Hepatoma 5123D Research Articles

Difference in Gene Expression between Azo-Dye-Induced Primary Hepatomas and Corresponding Transplantable Ascites Hepatoma Lines in Rats

Using RNA blot analysis, we examined the relatedness of gene expression of several rat ascites hepatoma lines (AH) to azo-dye-induced primary hepatomas (PH). Four cDNA clones previously defined as containing sequences abundantly expressed in various tumor lines showed virtually the same pattern on both RNA blots of an AH line, AH60C and of PH, thereby indicating that the tumor-abundant expression of the sequences is also well retained in PH. Expression of ras and myc oncogenes in AH was the same as that in PH. However, liver-specific mRNAs such as albumin and apoprotein A-1 mRNA were expressed in normal liver and PH, but to a much lesser extent in AH60C. alpha-Fetoprotein was expressed in PH, but little in the normal liver and, if any, very little in AH60C. alpha 2u-Globulin was not expressed in either AH60C or PH. Semiquantitative RNA dot blot analyses revealed that the different expressions of certain genes between AH60C and PH observed above also hold true, even in case of other AH lines and a solid tumor line, Morris hepatoma 5123D. Southern blot analyses of the genomic DNAs showed that the different expressions might have occurred, with no major alteration in the gene structure.

Tissue-Specific Changes in Chromatin Structure of the Rat Aldolase B Locus1

Chromatin structures of the aldolase B gene locus in repressed and derepressed states were examined by DNase I digestion. Within the gene locus, several structural features were observed with respect to the sensitivity to DNase I; hypersensitive sites, relatively resistant regions, and preferential cleavage sites within the resistant regions. The hypersensitive sites and the resistant regions are tissue- or cell-specifically distributed, but are not simply related to the active or inactive state chromatin. Among these structural features, however, a DNase I-hypersensitive site located about 0.3 kilobase pairs (kb) upstream from the transcription-initiation site is characteristic only in transcriptionally active tissues or cells (liver, kidney and Morris hepatoma 5123D). In addition, analysis with nuclei of fetal liver cells indicated that this hypersensitive site is constructed prior to the transcriptional activation of the aldolase B gene during development. These results may indicate that the structural alteration in chromatin at the 0.3 kb upstream site is related to the regulation of the aldolase B gene expression.

Purification, induction, and distribution of placental glutathione transferase: a new marker enzyme for preneoplastic cells in the rat chemical hepatocarcinogenesis.

A polypeptide of Mr 26,000 and pI 6.7 that was markedly increased in rat livers bearing hyperplastic nodules (HNs) induced by chemical carcinogens was identified immunochemically as the subunit of neutral glutathione (GSH) transferase (GSHTase; RX:glutathione R-transferase, EC 2.5.1.18; also called GSH S-transferase) purified from placenta (GSHTase-P) and was demonstrated immunohistochemically to be localized in preneoplastic foci and HNs. In the present study, GSHTase-P has been purified from the HN-bearing liver, and the distribution and inducibility have been examined quantitatively using anti-GSHTase-P antibody. Elevation of GSHTase-P in the HN-bearing livers was also confirmed by in vitro translation of mRNAs isolated from the HN-bearing livers. The purified GSHTase-P was homogeneous in size but had two charge isomers on two-dimensional gel electrophoresis. In normal tissues, including liver, placenta, and fetal liver, the protein content of GSHTase-P was generally low but was significantly high in kidney and pancreas. In contrast, the amount of GSHTase-P in HN-bearing livers (primary hepatomas) and transplantable Morris hepatoma 5123D were several 10-fold higher than that in normal liver but were undetectably low in transplantable Yoshida ascites hepatoma AH 130. Different from ordinary drug-metabolizing enzymes, GSHTase-P was uninducible by administration of drugs and carcinogens prior to appearance of the preneoplastic foci and HNs. In addition, species specificity of GSHTase-P was low as it was crossreactive among rat, hamster, and human.

