiological processes of the recipient cells were also characterized. The short-term inhibition of HpEV secretion results in the accumulation of functional cellular components of HpEVs, thereby altering the biological response of these cells at the molecular level. Meanwhile, continuously inhibiting the secretion of HpEVs negatively influenced growth, and fatty acid and astaxanthin accumulation in H. pluvialis. Small RNA high-throughput sequencing was further performed to determine the miRNA cargoes and compelling details in HpEVs in depth. Comparative analysis revealed commonalities and differences in miRNA species and expression levels in three stages of HpEVs. A total of 163 mature miRNAs were identified with a few unique miRNAs reveal the highest expression levels, and miRNA expression profile of the HpEVs exhibited a clear stage-specific pattern. Moreover, a total of 12 differentially expressed miRNAs were identified and their target genes were classified to cell cycle control, lipid transport and metabolism, secondary metabolites biosynthesis and so on.ConclusionIt was therefore proposed that cargos of HpEVs, including miRNA constituents, were suggested potential roles in modulate cell physiological state of H. pluvialis. To summarize, this work uncovers the intercellular communication and metabolism regulation functions of HpEVs.

Milk exosomal microRNA profiling identified miR-375 and miR-199-5p for regulation of immune response during subclinical mastitis of crossbred cattle.

The dairy industry has experienced significant economic losses as a result of mastitis, an inflammatory disease of cows, including both subclinical and clinical cases. Milk exosome microRNAs have gained attention due to their stable and selective wrapping nature, offering potential for the prognosis and diagnosis of bovine mastitis, the most common pathological condition of the mammary gland. In the present investigation, the microRNA profile of milk exosomes was explored using high-throughput small RNA sequencing data in sub-clinical mastitic and healthy crossbred Vrindavani cattle. In both groups, 349 microRNAs were identified, with 238 (68.19%) microRNAs co-expressed; however, 35 and 76 distinct microRNAs were found in subclinical mastitic and healthy cattle, respectively. Differential expression analysis revealed 11 microRNAs upregulated, and 18 microRNAs were downregulated in sub-clinical mastitic cattle. The functional annotation of the target genes of differentially expressed known and novel microRNAs including bta-miR-375, bta-miR-199-5p and bta-miR-12030 reveals their involvement in the regulation of immune response and inflammatory mechanisms and could be involved in development of mastitis. The analysis of milk exosomal miRNAs cargos hold great promise as an approach to study the underlying molecular mechanisms associated with mastitis in high milk producing dairy cattle. Concurrently, the significantly downregulated miR-375 may upregulate key target genes, including CTLA4, IHH, IRF1, and IL7R. These genes are negative regulators of immune response pathways, which could be associated with impaired inflammatory mechanisms in mammary cells. According to the findings, bta-miR-375 could be a promising biomarker for the development of mastitis in dairy cattle.

Circ_0008146 Exacerbates Ferroptosis via Regulating the miR-342-5p/ACSL4 Axis After Cerebral Ischemic/Reperfusion.

Acute ischemic stroke (AIS) has seriously threatened people's health worldwide and there is an urge need for early diagnosis and effective treatment of AIS. This research intended to clarify the regulatory role of circ_0008146/miR-342-5p/ACSL4 axis in AIS. High-throughput small RNA sequencing analysis was adapted to identify differentially expressed miRNAs between the AIS and control group. The circ_0008146, miR-342-5p, and ACSL4 levels were detected by qRT-PCR. Middle cerebral artery occlusion/reperfusion (MCAO/R) models were constructed in C57BL/6J mice. Assay kits were used to determine Fe2+ levels and a battery of oxidative stress and lipid peroxidation indicators, including ROS, MDA, LPO, SOD and GSH/GSSG ratio. The protein levels of ACSL4 were measured by Western blot. The behavioral function was assessed using neurobehavioral tests. TTC staining was employed to visualize infarction size. Nissl staining was adapted to detect histopathological changes. Receiver operating characteristic curve and correlation analysis were applied to investigate the clinical value and association of miR-342-5p and ACSL4. A total of 44 AIS patients and 49 healthy controls were enrolled in our study. The small RNA sequencing unveiled a significant decrease in miR-342-5p levels in AIS patients. MiR-342-5p inhibited oxidative stress and RSL3-induced ferroptosis after cerebral ischemic/reperfusion injury in vivo by targeting ferroptosis-related gene ACSL4. Circ_0008146 acted as a sponge of miR-342-5p, and overexpression of circ_0008146 increased neurological deficits and brain injury in mice. Circ_0008146 contributed to ferroptosis in cerebral infarction via sponging miR-342-5p to regulate ACSL4. Plasma miR-342-5p and ACSL4 demonstrated significant correlation and good diagnostic value for AIS patients. This study provides the first in vivo evidence to show that circ_0008146 exacerbates neuronal ferroptosis after AIS via the miR-342-5p/ACSL4 axis. Furthermore, miR-342-5p/ACSL4 axis holds promise as a viable therapeutic target and practical biomarkers for AIS patients.

Comparative miRNA expression profile analysis of porcine ovarian follicles: new insights into the initiation mechanism of follicular atresia.

