High-throughput Genotyping Assays Research Articles

Frequencies of single nucleotide polymorphisms and haplotypes of organic anion transporting polypeptide 1B1 SLCO1B1 gene in a Finnish population

Organic anion transporting polypeptide 1B1 (OATP1B1) is a drug uptake transporter located at the sinusoidal membrane of hepatocytes. Our aim was to establish high-throughput genotyping assays for the major known single nucleotide polymorphisms (SNP) in the SLCO1B1 gene encoding OATP1B1 and to investigate the frequencies of SNPs and haplotypes of SLCO1B1 in a large Caucasian population. Distribution of SLCO1B1 alleles was determined in 468 healthy Finnish Caucasian subjects at 11 variant sites spanning the entire gene by using allelic discrimination with TaqMan 5' nuclease assays. The allelic frequencies of SLCO1B1 SNPs were 9.7% for g.-11187G>A, 0.4% for g.-11110T>G, 8.0% for g.-10499A>C, 46.2% for c.388A>G, 13.1% for c.411G>A, 13.1% for c.463C>A, 20.2% for c.521T>C, 53.2% for c.571T>C, 46.4% for c.597C>T, 4.0% for c.1929A>C and 48.8% for c.*439T>G. Altogether, 26 haplotypes were statistically inferred. The most common haplotype, with a frequency of 35.6%, contained variant allele C at position c.571, but had the reference nucleotide at all other positions investigated. The functionally significant c.521T>C SNP existed in four major haplotypes, which could be differentiated by the g.-11187G>A, g.-10499A>C and c.388A>G SNPs. The frequencies of these haplotypes were 7.9% for g.-11187G/g.-10499C/c.388G/c.521C (*16), 6.9% for AAGC (*17), 2.7% for GAAC (*5) and 2.4% for GAGC (*15). Sequence variations of SLCO1B1 occur at high frequencies in the Caucasian population. Further studies are needed to characterise the effects of SLCO1B1 haplotypes, especially *16, *17, *15 and *5, on drug pharmacokinetics and response, and to determine the frequencies of SLCO1B1 SNPs and haplotypes in different populations.

Development and cross-validation of sequencing-based assays for genotyping common polymorphisms of the CXCL5 gene

Background Epithelial neutrophil activating peptide (ENA-78) is encoded by the polymorphic CXCL5 gene and is a recruiter and activator of neutrophils. Furthermore, ENA-78 may be involved in pathological inflammatory processes and variable drug responses. Methods To facilitate future disease–gene and pharmacogenetic investigation of ENA-78, we developed and cross-validated medium- to high-throughput genotyping assays for 2 commonly occurring CXCL5 polymorphisms (rs352046 and rs425535). Furthermore, we compared allele and genotype frequencies in a U.S. population with those of a previously studied European population. Results There was 100% genotype concordance between the 2 methods used (Pyrosequencing® and TaqMan®). Variant allele frequencies for rs352046 were consistent between the U.S. (16%) and European (16%) populations, while the rs425535 variant allele was more than twice as high in the European cohort (38% vs. 16%). There was complete linkage of genotypes at both loci in our population. Conclusions The distribution of variant alleles for the 2 polymorphisms studied should be further evaluated in other populations. In addition, our data highlight the importance of assay validation using multiple platforms.

A Simple Automated DNA Extraction Method for Dried Blood Specimens Collected on Filter Paper

We developed a simple, inexpensive, and automated procedure for the extraction of genomic DNA from dried blood specimens (DBS) collected on filter paper. This DNA extraction method involves two simple steps. First, the DBS is treated with methanol. Genomic DNA is then extracted with Tris buffer in a heat incubation step. The use of common inexpensive chemicals such as methanol and Tris buffer makes this method very cost efficient. The isolated DNA samples can then be used for high-throughput genotyping assays. Both DNA extraction and PCR setup steps have been adapted for use with a Beckman Coulter core robotic system.

Lifestyles of Colletotrichum acutatum.

Lifestyles of Colletotrichum acutatum.

Rapid Detection of the C−1496G Polymorphism in the CYP2D6 *2 Allele

The CYP2D6 gene, encoding debrisoquine hydroxylase, is involved in the metabolism of a large number of medications (1). Recently, Raimundo et al. (2) described a C−1496G polymorphism in the promoter region of the CYP2D6 *2 allele that has a strong effect on debrisoquine metabolic phenotype when present in combination with a null allele. The *2 allele is the most common allele encoding intermediate debrisoquine hydroxylase activity in Caucasians (3), but to date, substantial variability among *2 carriers in metabolic activity has been reported. To accurately predict debrisoquine phenotype from CYP2D6 genotype in *2 carriers, determining C−1496G genotype will be necessary. We sought to develop a rapid, high-throughput genotyping assay for the CYP2D6 C−1496G promoter polymorphism described by Raimundo et al. (2). Because no available restriction enzyme differentially digests the polymorphic site (4), we introduced a Bsr I restriction site (actggn∧) into the amplicon using a forward primer with a 3′ single-nucleotide mismatch (underlined and in bold). The primers 2D6–1496F [gcctggacaacttggaagaac t ; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D6–1496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon. The following were mixed with 1 μL of genomic DNA at 0.23–1.1 μg/μL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 μL: 2.5 μL of 10× PCR buffer (Applied Biosystems); 0.5 μL of 10 mM dNTP (Amersham Pharmacia Biotech); 0.1 …

High-throughput genotyping assay approaches.

High-throughput genotyping approaches are being developed to meet the demands of pharmacogenomnics, where numerous individuals are studied with thousands of single nucleotide polymorphism (SNP) markers. All non-gel-based genotyping approaches achieve allelic discrimination by one of four mechanisms: allele-specific hybridisation, allele-specific primer extension, allele-specific oligonucleotide ligation and allele-specific cleavage of a flap probe. By combining one of these allelic discrimination mechanisms with either a homogeneous or solid-phase reaction format and a detection method such as fluorescence intensity, fluorescence polarisation or mass spectrometry, a number of viable high-throughput genotyping methods have been developed and are being readied for routine use. With the biochemistry for robust genotyping in place, good engineering solutions are needed to make high-throughput genotyping a reality.

From gels to chips: "minisequencing" primer extension for analysis of point mutations and single nucleotide polymorphisms.

In the minisequencing primer extension reaction, a DNA polymerase is used specifically to extend a primer that anneals immediately adjacent to the nucleotide position to be analyzed with a single labeled nucleoside triphospate complementary to the nucleotide at the variant site. The reaction allows highly specific detection of point mutations and single nucleotide polymorphisms (SNPs). Because all SNPs can be analyzed with high specificity at the same reaction conditions, minisequencing is a promising reaction principle for multiplex high-throughput genotyping assays. It is also a useful tool for accurate quantitative PCR-based analysis. This review discusses the different approaches, ranging from traditional gel-based formats to multiplex detection on microarrays that have been developed and applied to minisequencing assays.