Microsomal monooxygenase system in morris hepatoma: Purification and characterization of cytochromes p-450 from morris hepatoma 5123D of 3-methylcholanthrene-treated rats

Two forms of cytochrome P-450 (hepatoma P-450 MCI and P-450 MCII were purified from hepatoma 5123D microsomes of tumor-bearing rats treated with 3-methylcholanthrene. Hepatoma P-450 MCI had a specific content of 18.4 nmol/mg protein and showed a main protein band with a minimum molecular weight of 56,000 on sodium dodecyl sulfate-polyacrylamide gel. Hepatoma P-450 MCII had a specific content of 7.38 nmol/mg protein and a minimum molecular weight of 50,000. The carbon monoxidereduced difference spectral peak of hepatoma P-450 MCI was at 446.5 nm, whereas the peak of hepatoma P-450 MCII was at 451 nm. In the reconstituted system, hepatoma P-450 MCI catalyzed 3-hydroxylation of benzo[ a]pyrene and O-deethylation of 7-ethoxycoumarin, but showed low activities for N-demethylation of benzphetamine and aminopyrine, O-demethylation of p-nitroanisole, and p-hydroxylation of aniline. On the other hand, hepatoma P-450 MCII did not catalyze hydroxylation of any of the substrates tested. By Ouchterlony double-diffusion analysis, hepatoma P-450 MCI was immunologically indistinguishable from rat liver cytochrome P-450 c, but hepatoma P-450 MCII was distinct from hepatoma P-450 MCI and rat liver cytochrome P-450 c. Peptide maps of hepatoma P-450 MCI and rat liver cytochrome P-450 c after proteolysis with Staphylococcus aureus V8 protease demonstrated the similarity of the two cytochromes P-450.

Immunocytochemical detection of oncomodulin in tumor tissue.

Using the rat hepatoma calcium-binding protein, oncomodulin, from Morris hepatoma 5123tc, an antiserum has been raised in rabbits useful for immunostaining of this tumor protein. The peroxidase-antiperoxidase (PAP) technique has been used to demonstrate oncomodulin in sections of Morris rat hepatomas 5123D, 5123tc, 7288Ctc, and 7777 fixed with Bouin's or Carnoy's fixatives, or using freeze substitution. Oncomodulin-specific staining was also shown by a hepatoma metastasis in lung. Optimal conditions for the indirect fluorescent antibody technique were established to demonstrate oncomodulin in virally transformed NRK cells (ASV-NRK). In both tumors and cultured neoplastic cells staining appeared which suggested that oncomodulin might occur in nucleus and cytoplasm. Normal untransformed tissues and uninfected cells did not show oncomodulin staining.

Regulation and expression of carbamyl phosphate synthetase I mRNA in developing rat liver and Morris hepatoma 5123D.

A cDNA clone complementary to mRNA encoding the precursor (Mr = 165,000) to the rat liver mitochondrial matrix enzyme carbamyl phosphate synthetase I (Mr = 160,000) was employed to compare relative amounts of the messenger in adult and fetal liver and in Morris hepatoma 5123D and 3924A cells. Northern blot analysis gave a size estimate for the messenger of 6,500-6,700 nucleotides. Carbamyl phosphate synthetase mRNA levels in 15-day-old fetal liver were less than 10% of adult levels; 5123D cells expressed the messenger at levels about 2-fold higher than normal adult liver, but the messenger was undetectable in 3924A cells. Albumin mRNA was also expressed in the former but not in the latter. Maintaining rats for 5 days on a diet containing 60% casein augmented the relative amount of carbamyl phosphate synthetase mRNA by about 2-fold, while a protein-free diet resulted in reduced levels of the mRNA (about 50% compared to animals on a normal diet). Finally, the pattern of hybridization of carbamyl phosphate synthetase cDNA to HindIII-digested genomic DNA showed no differences between normal liver and its corresponding hepatoma; however, a HindIII site polymorphism was observed between Buffalo and ACI rats.

Amplification and over-expression of the c-myc gene in Morris hepatomas.

Morris hepatoma 7794A was found to have its c-myc gene amplified 5- to 10-fold. The over-expression of c-myc was observed in all three hepatomas studied (Morris hepatomas 5123D, 7136A and 7794A), although in the first two instances the c-myc genes were not amplified. Over-expression or deregulation of c-myc seems to be a general phenomenon associated with hepatoma.

Cloning of sequences expressed specifically in tumors of rat.

