Rapid Detection of the C−1496G Polymorphism in the CYP2D6 *2 Allele

Abstract

The CYP2D6 gene, encoding debrisoquine hydroxylase, is involved in the metabolism of a large number of medications (1). Recently, Raimundo et al. (2) described a C−1496G polymorphism in the promoter region of the CYP2D6 *2 allele that has a strong effect on debrisoquine metabolic phenotype when present in combination with a null allele. The *2 allele is the most common allele encoding intermediate debrisoquine hydroxylase activity in Caucasians (3), but to date, substantial variability among *2 carriers in metabolic activity has been reported. To accurately predict debrisoquine phenotype from CYP2D6 genotype in *2 carriers, determining C−1496G genotype will be necessary. We sought to develop a rapid, high-throughput genotyping assay for the CYP2D6 C−1496G promoter polymorphism described by Raimundo et al. (2). Because no available restriction enzyme differentially digests the polymorphic site (4), we introduced a Bsr I restriction site (actggn∧) into the amplicon using a forward primer with a 3′ single-nucleotide mismatch (underlined and in bold). The primers 2D6–1496F [gcctggacaacttggaagaac t ; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D6–1496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon. The following were mixed with 1 μL of genomic DNA at 0.23–1.1 μg/μL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 μL: 2.5 μL of 10× PCR buffer (Applied Biosystems); 0.5 μL of 10 mM dNTP (Amersham Pharmacia Biotech); 0.1 …