Follicular atresia occurs in every stage of ovarian development, which is relevant to female fertility. In the past decade, increasing studies have confirmed that miRNAs, a class of short non-coding RNAs, play an important role in follicular atresia by post-transcription regulation of their target genes. However, the function of miRNAs on follicular atresia initiation is unknown. In the present study, high-throughput small RNA sequencing was performed to analyze differential miRNA expression profiles between healthy (HF) follicles and early atretic (EAF) follicles. A total of 237 conserved miRNA were detected, and the miR-143 is the highest expressed in follicles. Meanwhile, we also found wide sequence variations (isomiRs) in porcine ovarian miRNA, including in 5'un-translation region, core seed sequences and 3'untranslation region. Furthermore, we identified 22 differentially expressed miRNAs in EAF groups compared to HF group, of which 3 miRNAs were upregulated, as well as 19 miRNAs were downregulated, and then the RT-PCR was performed to validate these profiles. The target genes of these differentially expressed miRNAs were predicted by using miRwalk, miRDB, and Targetscan database, respectively. Moreover, the gene ontology and KEGG pathway enrichment established that the regulating functions and signaling pathways of these miRNAs contribute to follicular atresia initiation and cell fate. In conclusion, this study provides new insights into the changes of miRNAs in early atretic follicles to demonstrate their molecular regulation in ovarian follicular atretic initiation.

Isolation and Enrichment of Extracellular Vesicles with Double-Positive Membrane Protein for Subsequent Biological Studies.

The isolation and enrichment of specific extracellular vesicle (EV) subpopulations are essential in the context of precision medicine. However, the current methods predominantly rely on a single-positive marker and are susceptible to interference from soluble proteins or impurities. This limitation represents a significant obstacle to the widespread application of EVs in biological research. Herein, a novel approach that utilizes proximity ligation assay (PLA) and DNA-RNA hybridization are proposed to facilitate the binding of two proteins on the EV membrane in advance enabling the isolation and enrichment of intact EVs with double-positive membrane proteins followed by using functionalized magnetic beads for capture and enzymatic cleavage for isolated EVs release. The isolated subpopulations of EVs can be further utilized for cellular uptake studies, high-throughput small RNA sequencing, and breast cancer diagnosis. Hence, developing and implementing a specialized system for isolating and enriching a specific subpopulation of EVs can enhance basic and clinical research in this field.

Motility-related microRNAs identified in pig seminal plasma exosomes by high-throughput small RNA sequencing

Boar fertility is a key determinant of the production efficiency of the whole pig breeding industry and boar sperm motility is the seminal parameter with the greatest impact on the fecundity of a sow. Exosomes are small, extracellular vesicles found in many body fluids. Seminal plasma exosomes, which are secreted by the epididymis, prostate, seminal vesicles, and testes, contain a large number of miRNAs, the types and levels of which can reflect the physiological state of source cells. It has been shown that the expression profile of seminal plasma exosomal miRNA differs between low-motility semen and normal semen. The aim of this study was to investigate the relationship between semen motility and exosomal miRNA profiles to obtain information that would allow to predict boar fertility, as well as contribute to the understanding of the mechanisms by which exosomal miRNAs regulate semen motility. Three high-motility (semen motility >90 %) and three low-motility (semen motility <80 %) semen samples were collected from Landrace and Yorkshire boars, respectively, and seminal plasma exosomes were extracted by ultracentrifugation. Exosome characterization was performed using transmission electron microscopy, NTA, and Western blot. The expression profiles of exosomal miRNAs associated with semen motility in the two boar breeds were subsequently determined by small RNA sequencing. The results showed that 297 known miRNAs and 295 novel RNAs were co-expressed in the four groups. Notably, six miRNAs (ssc-miR-122–5p, ssc-miR-486, ssc-miR-451, ssc-miR-345–3p, ssc-miR-362, and ssc-miR-500–5p) were found to be differentially expressed in both boar breeds. Enrichment analysis of the target genes of the differentially expressed miRNAs showed that they were mainly involved in biological processes such as regulation of transcription from RNA polymerase II promoter, regulation of gene expression, and intracellular signal transduction and signaling pathways such as the PI3K-Akt, MAPK, and Ras signaling pathways. The six differentially expressed miRNAs identified in this study have significant potential as noninvasive markers of boar semen motility. Meanwhile, the results of the enrichment analysis provide novel insights into the mechanisms underlying the regulation of semen motility.

MiR-1246b, a novel miRNA molecule of extracellular vesicles in bronchoalveolar lavage fluid, promotes nodule growth through FGF14 in patients with lung cancer

With the widespread development of chest computed tomography (CT), the detection rate of pulmonary nodules has increased; therefore, the classification of benign vs. malignant nodules has become a common problem in the clinic. MicroRNA, a potential tool, is expected to become a good choice for diagnosing and studying the occurrence and development of diseases through the vector of bronchoalveolar lavage fluid extracellular vesicles (BALF-EVs). In this study, radial endobronchial ultrasound (R-EBUS) was used to locate pulmonary nodules in patients. BALF was obtained, EVs were isolated, and small RNA sequencing was performed to screen differentially expressed miRNAs between benign and malignant pulmonary nodules. The binding targets and underlying mechanisms of the differentially expressed miRNAs were verified by in vitro and in vivo experiments. R-EBUS localization and sampling was used to obtain BALF, and EVs were successfully isolated and characterized. Differentially expressed miRNAs in BALF-EVs of patients with benign vs. malignant pulmonary nodules were screened by high-throughput small RNA sequencing. A new miRNA, miR-1246b, was identified. We found that FGF14 was the binding target of miR-1246b by luciferase assay. Subsequent mechanistic studies showed that miR-1246b inhibited the expression of FGF14 in lung cancer cells, further leading to ERK phosphorylation and epithelial-to-mesenchymal transition (EMT), which ultimately contributed to lung cancer cell proliferation, migration and invasion. In summary, our study demonstrates that the detection of miRNAs in BALF-EVs, a means of liquid biopsy, could assist in distinguishing malignant nodules from benign nodules. miR-1246b, which was extracted from BALF-EVs, targets FGF14 to promote lung cancer cell proliferation, migration and invasion.