The sequences specifically transcribed in tumor cells are believed to be closely related to transformed phenotypes. For the isolation of such sequences, a cDNA clone library was constructed by using poly(A)+ RNAs from azo-dye-induced rat ascites hepatomas. Thirty-one tumor RNA-responsive clones were isolated by screening 4,000 clones of this library with conventional techniques, differential colony hybridization, and RNA blot hybridization. These clones were categorized into two groups with respect to their size distribution of mRNAs from which clones were derived. The first group was complementary to a single distinct species, either about 1.5 or 0.6 kilobases in length, of poly(A)+ RNA, and the second showed no distinct bands but a smear on a RNA blot. Semiquantitative RNA dot blot assays revealed that the sequences of these clones were expressed very little, if at all, in normal and regenerating livers, while generally high in ascites hepatomas. This specificity was also true for other solid lines of tumors, such as Morris hepatoma 5123D of Buffalo rat and Walker 256 carcinosarcoma of Wistar rat. The smear class sequences were transcribed from middle-repetitive sequences of DNA, indicating that a class of middle-repetitive sequences is specifically transcribed in tumor cells.

Effects of glucagon on biosynthesis of the mitochondrial enzyme, carbamoyl-phosphate synthase I, in primary hepatocytes and Morris hepatoma 5123D

When freshly-dispersed rat hepatocytes are maintained in primary monolayer cultures, they quickly lose their capacity to synthesize the urea cycle enzyme, carbamoyl-phosphate synthase. The ability to synthesize many other proteins, e.g., serum proteins including albumin, is retained. After an initial recovery period following cell isolation (24–48 h), glucagon is able to restore the ability of cultured hepatocytes to make carbamoyl-phosphate synthase. mRNA encoding the enzyme is about 4-times higher in hepatocytes maintained for 48 h in the presence of glucagon compared to hepatocytes without the hormone, as judged by in vitro translational assays. The level of carbamoyl-phosphate synthase activity expressed in transformed hepatocytes is unique to each hepatoma. Here we show that Morris hepatoma 5123D has retained such expression, and actively synthesizes the enzyme when 5123D cells are placed in monolayer cultures. Unlike normal hepatocytes, however, synthesis continues uninterrupted at a high level whether or not glucagon is present. 5123D has higher levels of translatable carbamoyl-phosphate synthase mRNA than normal liver.

TRNA alterations in cancer.

1. 3H-, 125I-, and 32P-labeling methods were developed for base composition and sequence analysis of minute amounts of nonradioactive nucleic acids containing modified constituents. 2. Base composition analysis showed tRNA from two "liver-like" minimal deviation hepatomas, Morris hepatomas 5123D and 7777, to exhibit typical alterations when compared with liver tRNA. Our observations, which were made for different transplant generations of the tumors, indicated a trend toward undermethylation and undermodification of tRNA. 3. Sequence analysis of several cytoplasmic and mitochondrial tRNAs from hepatoma 5123D showed partial lack of m2G and complete lack of Gm and Q. 4. Sequence analysis of mitochondrial tRNAs from hepatoma 5123D indicated several instances of alterations of primary structure, a phenomenon not previously observed for cytoplasmic tRNAs from neoplasms. 5. Biochemical mechanisms underlying these alterations, as well as their functional implications, have yet to be investigated. 6. Modification patterns, but not primary structures, of mitochondrial tRNAs have been highly conserved when compared to prokaryotic and eukaryotic cytoplasmic tRNAs. This implies that (a) post-transcriptional modifications must play a crucial role in tRNA function, and (b) alterations of post-transcriptional modifications in tumor tRNAs have to be regarded as highly significant deviations from the norm.

Modifications in alpha 2u globulin gene structure, transcription, and mRNA translation in hepatomas.

alpha 2u globulin synthesis ceases when a liver cell becomes malignant. We have compared the structure and transcription of the alpha 2u globulin genes in Morris hepatomas 5123D and 7793 with that of normal hepatic genes using alpha 2u globulin cDNA as a hybridization probe. No alpha 2u globulin mRNA was detected in hepatoma 7793 by cell-free translation, Northern blot, or R0t analysis. In hepatoma 5123D, however, a small number of alpha 2u globulin RNA sequences were detected by Northern blot and R0t analysis, but this RNA was not detectably translationally active either in vivo or in an in vitro cell-free translational system. No structural differences between normal liver and the hepatoma alpha 2u globulin genes were observed by Southern blot analysis of genomic DNA digested with restriction endonucleases Pst I, Bam HI, or Ava I. However, a general demethylation of cytosine residues in the alpha 2u globulin genes of hepatomas has been found using the restriction enzyme Hha I and the isoschizomeric pair of restriction enzymes Msp I and Hpa II. Therefore, loss of the alpha 2u globulin phenotype in these hepatomas is accompanied by extensive demethylation of DNA sequences within and/or immediately flanking the alpha 2u globulin genes.

Tumor mitochondrial transfer RNAS: The nucleotide sequence of mitochondrial tRNA LeuUAG from morris hepatoma 5123D

Summary A leucine tRNA (anticodon UAG) was isolated from the mitochondria of a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pACUUU/GUAUm 1 Am 2 GGAUAGAAGDAAUCCAUUGGUCU UAG m 1 GAACCAAAAACm 5 CUUGGUGCAACUCCAAAUAAAAGUACCA OH , can be arranged in cloverleaf form. It exhibits several unusual features, such as the absence of the constant GG sequence in loop I, the presence of a G11·C23 base pair in the stem of this loop, the presence of UGC instead of the constant TUC (UUC) in loop IV, a short variable arm, predominance of A·U base pairs, and the presence of m 1 A in position 9. The other modified nucleosides (N 2 -methylguanosine, dihydrouridine, pseudouridine, 1-methylguanosine, and 5-methylcytidine) occupy expected positions. In position 5, 2 nucleosides (uridine + guanosine) were found, possibly signifying a tumor-specific point mutation in mitochondrial DNA.

Further studies on the increase in drug-metabolizing capacity adjacent to intrahepatic Morris hepatomas

Microsomal cytochrome P-450 content was higher in histologically non-tumorous liver adjacent to intrahepatically implanted Morris hepatomas 5123D or 7795 than in histologically normal liver far removed from each tumor. V max values for microsomal benzo[ a]pyrene monooxygenase activity and cyclophosphamide activation were also significantly higher in tumor-adjacent liver than in normal liver far removed from tumor. K m values of these reactions were unchanged. After intrahepatic implantation, inert spheres of several different materials produced no regional differences in hepatic microsomal cytochrome P-450 content. Both intrahepatic Morris hepatomas exhibited markedly reduced cytochrome P-450 content and benzo[ a]pyrene monooxygenase activity. Cyclophosphamide biotransformation could not be detected in microsomes from either Morris hepatoma. Similar recoveries from microsomes of far-removed and tumor-adjacent liver indicated that differences between these regions in drug-metabolizing activity could not be attributed to different stabilities or sedimenting properties of their microsomes. Although microsomal recovery was significantly less from hepatomas than from far-removed or tumor-adjacent liver, this loss of tumor microsomes accounted for only a small part of the reductions in cytochrome P-450-mediated monooxygenases observed within tumors. Compared to control rats. tumor-bearing rats exhibited no change in hepatic drug-metabolizing capacity measured in vivo by hexobarbital sleeping times and antipyrine elimination rates. Phenobarbital (PB) pretreatment of tumor-bearing rats induced cytochrome P-450 to different extents within far-removed liver, tumoradjacent liver, and both hepatomas. The same differential inducibility occurred with PB pretreatment for cyclophosphamide activation. After PB induction, differences in drug-metabolizing activity between far-removed and tumor-adjacent liver disappeared; though induced, these activities remained lower in the hepatomas than in other regions. These changes in drug-metabolizing activity in both basal and PB-induced states of various hepatic regions were related to changes in cellularity of tumor-adjacent tissue. Hepatocellular nuclei prepared from tumor-containing liver were separated into diploid and tetraploid classes by sucrose density gradient centrifugation. Compared to far-removed liver, tumoradjacent liver contained significantly more diploid nuclei and less tetraploid nuclei.

Isolation and sequence analysis of two major leucine transfer ribonucleic acids (anticodon Mm-A-A) from a rat tumor, Morris hepatoma 5123D.

The nucleotide sequences of two major tRNALeu species (anticodon Mn-A-A)isolated from Morris hepatoma 5123D were determined by a combination of a newly developed thin-layer readout sequencing method [Gupta, R. C., & Randerath, K. (1979) Nucleic Acids Res. 6, 3443-3458] and additional 3H- and 32P-labeled derivative methods entailing chromatographic fingerprinting and base-specific enzymatic cleavages. The nucleotide sequence of the two hepatoma tRNAMm-A-ALeu species, one of which has U and the other of which has A in position 50 at the tip of the long extra arm, is pG-U-C-A-G-m2G-A-U-G-(m2)G-C-(ac4)C-G-A-G-U-G-G-D-C-psi-A-A-G-G-C-m22G-C-C-A-G-A--C-U-Mm-A-A-m1G*-psi-psi-C-U-G-G-L-(psi)U-C-C-G-U- or A-A-U-G-G-A-G-m5C-G-U-G-G-G-T-psi-C-G-m1A-A-U-C-C-C-A-C-U-U-C-U-G-A-C-A-C-C-AOH. These are the first leucine tRNA sequences from higher eukaryotes that have been determined. Noteworthy features of the mammalian leucine tRNAs are the presence of psi in the beta region of the D loop and the occurrence of three unknown hypermodified nucleosides (Mm, m1G*, and L) in positions 35, 38, and 45, respectively. m1G* was converted to m1G by treatment with alkali. Sequencing gels indicated that the parent base of the 2'-O-methylated nucleoside Mm may be a pyrimidine, probably a C derivative, as indicated by the chromatographic behavior of nucleotides containing Mm. The presence of a pyrimidine in the wobble position would be consistent with the antidodon sequence Mm-A-A and the leucine condons U-U-G and U-U-A. The occurrence of a hypermodified nucleoside, L, in the first position of the long extra arm appears unusual; thus far the only modified nucleoside found in this position is Um in eukaryotic serine tRNAs. Since all tRNAs with a long extra arm sequenced to date have a pyrimidine in this position, L is likely to be a pyrimidine, probably a U derivative, as inferred from chromatographic data.

Transcriptionally active RNA polymerases from Morris hepatomas and rat liver. Elucidation of the mechanism for the preferential increase in the tumour RNA polymerase I.

The amount and/or activity of DNA-dependent RNA polymerase I, Ii and III from resting liver, regenerating liver and a series of Morris hepatomas (5123D, 7800, 7777, 3924A) were determined after extraction of the enzymes from whole tissue homogenates and subsequent fractionation by DEAE-Sephadex column chromatography. When compared with resting liver, the tumours exhibited a characteristic enzyme pattern in which polymerase I, but not II, was increased. The increase in RNA polymerase I was proportional to the tumour growth rates. Alterations in polymerase III were confined to the most rapidly proliferating hepatomas. By contrast, all classes of RNA polymerase were found to be increased during liver regeneration. Relative to resting liver, the fastest growing tumour, 3924A, exhibited the highest activities and/or amounts of RNA polymerase I (8-fold) and III (5-fold) per g of tissue. These alterations in the tumour RNA polymerases were reflected in corresponding increases in the transcriptionally active (bound or chromatin-associated) enzyme population. The mechanisms underlying the augmented synthesis of RNA in vitro by bound polymerase I from hepatoma 3924A were elucidated by product analysis. The results indicated that, relative to liver RNA polymerase I, the tumour enzyme produced more nascent RNA chains and elongated these chains at a faster rate. The number of 3'-termini, as measured by incorporation into uridine, was higher in the hepatoma even under conditions which prevented re-initiation. suggesting increased amount of transcriptionally active RNA polymerase I in the tumour.

Effect of adenosine 3':5'-monophosphate and guanosine 3':5'-monophosphate on RNA release from isolated nuclei.

The addition of physiological concentrations of either cAMP or cGMP stimulated the release of RNA from isolated prelabeled rat liver nuclei to a fortified cytosol in a cell-free system. The released RNA was shown to be primarily mRNA by its binding to oligo(dT)-cellulose and its sedimentation profile. Treatment of rats with cAMP or cGMP 30 min prior to the preparation of cyclic nucleotides on the cell-free system. Cyclic nucleotides stimulation of RNA release occurred in systems prepared from resting rat liver, Novikoff hepatoma, and Morris hepatoma 5123D, but not the 18-h regenerating liver. The response of the cell-free system to added cyclic nucleotides reflected the in vivo concentration of these substances in the tissues from which the system was prepared. Those with high in vivo levels were not stimulated while those with lower levels did respond to added cyclic nucleotides. Neither cAMP nor cGMP had an appreciable effect on rRNA release.

Control of specific messenger RNA species in liver and hepatoma.

Two liver proteins subject to hormonal induction, α2u-globulin and tryptophan oxygenase, were absent from well-differentiated Morris hepatomas. Pulse [3H]-leucine incorporation studies in vivo demonstrated that in Morris hepatoma 5123D no synthesis of α2u-globulin occurs while the host liver synthesizes this protein at a normal rate. Using an in vitro translation system and polyadenylate-containing RNA isolated from host livers or hepatomas, the level of specific mRNA functionally capable of coding for α2u-globulin was determined. Host liver was found to contain α2u-globulin mRNA at normal levels whereas hepatoma tissue was devoid of functionally competent mRNA coding for this protein.

Neoplastic alterations of glucosamine 6-phosphate synthase in rat liver

Glucosamine 6-phosphate (GlcN-6-P) synthase catalyzes the formation of GlcN-6-P from fructose 6-phosphate and glutamine and is the rate-limiting enzyme for the biosynthesis of UDP-N-acetylglucosamine. In the rat, the enzyme is rich in proliferating and fetal tissues as well as those engaged in glycoprotein export and exists in multi-molecular forms. The enzyme purified from adult liver has a pI at 5.0 and differs in many respects from the major enzyme of adult brain. The latter form, with a pI of 4.1, is also found in early embryos. Sequential alterations in enzyme species thus occurs in the liver with the progress of differentiation. Upon the hepatocarcinogenesis, GlcN-6-P synthase undergoes profound alterations. The activity is especially high in fast growing ascites hepatomas, which possess as the major component the brain-type enzyme. In a Morris hepatoma (5123D), however, the liver form is replaced partially by a form with a pI of 4.3. Partial hepatectomy induces profound changes in GlcN-6-P synthase of the remnant liver. Following the operation, the transient and sequential appearance of the three forms with respective isoelectric points of 4.3, 4.8, and 4.5 is noted. Comparison of these alterations with those induced by laparotomy and by injection of the mixture of triiodothyronine, amino acids, glucagon and heparin enables us to postulate that the sequential appearance and disappearance of the 4.3 and 4.5 forms are associated with the proliferative cycle of regenerating liver. The 4.8 form is induced in response to surgical stress. The interrelation between GlcN-6-P synthase and tissue proliferation is discussed in the light of these results.

Inhibition of mitogen-induced lymphocyte blastogenesis by serum from tumor-bearing animals: Changes with tumor growth

Serum from rats bearing hepatoma 5123D was found to be inhibitory to the mitogen-induced blastogenic response of normal rat peripheral blood lymphocytes, and this inhibition increased with increasing tumor size. Tumor-bearer serum inhibited the phytohemagglutinin and concanavalin A responses at an earlier stage of tumor growth than the response to dextran sulfate. The concentration of phytohemagglutinin eliciting maximal incorporation of tritiated thymidine was 5 μl/ml for lymphocytes cultured in normal serum and 15 μl/ml for tumor-bearer serum. For concanavalin A the best response was at 2·5 μg/ml in both sera. For dextran sulfate 40 μg/ml elicited the maximal incorporation in normal serum while 20 μg/ml was found for tumor-bearer serum. In all cases, the maximal response at all mitogen levels was significantly less when tumor-bearer as opposed to normal serum was used. The inhibitory component(s) in the tumor-bearer serum was heat stable, nondializable and could be removed from the serum by exposure to normal lymphocytes.

Base composition studies on mitochondrial 4 S RNA from rat liver and Morris hepatomas 5123D and 7777

The major and modified base composition of mitochondrial 4 S RNA from rat liver and from Morris hepatomas 5123D and 7777 has been determined for 16 constituents using a chemical tritium-derivative method. The base composition of these mitochondrial 4 S RNA preparations was compared with the base composition of cytoplasmic and bacterial ( Escherichia coli B and Bacillus subtilis) 4-S RNAs. The results of these studies are: 1. 1. When compared with cytoplasmic 4 S RNA, the liver and hepatoma mitochondrial 4-S RNAs are characterized by high (A + U)/(G + C) ratios and low overall degrees of base methylation and modification. 2. 2. The mammalian mitochondrial 4-S RNAs are qualitatively even more different from the bacterial 4-S RNAs than from their cytoplasmic counterparts. Thus, several modified constituents found in both cytoplasmic and mitochondrial 4 S RNA are absent from the bacterial 4-S RNAs. 3. 3. Mitochondrial 4 S RNA from both hepatomas was found to be undermethylated and undermodified when compared with normal liver mitochondrial 4 S RNA. This trend is more pronounced for the rapidly growing hepatoma 7777 (i.e., 17% undermethylation) than for the more slowly growing hepatoma 5123D (i.e., 8% undermethylation). These findings are discussed in relationship to (1) results of other authors on composition of mitochondrial 4 S RNA, (2) special features of structure and biosynthesis of mitochondrial 4 S RNA, (3) the possible evolutionary origin of mitochondria and (4) the possible role played by aberrant mitochondrial 4 S RNA in altered mitochondrial protein synthesis in tumors.